ABCMdb

ABCC7 p.Ala1006Glu

None has been submitted yet.

Publications

PMID: 10875853 [PubMed] Casals T et al: "Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens."

No. Sentence Comment

67 The abnormally migrating fragments were characterized by sequencing with the DyeDeoxy™ chain terminator method on an variant and another mutation (S50P, 2751ϩ3A→G, A1006E I. Description of the seven novel CFTR mutations and five polymorphisms in CAVD patients Mutation Location Nucleotide Amino acid Markers haplotype changes change (T)n-8CA-17bTA-M470V S50P exon 2 280 T→C Ser → Pro 5T/7T-16-31-ND D110Y exon 4 460 G→T Asp acid → Tyr 7T-17-7-V470 L383S exon 8 1280 T→C Leu → Ser 7T-16-7-M470 H484Y exon 10 1582 C→T His → Tyr no phase-M470 2751ϩ3A→G intron 14a 2751ϩ3 A→G - 5T-16-30-ND Q890R exon 15 2801 A→G Glu → Arg 7T-16-7/29-V470 P1021S exon 17a 3193 C→T Pro → Ser 7T-17-7-M470 Polymorphisms 104C/A 5ЈUTR - 296ϩ128G/C intron 3 - 741C/T exon 6a Ile203 no change 3195A/T exon 17a Pro1021 no change 3212T/C exon 17a Ile1027 no change CAVD ϭ congenital absence of the vas deferens; ND ϭ not determined; 5ЈUTR ϭ 5Ј untranslated region. Login to comment
74 The five new polymorphisms identified are Others (27) 27 (17) 1 (7) 28 (17) described in Table I. aS50P (n ϭ 1), 2751ϩ3A→G (n ϭ 1), F1074L (n ϭ 1), A1006E (n ϭ 2). Login to comment
97 Dilatation V232D/V232D 9T/9T 1 of ejaculatory ducts, often resembling utricular cysts, was S945L/R258G 7T/7T 1 demonstrable also in some men, all of whom were azoospermicG551D/F1074L 5T/7T 1 A1006E/L383S 5T/7T 1 (Figure 1). Login to comment
99 The prostate gland showed normal size and A1006E/- 5T/5T 1 morphology in all patients. Login to comment

PMID: 15084222 [PubMed] D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."

No. Sentence Comment

55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

PMID: 16189704 [PubMed] McGinniss MJ et al: "Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples."

No. Sentence Comment

53 Finally, one CF patient with mild symptoms carried a complex allele [p.V562I; p.A1006E] and a nonsense mutation (p.R1158X) on the other allele. Login to comment
103 The last two samples were from affected siblings and were found to be positive for three previously described CFTR mutations: p.V562I, p.A1006E, and p.R1158X. Login to comment

PMID: 18306312 [PubMed] Gene GG et al: "N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel."

No. Sentence Comment

133 Genotype^Phenotype Correlation in the N-Terminal CFTR MissenseVariants Under StudyÃ Missense varianta Phenotype Second allele (number of patients)b p.P5L CF p.F508del (1), p.P205S (1) p.S50P CBAVD p.F508del (1), p.E115del (1) p.E60K CF p.G542X (1), p.I507del (1) p.R75Q HT p.F508del (3), p.E725K (1) B p.R347H (1), p.R75Q (1), n.i. (4) Br c.1584G4A (2), c.1210-7_1210-6delTT (1), n.i.(3) NT p.F508del (1) CP c.1584G4A (1), n.i. (3) MI n.i. (1) CUAVD n.i. (2) OZ n.i. (2) Normal p.R75Q (1), c.2052_2053insA (1), n.i. (1) p.G85E CF p.F508del (8), p.G542X (2), p.I507del (1), c.580-1G4T (1), p.G85E (1), c.1477_ 1478delCA (1) CBAVD p.G576A (1) HT p.L997F (1),WT (1) p.G85V CF p.F508del (2), p.G542X (2), p.Y1092X (1), c.265715G4A (1), p.A1006E, c.1210-7_1210- 6delTT (1), n.i. (1) p.Y89C CF n.i. (1)c p.E92K CF p.F508del (2), p.Q890X (1), p.L206W (1) CBAVD c.1210-7_1210-6delTT (1) ÃThe recommendations for mutation nomenclature (www.hgvs.org/mutnomen/) were used to name CFTR gene sequence variations at both the nucleotide level and the protein level. Login to comment

