ABCMdb

ABCC7 p.Arg553Gln

ClinVar:	c.1657C>T , p.Arg553* D , Pathogenic c.1657C>G , p.Arg553Gly ? , not provided c.1658G>A , p.Arg553Gln D , Pathogenic
CF databases:	c.1657C>T , p.Arg553* D , CF-causing c.1657C>G , p.Arg553Gly (CFTR1) ? , This mutation was found identified by DGGE and direct sequencing. This nucleotide change was observe in a French CF chromosome. c.1658G>A , p.Arg553Gln (CFTR1) ? , The amino acid change was found in a German CF patient on the maternal [delta]F508 CF chromosome associated with the haplotype 1-2-1-1-1-2 in J3.11(Msp) - KM.19 (Pst) - XV-2c - metH(Msp) - metH (Taq) - metD(taq). The paternal CF chromosome carries the 553X Stop mutation. So far, the R553Q mutation was not found on a small number of normal and of CF [delta]F508 or non-[delta]F508 chromosomes. Since this mutation occurs in the region of sequence identity with other membrane-associated proteins or transport systems that may contain glutamine instead of a basic amino acid at this position, we assume that this mutation may be neither a polymorphism nor may cayse disease but rather modulates the function of the [delta]F508 CFTR gene product.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (85%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (59%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: N, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: D, P: D, Q: N, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Complex allele [-102T>A+S549R(T>G)] is associated ... Hum Genet. 1999 Jul-Aug;105(1-2):145-50. Romey MC, Guittard C, Chazalette JP, Frossard P, Dawson KP, Patton MA, Casals T, Bazarbachi T, Girodon E, Rault G, Bozon D, Seguret F, Demaille J, Claustres M
Complex allele [-102T>A+S549R(T>G)] is associated with milder forms of cystic fibrosis than allele S549R(T>G) alone.
Hum Genet. 1999 Jul-Aug;105(1-2):145-50., [PMID:10480369]

Abstract [show]
We recently reported a novel complex allele in the cystic fibrosis transmembrane regulator (CFTR) gene, combining a sequence change in the minimal CFTR promoter (-102T>A) and a missense mutation in exon 11 [S549R(T>G)]. Here we compare the main clinical features of six patients with cystic fibrosis (CF) carrying the complex allele [-102T>A+S549R(T>G)] with those of 16 CF patients homozygous for mutation S549R(T>G) alone. Age at diagnosis was higher, and current age was significantly higher (P=0.0032) in the group with the complex allele, compared with the S549R/S549R group. Although the proportion of patients with lung colonization was similar in both groups, the age at onset was significantly higher in the group with the complex allele (P=0.0022). Patients with the complex allele also had significantly lower sweat test chloride values (P=0.0028) and better overall clinical scores (P=0.004). None of the 22 patients reported in this study had meconium ileus. All 16 patients homozygous for S549R(T>G), however, were pancreatic insufficient, as compared with 50% of patients carrying the complex allele (P=0.013). Moreover, the unique patient homozygous for [-102T>A+S549R(T>G)] presented with a mild disease at 34 years of age. These observations strongly suggest that the sequence change (-102T>A) in the CFTR minimal promoter could attenuate the severe clinical phenotype associated with mutation S549R(T>G).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 For instance, the missense mutation R553Q, when carried on a ∆ F508 allele, has been shown to be associated with almost normal sweat electrolyte values in a patient with severe CF (Dörk et al. 1991), suggesting that R553Q may partially suppress the ∆F508 chloride transport defect in sweat glands of this patient. Login to comment
80 It was later demonstrated in a yeast expression system that the abnormal folding produced by ∆F508 can be partially corrected by the additional, "revertant" mutation R553Q (Teem et al. 1993). Login to comment

