ABCC7 p.Asp110His
[switch to full view]Comments [show]
PMID: 11278813
[PubMed]
Hammerle MM et al: "Disease-associated mutations in the extracytoplasmic loops of cystic fibrosis transmembrane conductance regulator do not impede biosynthetic processing but impair chloride channel stability."
No.
Sentence
Comment
75
TABLE I Oligonucleotide primers used to generate mutations Mutation Primer S108F GGAAGAATCATAGCTTtCTATGACCCGGATAAC Y109C AGAATCATAGCTTCCTgTGACCCGGATAACAAG D110H ATCATAGCTTCCTATcACCCGGATAACAAGGAG P111A ATAGCTTCCTATGACgCGGATAACAAGGAGGAA P111L ATAGCTTCCTATGACCtGGATAACAAGGAGGAA E116K CCGGATAACAAGGAGaAACGCTCTATCGCGATT R117C GATAACAAGGAGGAAtGCTCTATCGCGATTTAT R117H GATAACAAGGAGGAACaCTCTATCGCGATTTAT R117L GATAACAAGGAGGAACtCTCTATCGCGATTTAT R117P GATAACAAGGAGGAACcCTCTATCGCGATTTAT E217G ATGGGGCTAATCTGGGgGTTGTTACAGGCGTCT T908N TATGCAGTGATTATCAaCAGCACCAGTTCGTAT P1013L GTCGCAGTTTTACAACtCTACATCTTTGTTGCA FIG. 2.
X
ABCC7 p.Asp110His 11278813:75:155
status: NEW117 A, squares, wild type; circles, S108F; triangles, Y109C; diamonds, D110H; crosses, wild type without stimulation.
X
ABCC7 p.Asp110His 11278813:117:67
status: NEW126 Replacing the aspartate residue in the next position by histidine (D110H) resulted in a much more normal looking channel with a major mean conductance of about 8.5 pS.
X
ABCC7 p.Asp110His 11278813:126:67
status: NEW171 For example a nucleotide binding domain mutation, G551D, precludes virtually all TABLE II Relative charge transport capacity of mutants Mutants S108F Y109C D110H P111L P111A E116K R117H R117C R117L R117P E217G T908N P1013L Imutant/Iwt 100% 11 15 27 173 105 12 80 27 5 11 10 48 170 FIG. 5.
X
ABCC7 p.Asp110His 11278813:171:156
status: NEW
No.
Sentence
Comment
42
The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X.
X
ABCC7 p.Asp110His 11933191:42:144
status: NEW
PMID: 12007216
[PubMed]
Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."
No.
Sentence
Comment
112
Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL.
X
ABCC7 p.Asp110His 12007216:112:1630
status: NEW
PMID: 12167682
[PubMed]
Groman JD et al: "Variant cystic fibrosis phenotypes in the absence of CFTR mutations."
No.
Sentence
Comment
71
MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1.
X
ABCC7 p.Asp110His 12167682:71:209
status: NEW
PMID: 12439892
[PubMed]
Kilinc MO et al: "Highest heterogeneity for cystic fibrosis: 36 mutations account for 75% of all CF chromosomes in Turkish patients."
No.
Sentence
Comment
80
Haplotypes Associated With the Mutations Identified in 83 Turkish CF Patients* Mutation Total number of alleles Number of alleles Number of patients Haplotypes Homo Hetero DF508 39 (23.5) 6 7 23 M 28 13 1 0 1 6 7 23 M 30 13 1 0 1 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 11 4 3 6 7 23 M 7 17 2 0 2 6 7 16 M 31 13 3 1 1 6 7 17 M 31 13 17 5 7 6 7 17 M 32 13 3 1 1 1677delTA 12 (7.2) 7 7 16 V 30 13 12 5 2 2183AA > G 7 (4.2) 7 7 16 M 30 13 1 0 1 7 9 16 M 31 13 4 2 0 7 7 16 M 32 13 2 1 0 G542X 6 (3.6) 6 7 23 M 32 13 6 3 0 F1052V 5 (3.0) 6 7 17 M 7 13 4 1 2 7 5 17 M 7 17 1 0 1 W1282X 5 (3.0) 7 7 17 M 7 17 4 1 2 7 7 17 M 7 18 1 0 1 E92K 4 (2.4) 7 7 16 V 46 13 3 1 1 7 7 17 V 46 13 1 0 1 1525 À 1G > A 4 (2.4) 7 7 17 M 7 17 4 2 0 2789 þ 5G > A 4 (2.4) 7 9 17 M 7 17 3 1 1 7 5 17 M 7 17 1 0 1 N1303K 4 (2.4) 7 7 23 M 31 13 2 0 2 6 7 22 M 30 13 1 0 1 6 7 23 M 30 13 1 0 1 A46D 3 (1.8) 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 2 1 0 2184insA 3 (1.8) 7 5 17 V 30 13 1 0 1 7 7 16 V 30 13 2 0 2 R1070Q 3 (1.8) 7 7 16 M 31 13 1 0 1 7 7 17 M 31 13 2 0 2 Q493Pa 2 (1.2) 6/7 5 16 M 46 13 2 1 0 3849 þ 5G > Aa 2 (1.2) 7 7 16 M 31 13 2 1 0 CFTRdele17b,18a 2 (1.2) 6 9 16 V - - 2 1 0 K68Ea 1 (0.6) 6 9 17 M 7 13 1 0 1 R74W 1 (0.6) 6 7 16 M 32 16 1 0 1 306delTAGA 1 (0.6) 7 7 16 M 7 17 1 0 1 D110H 1 (0.6) 7 9 16 V 30 13 1 0 1 I125T 1 (0.6) 6 7 23 V 7 16 1 0 1 406 À 3T > Ca 1 (0.6) 7 7 16 V 33 17 1 0 1 I148T 1 (0.6) 6/7 7 16/17 M 7 17/23 1 0 1 621 þ 1G > T 1 (0.6) 6 7 21 V 31 13 1 0 1 R347P 1 (0.6) 7 9 17 V 30 13 1 0 1 S466X 1 (0.6) 7 7 23 M 33 13 1 0 1 L571S 1 (0.6) 7 7 16 V 29 13 1 0 1 1717 À 1G > A 1 (0.6) 7 9 17 M 7 16 1 0 1 E608Ga 1 (0.6) 7 9 16 M/V 29/31 13 1 0 1 2043delG 1 (0.6) 7 9 17 M 7 17 1 0 1 P1013L 1 (0.6) 6 5 16 M 21 18 1 0 1 R1066L 1 (0.6) 7 7 17 M 7 13 1 0 1 3129del4 1 (0.6) 7 7 16 V 29 13 1 0 1 V1147Ia 1 (0.6) 6 7 17 M 33 17 1 0 1 S1235R 1 (0.6) 6 7 17 M 39 13 1 0 1 CFTRdele2,3 1 (0.6) 7 7 16 V 33 13 1 0 1 Total 125 (75) 125 32 61 *The order of the polymorphisms is IVS6GATT, Tn, IVS8CA, M470V, IVS17BTA and IVS17BCA.