PMID: 19845690 [PubMed] Moya-Quiles MR et al: "CFTR mutations in cystic fibrosis patients from Murcia region (southeastern Spain): implications for genetic testing."

No. Sentence Comment

17 of chromosomes Frequency (%) F508dela E.10 67 36.8 G542Xa E.11 22 12.1 A1006E E.17a 10 5.5 K710X E.13 10 5.5 2789+5G>Aa I.14b 9 4.9 L206W E.6a 7 3.8 1811+1.6kbA>G I.11 6 3.3 R334Wa E.7 5 2.7 2869insG E.15 5 2.7 I507dela E.10 4 2.2 N1303Ka E.21 4 2.2 R347Pa E.7 3 1.6 711+1G>Ta I.5 3 1.6 3849+10kbC>Ta I.19 3 1.6 Q890X E.15 3 1.6 R117Ha E.4 2 1.1 R1162Xa E.19 2 1.1 2183AA>Ga E.13 2 1.1 A561E E.12 2 1.1 R560G E.11 2 1.1 1717-1G>Aa I.10 1 0.5 E1308X E.21 1 0.5 E585X E.12 1 0.5 L997F E.17a 1 0.5 1677delTA E.10 1 0.5 R1158X E.19 1 0.5 W202X E.6a 1 0.5 R74W+D1270N E.3 + E.20 1 0.5 G576A+R668C E.12 + E.13 1 0.5 Unknown 2 1.1 Total 182 100 aCFTR mutations identified with the PCR OLA CF Genotyping Assay . Login to comment
20 Letter to the Editor Although we observed a marked difference in the frequency distribution of all mutations, it was interesting to note that the third and fourth most prevalent were A1006E and K710X, mutations undetected by commercial panels and each presenting with a frequency of 5.5%. Login to comment
22 In Mediterranean France the K710X mutation showed a frequency of 0.93% and the A1006E mutation has never been reported (11). Login to comment
23 By contrast, the A1006E mutation has been previously reported in Italians (15). Login to comment
27 This may be due to the relatively low influx of people from other Spanish regions, hence not diluting the frequency of mutations that are common in this region, including A1006E or K710X. Login to comment

PMID: 20691141 [PubMed] Tomaiuolo AC et al: "Clinical hallmarks and genetic polymorphisms in the CFTR gene contribute to the disclosure of the A1006E mutation."