[hide] Two mild cystic fibrosis-associated mutations resu... J Biol Chem. 2001 Mar 23;276(12):9045-9. Epub 2000 Dec 15. Clain J, Fritsch J, Lehmann-Che J, Bali M, Arous N, Goossens M, Edelman A, Fanen P
Two mild cystic fibrosis-associated mutations result in severe cystic fibrosis when combined in cis and reveal a residue important for cystic fibrosis transmembrane conductance regulator processing and function.
J Biol Chem. 2001 Mar 23;276(12):9045-9. Epub 2000 Dec 15., 2001-03-23 [PMID:11118444]

Abstract [show]
The number of complex cystic fibrosis transmembrane conductance regulator (CFTR) genotypes identified as having double-mutant alleles with two mutations inherited in cis has been growing. We investigated the structure-function relationships of a severe cystic fibrosis (CF)-associated double mutant (R347H-D979A) to evaluate the contribution of each mild mutation to the phenotype. CFTR mutants expressed in HeLa cells were analyzed for protein biosynthesis and Cl(-) channel activity. Our data show that R347H is associated with mild defective Cl(-) channel activity and that the D979A defect leads to misprocessing. The mutant R347H-D979A combines both defects for a dramatic decrease in Cl(-) current. To decipher the molecular mechanism of this phenotype, single and double mutants with different charge combinations at residues 347 and 979 were constructed as charged residues were involved in this complex genotype. These studies revealed that residue 979, located in the third cytoplasmic loop, is critical for CFTR processing and Cl(-) channel activity highlighting the role of charged residues. These results have also important implications for CF, as they show that two mutations in cis can act in concert to alter dramatically CFTR function contributing to the wide phenotypic variability of CF disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 DISCUSSION Complex alleles have been described clinically (R553Q- ⌬F508, ⌬F508-V1212I, and R334W-R1158X), and most of them are considered to reverse the phenotype, as they are associated with milder symptoms than the most common mutation in isolation. Login to comment

[hide] Mutations in the nucleotide binding domain 1 signa... J Biol Chem. 2002 Sep 27;277(39):35896-905. Epub 2002 Jul 10. DeCarvalho AC, Gansheroff LJ, Teem JL
Mutations in the nucleotide binding domain 1 signature motif region rescue processing and functional defects of cystic fibrosis transmembrane conductance regulator delta f508.
J Biol Chem. 2002 Sep 27;277(39):35896-905. Epub 2002 Jul 10., 2002-09-27 [PMID:12110684]

Abstract [show]
The gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR), an ATP binding cassette (ABC) transporter that functions as a phosphorylation- and nucleotide-regulated chloride channel, is mutated in cystic fibrosis (CF) patients. Deletion of a phenylalanine at amino acid position 508 (DeltaF508) in the first nucleotide binding domain (NBD1) is the most prevalent CF-causing mutation and results in defective protein processing and reduced CFTR function, leading to chloride impermeability in CF epithelia and heterologous systems. Using a STE6/CFTRDeltaF508 chimera system in yeast, we isolated two novel DeltaF508 revertant mutations, I539T and G550E, proximal to and within the conserved ABC signature motif of NBD1, respectively. Western blot and functional analysis in mammalian cells indicate that mutations I539T and G550E each partially rescue the CFTRDeltaF508 defect. Furthermore, a combination of both revertant mutations resulted in a 38-fold increase in CFTRDeltaF508-mediated chloride current, representing 29% of wild type channel activity. The G550E mutation increased the sensitivity of CFTRDeltaF508 and wild type CFTR to activation by cAMP agonists and blocked the enhancement of CFTRDeltaF508 channel activity by 2 mm 3-isobutyl-1-methylxanthine. The data show that the DeltaF508 defect can be significantly rescued by second-site mutations in the nucleotide binding domain 1 region, that includes the LSGGQ consensus motif.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 Interestingly, the three ⌬F508 revertant mutations previously isolated using the STE6/CFTR system, R553Q, R553M, and R555K, are also located within the NBD1 signature motif (28, 29). Login to comment

[hide] The phenotypic consequences of CFTR mutations. Ann Hum Genet. 2003 Sep;67(Pt 5):471-85. Rowntree RK, Harris A
The phenotypic consequences of CFTR mutations.
Ann Hum Genet. 2003 Sep;67(Pt 5):471-85., [PMID:12940920]