X
ABCC7 p.Asp110His 12439892:80:1280
status: NEW
PMID: 15070876
[PubMed]
Dayangac D et al: "Mutations of the CFTR gene in Turkish patients with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
35
We next screened for six further CFTR gene mutations of the coding region and ¯anking intron sequences by previously described restriction-enzyme based methods: G85E, D110H, R347H, 2789+5G®A, D1152H, N1303K (DoÈrk et al., 1994a, 1997).
X
ABCC7 p.Asp110His 15070876:35:172
status: NEW40 Finally, the 5'-UTR and minimum promoter region were Table I. CFTR gene mutations identi®ed in 51 CBAVD patients Mutation Location Nucleotide alteration Predicted effect Allele frequency (%) Reference IVS8-5T Intron 8 Deletion of 2T between 1342±12 and 1342±6 Aberrant splicing 20 (19.6)a Chu et al. 1993 D1152H Exon 18 G®C at 3586 Amino acid substitution 15 (14.7)a Highsmith et al. 1992* D110H Exon 4 G®C at 460 Amino acid substitution 3 (2.9) Dean et al. 1990 DF508 Exon 10 Deletion of 3 nt at 1652±1655 Amino acid deletion 3 (2.9) Kerem et al. 1989 2789+5G®A Intron 14b G®A at 2789+5 Aberrant splicing 3 (2.9) Highsmith et al. 1997 L997F Exon 17a G®C at 3123 Amino acid substitution 3 (2.9) Fanen et al. 1992b CFTRdele2 (ins186) Introns 1±2 Deletion of 8.1 kb and insertion of 186 bp In-frame-deletion 2 (2.0) DoÈrk et al. 2000b R347H Exon 7 G®A at 1172 Amino acid substitution 2 (2.0) Cremonesi et al. 1992 E831X Exon 14a G®T at 2623 Truncation 2 (2.0) Ferec et al. 1992* 1767del6 Exon 11 Deletion of 6 nt at 1767±1773 In-frame-deletion 2 (2.0) (a) This study 3041-15T®G Intron 15 T®G at 3041±15 Aberrant splicing?
X
ABCC7 p.Asp110His 15070876:40:410
status: NEW56 Several mutations were already known as `mild' alleles in cystic ®brosis, e.g. D110H, R347H or 2789+5G®A, and have been described previously in studies of patients with CBAVD.
X
ABCC7 p.Asp110His 15070876:56:84
status: NEW72 CFTR genotypes in 51 patients with congenital bilateral absence of the vas deferens Mutation genotypes IVS8-(TG)mTn M470V n (%) Two mutations detected: D1152H/D1152H (TG)11 7T/ (TG)11 7T V/V 5 (9.8) IVS8-5T/IVS8-5T (TG)13 5T/ (TG)13 5T M/M 2 (3.9) (TG)12 5T/ (TG)13 5T M/V 1 (1.9) (TG)12 5T/ (TG)12 5T V/V 1 (1.9) IVS8-5T/D1152H (TG)12 5T/ (TG)11 7T V/V 2 (3.9) IVS8-5T/DF508 (TG)12 5T/ (TG)10 9T M/V 2 (3.9) IVS8-5T/2789+5G®A (TG)12 5T/ (TG)10 7T M/V 2 (3.9) IVS8-5T/365insT (TG)13 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/D110H (TG)12 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/E585X (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/2752-15C®G (TG)12 5T/ (TG)11 7T V/V 1 (1.9) IVS8-5T/M952I (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/3120+1G®A (TG)12 5T/ (TG)11 7T V/V 1 (1.9) D1152H/A349V (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/2789+5G®A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/G1130A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/ IVS8-6T (TG)13 6T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/1677delTA (TG)11 7T/ (TG)11 7T V/V 1 (1.9) R334Q/R347H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 1767del6/1767del6 (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 3041-15T®G/3041-15T®G (TG)12 7T/ (TG)12 7T M/M 1 (1.9) 3041-13del7/3041-13del7 (TG)10 7T/ (TG)10 7T M/M 1 (1.9) R1070W/3272-26A®G (TG)10 7T/ (TG)11 7T M/V 1 (1.9) I853F/L997F (TG)11 7T/ (TG)10 9T V/V 1 (1.9) One mutation detected: L997F/?
X
ABCC7 p.Asp110His 15070876:72:522
status: NEWX
ABCC7 p.Asp110His 15070876:72:994
status: NEWX
ABCC7 p.Asp110His 15070876:72:1039
status: NEW
PMID: 15084222
[PubMed]
D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."
No.
Sentence
Comment
89
Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency.
X
ABCC7 p.Asp110His 15084222:89:1062
status: NEW
PMID: 15371907
[PubMed]
Monaghan KG et al: "Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study."
No.
Sentence
Comment
53
Case 6, a female for whom no clinical information is available, was compound heterozygous for D110H and I148T/ 3199del6.