No. Sentence Comment

0 Clinical hallmarks and genetic polymorphisms in the CFTR gene contribute to the disclosure of the A1006E mutation Anna Cristina Tomaiuolo MSc1 Federico Alghisi MD2 Stefano Petrocchi MSc1 Cecilia Surace PhD1 Maria Cristina Roberti PhD1 Sergio Bella MD2 Vincenzina Lucidi MD2 Adriano Angioni MD1 1 Cytogenetics and Molecular Genetics Laboratory. Login to comment
6 From a familial study of a patient with CBAVD, carrier of the A1006E mutation, we have observed its strict association with the polymorphism 5T-TG11. Login to comment
7 In order to speed up the genetic diagnosis and to correlate the clinical setting to this genetic feature, we have directly investigated the exon 17a, where the A1006E mutation is located, of five cystic fibrosis patients belonging to two unrelated families. Login to comment
9 One more family with two affected individuals carrying the Q220X/A1006E mutations was investigated for the poly-T polymorphism. Login to comment
10 All the members were found to have the A1006E mutation and the 5T-TG11 in the same DNA strand, demonstrating that this strategy is a reliable and inexpensive method for genotyping the CFTR gene. Login to comment
15 Among these, due to familial segregation studies, we have found that the A1006E mutation is in cis with the 5T-TG11 polymorphism. Login to comment
16 Based on these observations we have decided to use the 5T-TG11 haplotype to trace the A1006E mutation in five CF patients with incomplete genotyping, belonging to two unrelated families. Login to comment
17 Two additional related patients, both compound heterozygotes carrying the A1006E, were investigated for the Tn-TGm locus to implement the finding of this association. Login to comment
28 They also carried the same CFTR gene mutations (Q220X/A1006E). Login to comment
56 Family 1 and Family 3 members underwent exon 17a sequencing that revealed the 3149 C>A mutation (A1006E) in all of them. Login to comment
58 A familial study involving all the informative relatives was then carried out showing the linkage of 5T-TG11 with the A1006E mutation. Login to comment
59 Discussion The A1006E is included in the group of the so called "borderline mutations".7 It is a missense defect due to the C to A nucleotide variation at 3149, within the exon 17a, resulting in the amino acid change alanine to glutamic acid. Login to comment
60 The involved proteic region is the second membrane spanning domain that contributes to complete the proper CFTR channel structure In our CF patient`s database the A1006E mutation has been detected, using the trace of the 5T-TG11 polymorphism, in 3 out of 436 CF chromosomes, accounting for an estimated incidence of about 0.7%. Login to comment
62 These results have been further confirmed through familial studies of informative relatives that showed the same linkage of the 5T-TG11 polymorphism with the A1006E mutation. Login to comment
66 Among the A1006E partners a possible role in modifying gene activity may be attributed to the poly-5T-TG tract, and indirectly, to M470V. Login to comment
69 The A1006E mutation has been detected in large series of patients with CBAVD or CF but scarce information is available from the clinical setting. Login to comment
72 Despite the late onset of clinical presentation (mean age at di- Tomaiuolo et al. A1006E mutation and TG(m)Tn polymorphism (c) 2010 CIM Clin Invest Med • Vol 33, no 4, August 2010 E237. Login to comment
73 TABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR gene Patients Haplotype Mutations Tn-TGm Sequence variations Sequence variations Pt1 Strand 1 F508del 9T-TG10 M470V Strand 2 A1006E 5T-TG11 M470V - Pts2-3 Strand 1 Q220X 7T-TG11 M470V Strand 2 A1006E 5T-TG11 M470V V562I Pts4-7 Strand 1 F508del 9T-TG10 M470V Strand 2 A1006E 5T-TG11 M470V V562I TABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR gene Pts Age at diagnosis Sweat test Current clinical statusCurrent clinical statusCurrent clinical statusCurrent clinical statusCurrent clinical status (years) (mmol/L) Age (years) X-Ray Lung Assessment FEV1% PS ARP 1 35 Cl: 84 36 Bronchiectasis 61 - - 2 21 Cl: 74 36 Bronchiectasis 76 - + 3 14 Cl: 76 29 Bronchiectasis 73 + - 4 IRT + Na: 76 18 Bronchial thickening 110 + - 5 16 Na: 121 34 Initial bronchiectasis 86 + - 6 14 Na: 119 32 Bronchiectasis; lobe excision 74 - + 7 13 Na: 97 31 Bronchial thickening 91 + - IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` agnosis of 16.2 ± 10.5 years, median age of 14 years) the course of the disease leads to a complete phenotypic expression. Login to comment
81 An interesting observation is the unexpectedly elevated incidence of the A1006E mutation within our data base of CF patients. Login to comment
83 Moreover, the geographic origin of our families may suggest a possible relationship for the high rate of the A1006E, with the historical Spanish domination along the south-western regions of our country. Login to comment
84 In conclusion, the study reports a detailed description of the phenotypic spectrum of the A1006E mutation, providing useful information for a ready and inexpensive genotyping in selected cases. Login to comment
86 For the clinical setting, these results illustrate the importance of an early detection of the disease - before the patients become symptomatic;17 IRT and sweat test appear to be sensitive diagnostic tests for patients affected by the A1006E mutation. Login to comment

PMID: 20706124 [PubMed] Lucarelli M et al: "A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation."