Abstract [show]
Cystic fibrosis is a common autosomal recessive disorder that primarily affects the epithelial cells in the intestine, respiratory system, pancreas, gall bladder and sweat glands. Over one thousand mutations have currently been identified in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene that are associated with CF disease. There have been many studies on the correlation of the CFTR genotype and CF disease phenotype; however, this relationship is still not well understood. A connection between CFTR genotype and disease manifested in the pancreas has been well described, but pulmonary disease appears to be highly variable even between individuals with the same genotype. This review describes the current classification of CFTR mutation classes and resulting CF disease phenotypes. Complex disease alleles and modifier genes are discussed along with alternative disorders, such as disseminated bronchiectasis and pancreatitis, which are also thought to result from CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
172 The first complex allele to be described was in 1991 where R553Q was detected on the same allele as F508 of a CF patient also carrying the R553X mutation (Dork et al. 1991). Login to comment
173 This patient exhibited pancreatic insufficiency and severe pulmonary disease but a borderline sweat test, suggesting that the R553Q mutation is somehow modulating the severity of CF disease normally associated with F508. Login to comment
174 Analysis of the crystal structure of the related ABC protein, HisP, showed that these two mutations are predicted to lie in adjacent α-helices and that R553Q lies in a region essential for the integrity of protein folding (Hung et al. 1998). Login to comment

[hide] Impact of the deltaF508 mutation in first nucleoti... J Biol Chem. 2005 Jan 14;280(2):1346-53. Epub 2004 Nov 3. Lewis HA, Zhao X, Wang C, Sauder JM, Rooney I, Noland BW, Lorimer D, Kearins MC, Conners K, Condon B, Maloney PC, Guggino WB, Hunt JF, Emtage S
Impact of the deltaF508 mutation in first nucleotide-binding domain of human cystic fibrosis transmembrane conductance regulator on domain folding and structure.
J Biol Chem. 2005 Jan 14;280(2):1346-53. Epub 2004 Nov 3., 2005-01-14 [PMID:15528182]

Abstract [show]
Cystic fibrosis is caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR), commonly the deletion of residue Phe-508 (DeltaF508) in the first nucleotide-binding domain (NBD1), which results in a severe reduction in the population of functional channels at the epithelial cell surface. Previous studies employing incomplete NBD1 domains have attributed this to aberrant folding of DeltaF508 NBD1. We report structural and biophysical studies on complete human NBD1 domains, which fail to demonstrate significant changes of in vitro stability or folding kinetics in the presence or absence of the DeltaF508 mutation. Crystal structures show minimal changes in protein conformation but substantial changes in local surface topography at the site of the mutation, which is located in the region of NBD1 believed to interact with the first membrane spanning domain of CFTR. These results raise the possibility that the primary effect of DeltaF508 is a disruption of proper interdomain interactions at this site in CFTR rather than interference with the folding of NBD1. Interestingly, increases in the stability of NBD1 constructs are observed upon introduction of second-site mutations that suppress the trafficking defect caused by the DeltaF508 mutation, suggesting that these suppressors might function indirectly by improving the folding efficiency of NBD1 in the context of the full-length protein. The human NBD1 structures also solidify the understanding of CFTR regulation by showing that its two protein segments that can be phosphorylated both adopt multiple conformations that modulate access to the ATPase active site and functional interdomain interfaces.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 We also investigated the effect of three suppressor mutations (G550E, R553Q, R555K) that have been observed to improve in vivo trafficking efficiency of STE6-CFTR chimeras containing the ⌬F508 mutation expressed in yeast (23-25). Login to comment
100 Crystal Structure of ⌬F508 hNBD1 Shows Minimal Conformational Changes but Substantive Changes in Surface Topography at the Putative Site of MSD1 Interaction-Crystals diffracting to a resolution of 2.3 Å were obtained for hNBD1-7a- ⌬F508, which contains seven mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of Phe-508 (see Table II). Login to comment
139 The three suppressor mutations (G550E, R553Q, R555K) occur either in or immediately following the LSGGQ signature sequence at the N terminus of ␣-helix 5. Login to comment