X
ABCC7 p.Asp110His 15371907:53:94
status: NEW66 Sex Race Indication Genotype Poly T status Clinical information 1 Female Asian Carrier screening I148Ta /I148Ta12 9T/9T Asymptomatic 2 Male Not provided Infertility I148Ta /⌬F508 Not determined CBAVD 3 Male Not provided Infertility I148Ta heterozygote Negative for 5T Obstructive azoospermia 4 Male Caucasian Infertility I148Ta /S1235R20 7T/9T None available 5 Male Caucasian Family history of CF mutation I148Ta /⌬F508 9T/9T Fertile male who underwent carrier screening after the identification of ⌬F508 in the heterozygous form in his child during newborn screening, child`s mother is negative for 25 mutation ACOG/ACMG CF panel 6 Female Armenian Family history of CF mutation D110H/I148T (3199del6 positive) Not determined Clinical information on this individual is not available, despite multiple attempts to obtain.
X
ABCC7 p.Asp110His 15371907:66:700
status: NEW105 The second individual underwent testing due to the presence of two different CF mutations in her two children and was found to have the genotype D110H/I148T(3199del6).
X
ABCC7 p.Asp110His 15371907:105:145
status: NEW108 D110H is a rare CF sequence variant, originally reported in a mildly affected CF patient,18 and recently in homozygous form in an infant with metabolic alkalosis.19 The remaining I148T compound heterozygotes were negative for 3199del6.
X
ABCC7 p.Asp110His 15371907:108:0
status: NEW
PMID: 15520400
[PubMed]
Niel F et al: "Rapid detection of CFTR gene rearrangements impacts on genetic counselling in cystic fibrosis."
No.
Sentence
Comment
136
The subjects were divided into three groups according to the results of a previous screening: (i) 43 CF patients who fulfilled the diagnostic criteria of CF15 and who carried a CF mutation, and seven parents of deceased CF patients, a CF mutation having already been identified in the other parent (50 unidentified CF alleles); (ii) 12 CF patients with no identified CF mutation (24 unidentified CF alleles); and (iii) 16 patients apparently homozygous for a CFTR mutation and who had CF (F508del 2n = 6-, 2104insA22109del10, S945L, 3120+1GRA, N1303K) or a CFTR related disease, that is, isolated CBAVD (D110H, R117H, L997F, R74W-D1270N) or DB (R334W, R668C- G576A-D443Y) (0-16 unidentified CF alleles).
X
ABCC7 p.Asp110His 15520400:136:604
status: NEW
PMID: 15638824
[PubMed]
Castaldo G et al: "Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population."
No.
Sentence
Comment
62
A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n.
X
ABCC7 p.Asp110His 15638824:62:1120
status: NEW85 Present study case (n) Mutation references* Haplotype (n. of repeats) Other studies case (n) W1282X 16 17-7-17 26 1, 2, 3 1259insA 11 16-33-13 852del22 11 16-33-13 4016insT 11 16-30-13 I502T 8 16-30-13 L1065P 4 16-30-13 2522insC 4 23-30-13 2789+5G>A 2 17-7-17 9 1, 2, 3 D1152H 2 16-7-13 2711delT 1 16-45-13 2 3 D110H 1 16-32-13 Y849X 1 16-30-13 * References: 1: Morral et al., 1996 2: Claustres et al., 1996 3: Hughes et al., 1996b peculiar to Sardinia, is absent in our population (Rendine et al. 1997).
X
ABCC7 p.Asp110His 15638824:85:311
status: NEW
PMID: 16126774
[PubMed]
Morea A et al: "Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility."
No.
Sentence
Comment
47
CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T.
X
ABCC7 p.Asp110His 16126774:47:181
status: NEW
PMID: 16379540
[PubMed]
Stanziale P et al: "Indirect CFTR mutation identification by PCR/OLA anomalous electropherograms."
No.
Sentence
Comment
2
Here we report the description of five cases of anomalous electropherograms obtained after PCR/OLA analysis, that led to the identification, in the homozygous state, of two point mutations (D110H and S589N) not included in the assay test panel, a large gene deletion (CFTRdel14b_17b), and an exonic polymorphism (c.4002A Ͼ G).
X
ABCC7 p.Asp110His 16379540:2:190
status: NEW45 A: Sequencing analysis of exon 4 in case 1 and wild-type control sample. The arrow indicates the nucleotide change leading to the D110H mutation.
X
ABCC7 p.Asp110His 16379540:45:130
status: NEW62 This nucleotide transversion generates the D110H mutation (substitution histidine for aspartic acid), often associated with CABVD (Dork et al., 1997).
X
ABCC7 p.Asp110His 16379540:62:43
status: NEW118 In addition, because the D110H and S589N changes, similar to CFTRdel14b_17b, are rare mutations (CF Genetic Analysis Consortium: www.genet.sickkids.on.ca/CFTR) and the c.4002A Ͼ G allelic frequency is 1.32%, as resulted by the analysis performed in 113 control individuals from central-southern Italy (data not shown), it seems to be reasonable to postulate consanguinity in all the families.
X
ABCC7 p.Asp110His 16379540:118:25
status: NEW
PMID: 16840743
[PubMed]
Wilschanski M et al: "Mutations in the cystic fibrosis transmembrane regulator gene and in vivo transepithelial potentials."
No.