No. Sentence Comment

103 In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former. Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

45 (%) p.F508del # E.10 1009 (51.74) p.G542X # E.11 150 (7.69) p.N1303K # E.21 57 (2.92) c.1811 + 1.6kbA > G I.11 36 (1.84) p.R334W # E.7 35 (1.79) p.L206W E.6a 32 (1.64) c.711 + 1G > T # I.5 31 (1.58) p.Q890X E.15 28 (1.43) p.R1162X # E.19 25 (1.28) c.2789 + 5G > A # I.14b 24 (1.23) p.R1066C E.17b 23 (1.18) p.I507del # E.10 21 (1.07) c.1609delCA E.10 18 (0.92) c.712-1G > T I.5 18 (0.92) c.3272-26A > G I.17a 18 (0.92) c.2183AA > G # E.13 16 (0.82) p.G85E # E.3 15 (0.77) c.2869insG E.15 15 (0.77) p.W1282X # E.20 15 (0.77) p.V232D E.6a 14 (0.71) p.A1006E * E.17a 12 (0.61) c.2184insA E.13 11 (0.56) p.K710X E.13 11 (0.56) TOTAL (n = 23) 1,634 (83.72) * , the complex allele [p.A1006E; p.V562I; IVS8-6(5T)] #, CF mutations identified with the Celera Diagnosis Cystic Fibrosis v2 genotyping assay and the Inno-Lipa CFTR12, CFTR17 + Tn Samples with microsatellite haplotypes 16/45-46-47 (IVS8CA/IVS17bTA) were submitted to direct analysis of the c.1811 + 1.6kbA > G mutation, which was found mainly associated with the 16-46 haplotype. Login to comment
66 For example the IVS8-6(5T) allele was detected in cis with four different mutations (p.S50P, c.2751 + 3A > G, p.A1006E and p.F1074L). Login to comment
70 The major complexity detected is attributable to the polyvariant [p.A1006E; p.V562I; IVS8-6(5T)], which was observed in all patients with the p.A1006E mutation (Table 1). Login to comment
85 In addition, three other mild mutations, c.3272-26A > G, p.V232D and p.A1006E, showed frequencies ranging from 0.9% to 0.6% (Table 1). Login to comment

PMID: 19236881 [PubMed] Enquist K et al: "Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein."

No. Sentence Comment

113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment

PMID: 22439061 [PubMed] Mesoraca A et al: "The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis."

No. Sentence Comment

80 Through the use of DHPLC, all the exonic regions of the CFTR gene were analysed and through the technique 44 of the 53 couples were found to be negative, while for 9 couples, 9 rare mutations were identified which were not revealed in I level screening: R1066C, L1065P, L1077P (exon 17b), A1006E (exon 19), R75Q (exon 3), D537E (exon 11), W1134X (exon 18), R1145X (exon 18), C524X (exon 11). Login to comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations. Login to comment

PMID: 9439669 [PubMed] Casals T et al: "High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes."

No. Sentence Comment

33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

215 The Q779X (p.Gln779*) mutation was found in a CF-PS brother and sister with a [(TG)11T5; V562I; A1006E]/Q779X (c. Login to comment
288 The V562I (p.Val562Ile) and the A1006E (p.Ala1006Glu) were only found within the complex allele. Login to comment
377 [1210-14TG[11];1210-12T[5];1684G>A;3017C>A] CF-PS,CFTR-RD T5 varying clinical consequence; V562I nd; A1006E nd K442X c.1324A>T CF-PI nd p.Lys442* T465N c.1394C>A CF-PI nd p.Thr465Asn [S466X(TGA);R1070Q] c. Login to comment