[hide] Side chain and backbone contributions of Phe508 to... Nat Struct Mol Biol. 2005 Jan;12(1):10-6. Epub 2004 Dec 26. Thibodeau PH, Brautigam CA, Machius M, Thomas PJ
Side chain and backbone contributions of Phe508 to CFTR folding.
Nat Struct Mol Biol. 2005 Jan;12(1):10-6. Epub 2004 Dec 26., [PMID:15619636]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an integral membrane protein, cause cystic fibrosis (CF). The most common CF-causing mutant, deletion of Phe508, fails to properly fold. To elucidate the role Phe508 plays in the folding of CFTR, missense mutations at this position were generated. Only one missense mutation had a pronounced effect on the stability and folding of the isolated domain in vitro. In contrast, many substitutions, including those of charged and bulky residues, disrupted folding of full-length CFTR in cells. Structures of two mutant nucleotide-binding domains (NBDs) reveal only local alterations of the surface near position 508. These results suggest that the peptide backbone plays a role in the proper folding of the domain, whereas the side chain plays a role in defining a surface of NBD1 that potentially interacts with other domains during the maturation of intact CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 Note added in proof: Crystal structures of the human F508A missense NBD1 (with solublizing mutations F429S and H667R) and the corrected ∆F508 NBD1 (with three known suppressor mutations G550E, R553Q and R555K, and the solublizing mutations F409L, F429S, F433L and H667R) have been reported51. Login to comment

[hide] Light and alcohol evoked electro-oculograms in cys... Doc Ophthalmol. 2006 Sep;113(2):133-43. Epub 2006 Oct 5. Constable PA, Lawrenson JG, Arden GB
Light and alcohol evoked electro-oculograms in cystic fibrosis.
Doc Ophthalmol. 2006 Sep;113(2):133-43. Epub 2006 Oct 5., [PMID:17021906]

Abstract [show]
Cystic fibrosis (CF) is caused by a defect in the cystic fibrosis transmembrane conductance regulator (CFTR) which is a chloride channel. CFTR is expressed in the retinal pigment epithelium (RPE) where it is believed to be important in generating the fast oscillations (FOs) and potentially contributing to the light-electro-oculogram (EOG). The role of CFTR in the alcohol-EOG is unknown. We recruited six individuals with CF (three homozygotes for Delta508 and three heterozygous for Delta508) and recorded the light- and alcohol-EOGs as well as the FOs and compared them to a control group. The results showed that in the CF group the amplitude of the alcohol- and light-EOGs were normal. However, the time to peak of the light- and alcohol-rises were significantly faster than in the control group. We conclude that CFTR is not primarily responsible for the alcohol- or light-rises but is involved in altering the timing of these responses. The FOs showed differences between the homozygotes, heterozygotes and the controls. The amplitudes were significantly higher and the time to the dark troughs were significantly slower in the heterozygote group compared to both controls and the homozygotes. In contrast, the homozygotes did not differ in either amplitude or the timing of the FOs compared to the controls.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
204 In D508, the accompanying mutation R553Q confers stability to the protein so that it retains function by improving the folding and trafficking of CFTR to the plasma membrane [60]. Login to comment

[hide] Functional analysis of mutations in the putative b... J Biol Chem. 2007 Mar 23;282(12):9098-104. Epub 2007 Jan 23. Zegarra-Moran O, Monteverde M, Galietta LJ, Moran O
Functional analysis of mutations in the putative binding site for cystic fibrosis transmembrane conductance regulator potentiators. Interaction between activation and inhibition.
J Biol Chem. 2007 Mar 23;282(12):9098-104. Epub 2007 Jan 23., 2007-03-23 [PMID:17244607]