Sentence
Comment
54
CFTR GENE MUTATIONS IN THE PATIENT GROUPS Control Subjects (n ϭ 31) Heterozygotes (n ϭ 21) CBAVD-1 (n ϭ 18) CBAVD-2 (n ϭ 36) CF-PS (n ϭ 24) CF-PI (n ϭ 26) G542X*/R75Q ⌬F508*/- (n ϭ 16) ⌬F508* (n ϭ 6) ⌬F508*/2789ϩ5G→A* ⌬F508*/R117H [5T]* (n ϭ 4) ⌬F508*/⌬F508* (n ϭ 11) ⌬F508* ⌬F508*/5T W1282X*/5T (n ϭ 8) R334W*/R334W* ⌬F508*/A455E* (n ϭ 2) ⌬F508*/G542X* (n ϭ 2) G542X* W1282X*/- (n ϭ 2) D1152H† ⌬F508*/R117H [7T] (n ϭ 10) ⌬F508*/3849ϩ10kbC→T* (n ϭ 2) ⌬F508*/G551D* (n ϭ 2) R117H[7T] G85E† /R75Q L206W† ⌬F508*/R117C [7T] G551D*/3849ϩ10kbC→T* ⌬F508*/621ϩ1G→T* (n ϭ 2) S431G R75Q/- A198P G551D*/R117H [7T] ⌬F508*/3272-26A→G† (n ϭ 2) ⌬F508*/2789ϩ5 G→A* 5T ⌬F508*/5T (n ϭ 8) ⌬F508*/P574H† (n ϭ 2) ⌬F508*/W1282X* G542X*/5T ⌬F508*/I1234V† ⌬F508*/G85E* W1282X*/5T ⌬F508*/P67L† ⌬F508*/L1077P† (n ϭ 2) ⌬F508*/P67L† ⌬F508*/R347H† G551D*/G480C† ⌬F508*/L206W† ⌬F508*/5T ⌬F508*/- (n ϭ 2) ⌬F508*/M952T† ⌬F508*/875ϩ1G→C† -/- ⌬F508*/S549R† G551D*/R75Q A455E*/L206W† ⌬F508*/- (n ϭ 2) 621ϩG→T*/R117C [7T] A455E*/- R117H [7T]/5T ⌬I507*/- R117L[7T]/5T -/- R117H/R117H [7T/7T] D979A/5T 5T/-741T→G 4016insT† /D110H Definition of abbreviations: CBAVD ϭ congenital bilateral absence of the vas deferens; CF-PI ϭ pancreatic-insufficient cystic fibrosis; CF-PS ϭ pancreatic-sufficient cystic fibrosis.
X
ABCC7 p.Asp110His 16840743:54:1692
status: NEW
PMID: 17329263
[PubMed]
Ratbi I et al: "Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling."
No.
Sentence
Comment
95
C)] þ [I556V] 1 Apparent homozygosity 3 0-3 1 [R117H] þ [R117H] 1 1 [D110H] þ [D110H] 1 [R74W;D1270 N] þ [R74W;D1270 N] 1 Total 61 57-75 4 F508del, 2221dupA, as well as variants at the IVS8(TG)m(T)n polymorphic site.
X
ABCC7 p.Asp110His 17329263:95:79
status: NEWX
ABCC7 p.Asp110His 17329263:95:94
status: NEW
PMID: 18178635
[PubMed]
Stanke F et al: "Diversity of the basic defect of homozygous CFTR mutation genotypes in humans."
No.
Sentence
Comment
78
E92K and D110H (data not shown) are located in the first ectoplasmic loop.
X
ABCC7 p.Asp110His 18178635:78:9
status: NEW
PMID: 18373402
[PubMed]
Lakeman P et al: "CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening."
No.
Sentence
Comment
113
Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account.
X
ABCC7 p.Asp110His 18373402:113:1314
status: NEW
PMID: 19897426
[PubMed]
Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."
No.
Sentence
Comment
48
Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT.
X
ABCC7 p.Asp110His 19897426:48:108
status: NEW97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction.
X
ABCC7 p.Asp110His 19897426:97:934
status: NEW98 Mutation Disorder Gender Age (years) Notes and refs ΔF508/R117H M 47 (C) [20,21] ΔF508/R117H F 36 (C) [20,21] ΔF508/R117H M 43 (C) [20,21] G542X/D1152H M 40 (C) R1162X/2789+5G→A CBAVD M 44 (C) R117H/2789+5G→A CBAVD M 42 (C) N1303K/D110H CBAVD M 32 (C) N1303K/D1152H M 40 (C) 2789+5G→A/R1066H M 40 (C) Abbreviations: CBAVD: Congenital Bilateral Absence of the Vas Deference; M: Male; F: Female.
X
ABCC7 p.Asp110His 19897426:98:263
status: NEW105 Among the subjects tested, 9 resulted to be compound heterozygotes: ΔF508/R117H (n=3), G542X/D1152H (n=1), R1162X/2789+5G→A (n=1), R117H/2789 + 5G→A (n = 1), N1303K/D110H (n = 1), N1303K/D1152H (n = 1), 2789 + 5G→A/R1066H (n = 1) (Table 2b).
X
ABCC7 p.Asp110His 19897426:105:185
status: NEW
PMID: 20100616
[PubMed]
Havasi V et al: "Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
68
Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Asp110His 20100616:68:132
status: NEW
PMID: 20949073
[PubMed]
Hinzpeter A et al: "Alternative splicing at a NAGNAG acceptor site as a novel phenotype modifier."
No.
Sentence
Comment
188
Age at diagnosis, gender: M, F Ethnic origin Genotype Sweat test* (mmol/l) Phenotype References Birth, F - E831X/G551D 100 Early childhood: MI, PI, and lung infections Adulthood: PI and no pulmonary symptoms 15 Twins 13y, M Turkish E831X/591del18 89/94 Recurrent nasal polyps 16 Adult, M Turkish E831X/D110H - CBAVD 17 Adult, M Turkish E831X/1677delTA - CBAVD 17 Adult, M Turkish E831X/DF508 92/94 CBAVD PS and mild lung disease 18 Adult, M Portuguese E831X/DF508 - CBAVD 19 First year, F - E831X/DF508 100 PS and no lung involvement French registry First year, M Turkish E831X/E831X 70 PS and mild lung disease This study III10 Adult, F Turkish E831X/E831X 70 PS and no lung involvement This study III5 Neonatal diagnosis, M Turkish E831X/E831X 74 PS and mild lung disease This study IV1 Abbreviations: CBAVD, congenital bilateral absence of the vas deferens; MI, meconium ileus; PI, pancreatic insufficiency; PS, pancreatic sufficiency.
X
ABCC7 p.Asp110His 20949073:188:302
status: NEW
PMID: 17440499
[PubMed]
Keymolen K et al: "Clinical outcome of preimplantation genetic diagnosis for cystic fibrosis: the Brussels' experience."