Abstract [show]
An increasing number of compounds able to potentiate the activity of mutants of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel have been identified by high throughput screening or by individual search of derivatives of known active compounds. Several lines of evidence suggest that most CFTR potentiators act through the same mechanism, probably by binding to the nucleotide binding domains to promote the activity of the protein and then, with lower affinity, to an inhibitory site. With the aim of identifying the activating binding site, we recently modeled the nucleotide binding domain dimer and predicted a common binding site for potentiators in its interface. To validate this model experimentally, we mutated some of the residues involved in the putative binding site, i.e. Arg(553), Ala(554), and Val(1293). The activity of CFTR potentiators was measured as apical membrane currents on polarized cells stably expressing wild type or mutated proteins. CFTR activity was elicited by application of a membrane-permeable cAMP analogue followed by increasing concentrations of potentiators. We found that all three mutants responded to cAMP, although the affinity of R553Q was higher than that of wild type CFTR. In R553Q and V1293G mutants, the dissociation constant of potentiators for the activating site was increased, whereas the dissociation constant for the inhibitory site was reduced. Our results show that the mutated residues are part of the activating binding site for potentiators, as suggested by the molecular model. In addition, these results suggest that the activating and inhibitory sites are not independent of each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 We found that all three mutants responded to cAMP, although the affinity of R553Q was higher than that of wild type CFTR. Login to comment
6 In R553Q and V1293G mutants, the dissociation constant of potentiators for the activating site was increased, whereas the dissociation constant for the inhibitory site was reduced. Login to comment
44 We found that the stimulating effect of potentiators was reduced for R553Q and V1293G. Login to comment
50 For mutations A554E and R553Q, CFTR cDNA was subcloned on pcDNA3.1. Login to comment
52 V1293G clones were selected and maintained in 800 ␮g/ml Zeocin, and A554E and R553Q constructs were selected and maintained in 1 mg/ml G418. Login to comment
53 Cell Cultures-FRT cells expressing wild type (WT), V1293G, A554E, or R553Q CFTR were cultured on 60-mm Petri dishes with Coon`s modified F12 containing 5% fetal bovine serum, 2 mM L-glutamine, 50 units/ml penicillin, and 50 ␮g/ml streptomycin and selection antibiotics, as described previously (15). Login to comment
86 Conversely, the dissociation constant for R553Q was significantly smaller. Login to comment
98 Continuous lines (WT, A554E, and V1293G) and broken lines (R553Q) indicate fitting of the data to Equation 1. Login to comment
100 Wild type A554E V1293G R553Q G551D n ϭ 5 n ϭ 4 n ϭ 4 n ϭ 6 n ϭ 7 Imax (␮A/cm2 ) 282.2 Ϯ 13.5 66.9 Ϯ 16.4a 70.2 Ϯ 14a 93.8 Ϯ 19a 10.1 Ϯ 2.8a Kd (␮M) 54.2 Ϯ 11.5 40.5 Ϯ 5.9 48.4 Ϯ 13.5 21.5 Ϯ 4.5a 74.2 Ϯ 12.1 I(20)/I(max) 0.3 Ϯ 0.04 0.34 Ϯ 0.03 0.32 Ϯ 0.05 0.51 Ϯ 0.05a 0.23 Ϯ 0.03 a p Ͻ 0.05. Login to comment
102 It is interesting to note that 20 ␮M CPTcAMP produced a similar current fraction (ϳ0.3) on mutants V1293G and A554E but half of the maximum current (ϳ0.5) on R553Q (see I(20)/ I(max) in Table 1), in agreement with the lower Kd of CPT-cAMP found on this mutant. Login to comment
108 In contrast, the protein with the adjacent residue mutated, R553Q, behaved in a completely different way. Login to comment
110 Mutant V1293G behavior was between A554E and R553Q. Login to comment
111 In fact, the two equilibrium constants were modified but less than in mutant R553Q (Table 2). Login to comment
120 In fact, the more the Ka value shifted toward higher concentrations, as in the case of genistein for R553Q, the more the Ki value shifted toward lower concentrations. Login to comment
123 A, representative traces showing the response of wild type CFTR and mutant R553Q to application of genistein. Login to comment
130 Compounds Protein n fA Ka Ki ␮M ␮M Genistein Wild type 5 1.33 Ϯ 0.41 3.08 Ϯ 0.74 562.4 Ϯ 111.1 A554E 6 2.75 Ϯ 0.62 4.58 Ϯ 0.51 408.6 Ϯ 84.8 V1293G 6 4.87 Ϯ 1.91 12 Ϯ 3.9a 270.5 Ϯ 36.4a R553Q 6 1.87 Ϯ 0.12 22.28 Ϯ 5.2a 119.9 Ϯ 34.9a UCCF029 Wild type 4 0.41 Ϯ 0.04 0.021 Ϯ 0.002 1036 Ϯ 523 A554E 4 1.56 Ϯ 0.45a 0.036 Ϯ 0.009 1519 Ϯ 651 V1293G 5 3.19 Ϯ 1.09 0.042 Ϯ 0.008 843 Ϯ 126 R553Q 5 1.08 Ϯ 0.17a 0.154 Ϯ 0.029a 547 Ϯ 99 Act-06 Wild type 5 0.8 Ϯ 0.17 0.69 Ϯ 0.33 439.6 Ϯ 108 A554E 4 1.67 Ϯ 0.42 0.74 Ϯ 0.25 319.1 Ϯ 42.4 V1293G 4 1.25 Ϯ 0.16 0.35 Ϯ 0.09 383.8 Ϯ 28.9 R553Q 6 1.77 Ϯ 0.47a 2.11 Ϯ 0.73 179.1 Ϯ 73.2a a Student`s t test indicated that these values were statistically different from those on WT CFTR with p Ͻ 0.05. Login to comment
149 Surprisingly, we found a lower equilibrium constant for CPT-cAMP on mutant R553Q (see Table 2). Login to comment
152 It is interesting to note that mutation R553Q is one of the CF mutations identified as ⌬Phe508 revertants (34). Login to comment
153 That means that introduction of R553Q mutation into human CFTR partially corrects the processing and gating defect caused by the ⌬Phe508 mutation, which has been suggested to modify the NBD1 surface that interacts with other CFTR domains (20). Login to comment
163 In fact, the mutation that produced a stronger shift of the affinity for these compounds was R553Q, where the charge was eliminated. Login to comment
167 The CFTR proteins are indicated in red, yellow, green, and blue for R553Q, V1293G, A554E and WT, respectively. Login to comment
176 Actually, we found that an increased Ka in R553Q and V1293G with respect to wild type CFTR is accompanied by a reduced Ki (Figs. Login to comment