No.
Sentence
Comment
66
Table 1 Assessment of CF risk Couples with PGD (n ¼ 47) Couples without PGD (n ¼ 22) All couples (n ¼ 69)(%) CF risk assessment Affected child or foetus 23 14 37 (53.6) CBAVD (without other CF complaints) 7 3 10 (14.5) During fertility work-up (not CBAVD) 10 10 (14.5) Positive family history 3 2 5 (7.2) CF patient (with CBAVD in males) 4 4 (5.8) Unknown 2 2 (2.9) Preconceptual screening 1 1 (1.4) Table 2 Reasons for choosing PGD Couples with PGD (n ¼ 47) Couples without PGD (n ¼ 22) All couples (n ¼ 69) Reason for choosing/informing about PGD Fertility problems 24 7 31 (44.9%) Objection to abortion 15 2 17 (24.6%) History of termination of pregnancy 8 1 9 (13%) Unknown 11 11 (15.9%) Other 1 1 (1.4%) Table 3 Genotypes of the couples with PGD cycles Female partner Male partner Number of couples with this genotype p.F508del/- p.F508del/- 17 p.F508del/- p.R117H/- (7T/9T) 1 p.2789+5G4A/- p.D110H/p.D110H 1 p.G542X/- p.F508del/- 1 p.R334Q/- p.F508del/- 1 p.R553X/- p.F508del/- 2 p.1717-1G4A p.2183AA4G/5T 1 p.F508del/- p.F508del/?
X
ABCC7 p.Asp110His 17440499:66:928
status: NEWX
ABCC7 p.Asp110His 17440499:66:936
status: NEW
PMID: 22724884
[PubMed]
Kazandi M et al: "Mid-trimester hyperechogenic bowel in a fetus of Turkish origin carrying a rarely seen mutation of cystic fibrosis."
No.
Sentence
Comment
7
Once the most frequent mutations have been accounted for, rarer mutations should be investigated.10 In this study we present a fetus with hyperechogenic bowel carrying a rarely seen compound heterozygous mutation of p.IIe1000fsX1001 and p.Asp110His in the CFTR gene.
X
ABCC7 p.Asp110His 22724884:7:239
status: NEW13 Also p.Asp110His mutation was identified whe- UH WKH F* !
X
ABCC7 p.Asp110His 22724884:13:7
status: NEW17 The result was consistent with Asp110His heterozygous mutation.
X
ABCC7 p.Asp110His 22724884:17:31
status: NEW39 The cases that have previously reported the p.Asp110His mutation were prone to severe salt loss upon exposure to heat or exercise, were overweight and had normal lung function.15 There have been several reports about a mild CF phenotype of isolated hypotonic dehydration associated with specific CFTR mutations, including p.Asp110His.16-18 An Iranian study on males with congenital bilateral absence of the vas deferens (CVDA) showed the c.3130delA mutation with a frequency of 2.9%.19 In the present study, following termination of pregnancy, paternal and maternal mutations were detected in molecular studies.
X
ABCC7 p.Asp110His 22724884:39:46
status: NEWX
ABCC7 p.Asp110His 22724884:39:324
status: NEW16 The result was consistent with Asp110His heterozygous mutation.
X
ABCC7 p.Asp110His 22724884:16:31
status: NEW38 The cases that have previously reported the p.Asp110His mutation were prone to severe salt loss upon exposure to heat or exercise, were overweight and had normal lung function.15 There have been several reports about a mild CF phenotype of isolated hypotonic dehydration associated with specific CFTR mutations, including p.Asp110His.16-18 An Iranian study on males with congenital bilateral absence of the vas deferens (CVDA) showed the c.3130delA mutation with a frequency of 2.9%.19 In the present study, following termination of pregnancy, paternal and maternal mutations were detected in molecular studies.
X
ABCC7 p.Asp110His 22724884:38:46
status: NEWX
ABCC7 p.Asp110His 22724884:38:324
status: NEW
PMID: 16436643
[PubMed]
Elahi E et al: "A haplotype framework for cystic fibrosis mutations in Iran."
No.
Sentence
Comment
95
Both domains are conserved in the ATP-binding cassette transporters.33 In addition, mutations p.D110H, p.R334W, p.T338I, p.L467F, and p.P1013L altered predicted exon splicing enhancer motifs in the CFTR gene, suggesting that they may have a deleterious effect on splicing.
X
ABCC7 p.Asp110His 16436643:95:96
status: NEW111 of Patients Total alleles* Associated haplotype Global distributionHom Het Exon 1 c.134TϾC M1T 1 1 Rare Exon 3 c.386GϾA G85E 1 1 Global Exon 4 c.460GϾC D110H 1 1 H2 Europe Exon 7 c.1132CϾT R334W 1 1 H2 Global Exon 7 c.1145CϾT T338I 1 1 Europe Intron 9 c.1525-1GϾA Mis-splicing 1 1 H8 Pakistan Exon 10 c.1529CϾG S466X 1 2 H4 Germany Exon 10 c.1531CϾT L467F 1 1 Rare Exon 10 c.1649TϾC I506T 1 2 H8 Lebanon Exon 10 c.1652del3† ⌬F508 6 7 19 H5 Global Exon 10 c.1677delTA 515fs 4 1 9 H1 Europe Exon 11 c.1756GϾT G542X 1 1 H5 Global Exon 12 c.1821CϾA Y563X 2 2 Europe Exon 13 c.2183AAϾG 684fs 3 6 H3 Europe Exon 17a c.3170CϾT P1013L 1 1 Turkey Exon 19 c.3616CϾT R1162X 2 2 H2 Germany Exon 19 c.3661AϾT K1177X 1 1 3 H2 Bahrain Intron 20 c.4005ϩ1GϾA Mis-splicing 1 2 H2 Europe Exon 21 c.4041CϾG N1303K 3 1 7 H5 Global Exon 23 c.4363CϾT Q1412X 1 1 Rare *A total of 64 (53%) of the 120 expected alleles were observed.