[hide] Diminished self-chaperoning activity of the DeltaF... PLoS Comput Biol. 2008 Feb 29;4(2):e1000008. Serohijos AW, Hegedus T, Riordan JR, Dokholyan NV
Diminished self-chaperoning activity of the DeltaF508 mutant of CFTR results in protein misfolding.
PLoS Comput Biol. 2008 Feb 29;4(2):e1000008., [PMID:18463704]

Abstract [show]
The absence of a functional ATP Binding Cassette (ABC) protein called the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) from apical membranes of epithelial cells is responsible for cystic fibrosis (CF). Over 90% of CF patients carry at least one mutant allele with deletion of phenylalanine at position 508 located in the N-terminal nucleotide binding domain (NBD1). Biochemical and cell biological studies show that the DeltaF508 mutant exhibits inefficient biosynthetic maturation and susceptibility to degradation probably due to misfolding of NBD1 and the resultant misassembly of other domains. However, little is known about the direct effect of the Phe508 deletion on the NBD1 folding, which is essential for rational design strategies of cystic fibrosis treatment. Here we show that the deletion of Phe508 alters the folding dynamics and kinetics of NBD1, thus possibly affecting the assembly of the complete CFTR. Using molecular dynamics simulations, we find that meta-stable intermediate states appearing on wild type and mutant folding pathways are populated differently and that their kinetic accessibilities are distinct. The structural basis of the increased misfolding propensity of the DeltaF508 NBD1 mutant is the perturbation of interactions in residue pairs Q493/P574 and F575/F578 found in loop S7-H6. As a proof-of-principle that the S7-H6 loop conformation can modulate the folding kinetics of NBD1, we virtually design rescue mutations in the identified critical interactions to force the S7-H6 loop into the wild type conformation. Two redesigned NBD1-DeltaF508 variants exhibited significantly higher folding probabilities than the original NBD1-DeltaF508, thereby partially rescuing folding ability of the NBD1-DeltaF508 mutant. We propose that these observed defects in folding kinetics of mutant NBD1 may also be modulated by structures separate from the 508 site. The identified structural determinants of increased misfolding propensity of NBD1-DeltaF508 are essential information in correcting this pathogenic mutant.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 However, even in the presence of correcting mutants (G550E, R553Q, and R555K) [10,15-17] in our model of NBD1-DF508, we still observe a significant change in dynamics at the folding transition. Login to comment

[hide] Atomic model of human cystic fibrosis transmembran... Cell Mol Life Sci. 2008 Aug;65(16):2594-612. Mornon JP, Lehn P, Callebaut I
Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces.
Cell Mol Life Sci. 2008 Aug;65(16):2594-612., [PMID:18597042]

Abstract [show]
We describe herein an atomic model of the outward-facing three-dimensional structure of the membrane-spanning domains (MSDs) and nucleotide-binding domains (NBDs) of human cystic fibrosis transmembrane conductance regulator (CFTR), based on the experimental structure of the bacterial transporter Sav1866. This model, which is in agreement with previous experimental data, highlights the role of some residues located in the transmembrane passages and directly involved in substrate translocation and of some residues within the intracellular loops (ICL1-ICL4) making MSD/NBD contacts. In particular, our model reveals that D173 ICL1 and N965 ICL3 likely interact with the bound nucleotide and that an intricate H-bond network (involving especially the ICL4 R1070 and the main chain of NBD1 F508) may stabilize the interface between MSD2 and the NBD1F508 region. These observations allow new insights into the ATP-binding sites asymmetry and into the molecular consequences of the F508 deletion, which is the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 These mutations are actually located outside the NBD1 structure core, in the regulatory insertion (F409L, F429S, F433L) and extension (R667H), or in the signature sequence region (G550E, R553Q, R555K), whose local conformations in the crystal structure and in our model are perfectly superimposable. Login to comment

[hide] Transient correction of the basic defect in sweat ... Thorax. 2009 Feb;64(2):179-80. Tummler B, Stanke F, Bronsveld I, Veeze H, Ballmann M
Transient correction of the basic defect in sweat glands in an individual with cystic fibrosis carrying the complex CFTR allele F508del-R553Q.
Thorax. 2009 Feb;64(2):179-80., [PMID:19176844]