X
ABCC7 p.Asp110His 16436643:111:170
status: NEW
PMID: 15463898
[PubMed]
Salvatore D et al: "Cystic fibrosis presenting as metabolic alkalosis in a boy with the rare D579G mutation."
No.
Sentence
Comment
17
Indeed, there are several reports about a mild CF phenotype of isolated hypotonic dehydration, associated with specific CFTR mutations, such as T338I, D110E and D110H [6-8].
X
ABCC7 p.Asp110His 15463898:17:161
status: NEW
PMID: 10923036
[PubMed]
Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."
No.
Sentence
Comment
108
g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb.
X
ABCC7 p.Asp110His 10923036:108:33
status: NEW152 Twenty-four non F508del mutations were found associated with the 9T allele: 394delTT, L90S, D110H, R117G, 621+1G>T, V232D, A455E, G542X, R851L, T908N, 2789+5G>A, 2896insAG, H939R, 3007delG, I980K, I1027T, R1066H, A1067T, D1154G, 3737delA, R74W+D1270N, N1303I, N1303K, D1377H.
X
ABCC7 p.Asp110His 10923036:152:92
status: NEW
PMID: 10862085
[PubMed]
Ellis LA et al: "A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning."
No.
Sentence
Comment
97
Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE.
X
ABCC7 p.Asp110His 10862085:97:456
status: NEW
PMID: 9521595
[PubMed]
Onay T et al: "Analysis of the CFTR gene in Turkish cystic fibrosis patients: identification of three novel mutations (3172delAC, P1013L and M1028I)."
No.
Sentence
Comment
67
Mutations 1677delTA, G542X and 2183AA→G have frequencies greater or equal to approximately 5%, whereas F1052V, 2043delG, D110H, N1303K, L571S and 296+9 A→T have frequencies of 2%.
X
ABCC7 p.Asp110His 9521595:67:128
status: NEW78 D110H 4 Asp→His at 110 G→C at 460 2 (1.64) Dean et al. 1990 8.
X
ABCC7 p.Asp110His 9521595:78:0
status: NEW124 Other mutations, namely F1052V, 2043delG, D110H, L571S and 296+9 A→T, have been detected with frequencies of 1.6% in Turkish CF chromosomes.
X
ABCC7 p.Asp110His 9521595:124:42
status: NEW
PMID: 9374552
[PubMed]
Fanen P et al: "Cystic fibrosis phenotype associated with pancreatic insufficiency does not always reflect the cAMP-dependent chloride conductive pathway defect. Analysis of C225R-CFTR and R1066C-CFTR."
No.
Sentence
Comment
100
Five patients had pancreatic insufficiency while the sixth had normal pancreatic function and was a compound heterozygote for a mild mutation (D110H) (14).
X
ABCC7 p.Asp110His 9374552:100:143
status: NEW
PMID: 9272157
[PubMed]
Dork T et al: "Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens."
No.
Sentence
Comment
86
The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p.
X
ABCC7 p.Asp110His 9272157:86:409
status: NEW137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level.
X
ABCC7 p.Asp110His 9272157:137:2132
status: NEWX
ABCC7 p.Asp110His 9272157:137:2138
status: NEW145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right).
X
ABCC7 p.Asp110His 9272157:145:420
status: NEWX
ABCC7 p.Asp110His 9272157:145:426
status: NEW148 Whereas none of the males with isolated CAVD was homozygous for ∆F508, homozygosity was observed for four other mutations: one Lebanese and one Turkish male with CBAVD were homozygous for the mutations D110H and 2789+5 G→A, respectively, both of which had previously been identified as very mild CF mutations (Dean et al. 1990; Highsmith et al. 1997).
X
ABCC7 p.Asp110His 9272157:148:209
status: NEW196 Our analysis adds mutations D110H, 2789+5 G→A and V938G to the growing list of CFTR mutations that, in the homozygous state, can result in a restricted and primarily genital expression of disease.
X
ABCC7 p.Asp110His 9272157:196:28
status: NEW
PMID: 7524909
[PubMed]
Schaedel C et al: "A novel cystic fibrosis mutation, Y109C, in the first transmembrane domain of CFTR."
No.
Sentence
Comment
27
Two other substitution mutations, D110H and R117H, have been reported in the same sequence (3).
X
ABCC7 p.Asp110His 7524909:27:34
status: NEW
PMID: 7683954
[PubMed]
Nunes V et al: "A new missense mutation (E92K) in the first transmembrane domain of the CFTR gene causes a benign cystic fibrosis phenotype."
No.
Sentence
Comment
8
SSCP conditions for exon 4 of the CFTR gene, which allow discrimination of mutant and wild type alleles, were developed for several control mutations at this exon: D110H, R117H, 556delA and 621+ 1G-T (8, 9).
X
ABCC7 p.Asp110His 7683954:8:164
status: NEW
PMID: 1376016
[PubMed]
Kristidis P et al: "Genetic determination of exocrine pancreatic function in cystic fibrosis."
No.
Sentence
Comment
58
Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both.
X
ABCC7 p.Asp110His 1376016:58:469
status: NEW66 As shown in table 3, meconium ileus Table 2 1181 Table 3 Frequency of 25 CF Mutations in Chromosomes of the Toronto Study Population Mutation AF508 ...... G551D...... G542X...... 621 +1G-'T N1303K..... W1282X..... R1 17H...... 1717-1G-~A R560T...... A1507 ...... R553X...... V52OF ...... R334W ..... A455E...... I148T ...... Q493X...... P574H...... R347P ...... SS6delA ..... 3659delC .... G480C...... 444delA ..... D110H...... G458V...... S549R ...... Y563N......
X
ABCC7 p.Asp110His 1376016:66:418
status: NEW
PMID: 1372093
[PubMed]
Cuppens H et al: "Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot."
No.
Sentence
Comment
19
Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population .
X
ABCC7 p.Asp110His 1372093:19:124
status: NEW
PMID: 16635477
[PubMed]
Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."
No.
Sentence
Comment
139
In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20).
X
ABCC7 p.Asp110His 16635477:139:173
status: NEW
PMID: 22043142
[PubMed]
Lilley M et al: "Newborn screening for cystic fibrosis in Alberta: Two years of experience."
No.
Sentence
Comment
124
Due to milder TAbLe 4 Cystic fibrosis transmembrane regulator full screen results for inconclusive cases with borderline and elevated sweat chloride results ID Sweat chloride, bc;mol/L IRT, bc;g/L 1st mutation 2nd mutation Mutation description (reference) 14920 67/72 194 F508del D110H Associated with mild or atypical CF (5) 14490 105 271 F508del W1204X Rare but associated with classic CF (6) 15810 95 162 1717GA Exon 2-3 del Associated with classic CF (7) 17167 110 178 F508del Not sequenced N/A 15905 40 94 3849+10kb 2789+1GA Not previously reported.
X
ABCC7 p.Asp110His 22043142:124:286
status: NEW142 Three mutations (D110H, L206W and 5T) were identified that are associated with a mild or variable phenotype.
X
ABCC7 p.Asp110His 22043142:142:17
status: NEW
PMID: 23891399
[PubMed]
Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."
No.
Sentence
Comment
44
None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1.
X
ABCC7 p.Asp110His 23891399:44:45
status: NEW64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations.
X
ABCC7 p.Asp110His 23891399:64:1629
status: NEW74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2.
X
ABCC7 p.Asp110His 23891399:74:458
status: NEWX
ABCC7 p.Asp110His 23891399:74:951
status: NEW82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org).
X
ABCC7 p.Asp110His 23891399:82:1641
status: NEW87 Similarly, the baseline chloride transport and ivacaftor response were higher for mutant CFTR forms with mild defects in channel conductance (30-84% of normal; D110H-, R347H, and R352Q-CFTR) [17-19], compared with those with severe defects in CFTR channel conductance (undetectable R334W- and T338I-CFTR) [9,20].
X
ABCC7 p.Asp110His 23891399:87:160
status: NEW92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3.
X
ABCC7 p.Asp110His 23891399:92:807
status: NEW
PMID: 24030637
[PubMed]
Deeks ED et al: "Ivacaftor: a review of its use in patients with cystic fibrosis."
No.
Sentence
Comment
36
Further in vitro data suggest that other CFTR proteins with residual function may also be potentiated by ivacaftor, including those with mutations that affect conductance (e.g. R117H, D110H), mildly affect CFTR processing (e.g. E56K, P67L) or have uncharacterized effects (e.g. D110E, S1235R) [5, 16].
X
ABCC7 p.Asp110His 24030637:36:184
status: NEW
PMID: 24513262
[PubMed]
Sarles J et al: "Neonatal screening for cystic fibrosis: comparing the performances of IRT/DNA and IRT/PAP."
No.
Sentence
Comment
158
IRT d3 Ctrl IRT PAP Cl- Mut 1 Mut 2 1 66 68 0.4 80 ƊF508del ƊF508del 2 87.8 106.5 0.5 137 E1104X E1104X 3 93.2 105.8 0.8 82 G91R ƊF508del 4 71.1 56.7 0.3 80.0 ƊF508del ƊF508del 5 67.9 54.4 1.5 99.0 ƊF508del ƊF508del 6 87.1 82.9 4.5 70.0 E1104X D110H 7 61.5 62 5.0 88.0 R553X A455E 8 62.4 63.0 14.6 110.0 2183AANG 907delCins11 9 117.0 81.5 15.6 130.0 S466X S466X Lines 1-3: false negatives in the IRT/PAP strategy, 6-9: false negatives in the IRT/DNA strategy, due to mutations not detected by the Elucigeneࡊ CF30, 45: false negatives in both strategies.
X
ABCC7 p.Asp110His 24513262:158:279
status: NEW
PMID: 25024266
[PubMed]
Cui G et al: "Three charged amino acids in extracellular loop 1 are involved in maintaining the outer pore architecture of CFTR."
No.
Sentence
Comment
15
Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability.
X
ABCC7 p.Asp110His 25024266:15:70
status: NEW31 H&#e4;mmerle et al. (2001) reported that mutations D110H, E116K, and R117H induce no trafficking defect when expressed in baby hamster kidney (BHK) cells but affect channel function significantly.
X
ABCC7 p.Asp110His 25024266:31:51
status: NEW32 When studied in planar lipid bilayers, R117H-CFTR had gating kinetics similar to WT-CFTR, but a reduced single-channel conductance, whereas D110H- and E116K- CFTR displayed unstable channel openings, leading the authors to propose that ECL1 might contribute to maintaining the open pore architecture of CFTR (H&#e4;mmerle et al., 2001).
X
ABCC7 p.Asp110His 25024266:32:140
status: NEW36 CF-causing mutations have been identified in ECL1, including S108F, Y109C/N, D110H/ Y/N,P111A/L,E116K/Q,andR117C/G/H/P/L.Among these residues, D110, E116, and R117 are charged amino acids fully conserved among nine species (Fig. 1 A).
X
ABCC7 p.Asp110His 25024266:36:77
status: NEW
PMID: 25033378
[PubMed]
LaRusch J et al: "Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis."
No.
Sentence
Comment
269
67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results.
X
ABCC7 p.Asp110His 25033378:269:143
status: NEW
PMID: 25287046
[PubMed]
Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."
No.
Sentence
Comment
346
First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a).
X
ABCC7 p.Asp110His 25287046:346:185
status: NEW354 Finally, two CF-causing mutations involve amino acids which are implied in salt bridges: (1) D110 in TM2 (mutation D110H; salt bridge with R1128, distances of 4.0 and 5.0 A da; ) and (2) R334 in ECL3 (mutation R334W; salt bridge with D891, distances of 3.8 and 4.4 A da; ) (Fig. 7b).
X
ABCC7 p.Asp110His 25287046:354:115
status: NEW
PMID: 25304080
[PubMed]
Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."
No.
Sentence
Comment
59
As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17].
X
ABCC7 p.Asp110His 25304080:59:907
status: NEW79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%.
X
ABCC7 p.Asp110His 25304080:79:189
status: NEW
PMID: 25674778
[PubMed]
Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."
No.
Sentence
Comment
15
Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve.
X
ABCC7 p.Asp110His 25674778:15:851
status: NEW74 However, the sensitivity of the IRT/NGS algorithm would have decreased as much as 50% for classic CF cases when a positive screen is defined as two CF-causing mutations because of uncommon mutations found in five patients Table 2ߒ Cases with a second mutation detected from the next-generation sequencing panel Case no. IRT (ng/ml) Second-tier DNA Additional mutation Sweat chloride (mmol/l) Clinical assessmenta Test 1 Test 2 1 64 F508del D110H 71.4 67.1 CF 2 327 F508del Q1313X N/A N/A CF 3 297 F508del Q1313X N/A N/A CF 4 71 R117H (7T) R347H 45.2 41.5 CRMSb 5 148 F508del R117C 40 38 CRMSb 6 66 F508del 5Tc 36.9 30.8 CRMSb 7 147 F508del D1152Hc 27.9 24.6 CRMSb 8 121 F508del D1152Hc 11 QNS Carrier 9 176 F508del D1152Hc 24 26 Carrier CF, cystic fibrosis; CRMS, CFTR-related metabolic syndrome; IRT, immunoreactive trypsinogen; QNS, quantity not sufficient.
X
ABCC7 p.Asp110His 25674778:74:446
status: NEW
PMID: 25910067
[PubMed]
Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."
No.
Sentence
Comment
163
(A) Frequencies of mutated genotypes, with a prevalence ࣙ0.006 in the CF (PI + PS) population, are reported in frequency decreasing order according to CF (PI + PS); the last genotype with a prevalence = 0.008 in the CF (PI + PS) population is the F508del/D110H (p.[Phe508del];[Asp110His]).
X
ABCC7 p.Asp110His 25910067:163:261
status: NEWX
ABCC7 p.Asp110His 25910067:163:283
status: NEW286 These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (2 CF-PS), Q779X (p.Gln779*) (2 CF-PS siblings), D110H (p.Asp110His) (1 CF-PS), D614G (p.Asp614Gly) (1 CF-PS), unknown (1 CBAVD).
X
ABCC7 p.Asp110His 25910067:286:180
status: NEWX
ABCC7 p.Asp110His 25910067:286:189
status: NEW290 [1210-14TG[11];1210-12T[5]]), with no other mutations in cis, was found in 1 CFTR-RD patient and 1 CBAVD patient with, respectively, the 3849+10kbC>T (c.3717+12191C>T) and the D110H (p.Asp110His) mutations on the other allele.
X
ABCC7 p.Asp110His 25910067:290:176
status: NEWX
ABCC7 p.Asp110His 25910067:290:185
status: NEW366 [227_228insT;1210-14TG[12];1210-12T[5]] uncertain: CF-PI and/or CF-PS and/or CFTR-RD 359insT nd; T5 varying clinical consequence G85E c.254G>A CF-PI,CF-PS CF-causing p.Gly85Glu D110H c.328G>C CF-PS CF-causing p.Asp110His R117C c.349C>T CF-PS CF-causing p.Arg117Cys R117H c.350G>A CFTR-RD varying clinical consequence p.Arg117His [R117L;L997F] c.
X
ABCC7 p.Asp110His 25910067:366:177
status: NEWX
ABCC7 p.Asp110His 25910067:366:211
status: NEW
PMID: 26014425
[PubMed]
Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."
No.
Sentence
Comment
79
(unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance.
X
ABCC7 p.Asp110His 26014425:79:237
status: NEWX
ABCC7 p.Asp110His 26014425:79:254
status: NEW92 Well known examples include missense variants D110H, R117C, L206W, R347P, R347H, R1066H, or splice variants that produce both aberrant and full-length transcript such as 3849+10kbC4T, 2789+5G4A, 3272-26 A4G, 711+3 A4G.
X
ABCC7 p.Asp110His 26014425:92:46
status: NEW
PMID: 26493493
[PubMed]
Destouni A et al: "Single-cell high resolution melting analysis: A novel, generic, pre-implantation genetic diagnosis (PGD) method applied to cystic fibrosis (HRMA CF-PGD)."
No.
Sentence
Comment
79
Validation case no. Genotype combination (HGVS CFTR reference sequences NM000492.3 and NG016465.1) Light scanner (LSC) exons (Montgomery et al. 2007) Number of cells tested Amplicons in multiplex RxNa PCR efficiency (%) Overall ADO (%) 1 p.Arg334Gln and c.489+3ANG 7.2 and 4.2 48 8 98.85% 2% 2 p.Phe508del and p.Leu732X 10 and 13.3 60 8 98% 1.66% 3 p.Phe508del and p.Asp110His 10 and 4.1 60 8 96.60% 3.33% 4 p.Phe508del and p.Gly542X 10 and 11 40 8 98% 3% Total lymphocytes tested 208 a RxN: reaction, ADO: allele drop-out 3 The mutation p.Phe508del could otherwise more rapidly be detected by fluorescent fragment analysis by incorporating the relevant primer set in the first PCR.
X
ABCC7 p.Asp110His 26493493:79:367
status: NEW
No.
Sentence
Comment
127
Second mutation not detected by using DNA sequencing 5 c.1521_1523delCTT (F508del)/ (Ex6b_10dup) White (n = 3) Meconium ileus (n = 4) c.1652G.A (G551D)/ c.3964-78_4242+577del (CFTRdel22,23) Hispanic (n = 1) Family history (n = 2) c.1519_1521delATC (I507del)/ c.1680-877G.Tc Unknown (n = 1) Symptoms (n = 3) c.1521_1523delCTT (F508del)/ c.328G.C (D110H)d c.1521_1523delCTT (F508del)/ (mutation not identified) cDNA, complementary DNA.
X
ABCC7 p.Asp110His 26574590:127:346
status: NEW
admin on 2016-08-19 15:16:22