Abstract [show]
The molecular pathology of mutant F508del CFTR is partially corrected in vitro by the secondary amino acid substitution R553Q in the ABC signature motif. An individual with the CFTR genotype R553X/F508del-R553Q showed the typical symptoms and electrophysiological anomalies of cystic fibrosis in the airways and intestine. Sweat chloride concentrations were normal early in life, but were later raised into the range that is diagnostic for cystic fibrosis, suggesting that R553Q could temporarily correct the basic defect in sweat glands. R553Q caused a delay in diagnosis because of false negative sweat tests but was not a disease reverting suppressor mutation as had been inferred from cellular models.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Transient correction of the basic defect in sweat glands in an individual with cystic fibrosis carrying the complex CFTR allele F508del-R553Q B Tu¨mmler,1,2 F Stanke,1 I Bronsveld,3 H Veeze,4 M Ballmann2 1 Klinische Forschergruppe, Medizinische Hochschule Hannover, Hannover, Germany; 2 Abteilung fu¨r Pa¨diatrische Pneumologie und Neonatologie, Medizinische Hochschule Hannover, Hannover, Germany; 3 Department of Pulmonology and Tuberculosis, Universitair Medisch Centrum Utrecht, Utrecht, The Netherlands; 4 Stichting Diabeter, Rotterdam, The Netherlands Correspondence to: Dr B Tu¨mmler, Klinische Forschergruppe, OE 6710, Medizinische Hochschule Hannover, Carl-Neuberg-Str 1, D-30625 Hannover, Germany; tuemmler.burkhard@ mh-hannover.de Received 17 January 2008 Accepted 2 June 2008 ABSTRACT The molecular pathology of mutant F508del CFTR is partially corrected in vitro by the secondary amino acid substitution R553Q in the ABC signature motif. Login to comment
1 An individual with the CFTR genotype R553X/F508del-R553Q showed the typical symptoms and electrophysiological anomalies of cystic fibrosis in the airways and intestine. Login to comment
2 Sweat chloride concentrations were normal early in life, but were later raised into the range that is diagnostic for cystic fibrosis, suggesting that R553Q could temporarily correct the basic defect in sweat glands. Login to comment
3 R553Q caused a delay in diagnosis because of false negative sweat tests but was not a disease reverting suppressor mutation as had been inferred from cellular models. Login to comment
5 Here we report on the 30 year course of a basic defect and disease in an individual with cystic fibrosis (CF) who was compound heterozygous for the cystic fibrosis transmembrane conductance regulator (CFTR) mutations R553X1 and the complex allele F508del-R553Q.2 The amino acid substitution R553Q resides within the ABC signature motif of CFTR.3 R553Q has been shown in heterologous model systems to partially correct the defective processing and anomalous ion channel gating of mutant F508del CFTR.4 Hence R553Q has been classified as a disease reverting suppressor mutation. Login to comment
23 The clinical characteristics of the R553X/F508del-R553Q subject were similar to those of R553X/F508del compound heterozygotes.2 Moreover, even in the sweat gland, the basic defect was corrected only early in life, but faded over the years, indicating that aging mechanisms abolished the rescue by R553Q in the morphologically inconspicuous tissue. Login to comment
24 In summary, R553Q rescued the molecular pathology of F508del CFTR in a cellular model, but it was not a disease reverting suppressor mutation in the affected individual. Login to comment

[hide] Molecular dynamics analysis of the wild type and d... Biochimie. 2010 Jan;92(1):51-7. Epub 2009 Sep 23. Bisignano P, Moran O
Molecular dynamics analysis of the wild type and dF508 mutant structures of the human CFTR-nucleotide binding domain 1.
Biochimie. 2010 Jan;92(1):51-7. Epub 2009 Sep 23., [PMID:19781595]

Abstract [show]
Mutations of CFTR (Cystic Fibrosis transmembrane Conductance Regulator), a membrane protein expressed in the epithelium that forms a chloride channel, cause a chronic, developmental and hereditary disease, known as Cystic Fibrosis. The most common mutation is the deletion of F508, a residue present in the first nucleotide binding domain (NBD1). We studied the thermodynamic properties of NBD1 wild type (WT) and mutant (dF508), starting from the crystallographic structures in the Protein Data Bank using the techniques of Molecular Dynamics. The two structures were similarly stable at room temperature, showed no change enthalpy or entropy, maintaining the same dimensions and the same order of magnitude of atomic fluctuations; the only difference was the energy of interaction with the solvent, in which the mutant appears slightly disadvantaged; these differences between the two models are at microscopic level and relate to local variations (in residues at 8 A from F508) of the surface exposed to the solvent. We also found a decrease in the mutant of about 30 times of affinity for ATP compared to WT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Structures were obtained by X-ray crystallography, at a resolution of 2.55 Å and 2.30 Å for WT and mutant, respectively. These structures are both characterized by the presence of seven mutations: F409L, F429S, F433L, G550E, R553Q, R555K and H667R which make them more soluble and therefore more easily crystallizable [6,7]. Login to comment
152 The chosen PDB entries,1XMJ and 2BBO, contain seven mutations, F409L, F429S, F433L, G550E, R553Q, R555K and H667R, that were introduced to the NBD1, wild type and dF508 used for this study, to facilitate the crystallization of the polypeptide [6]. Login to comment

[hide] Structure and dynamics of NBD1 from CFTR character... J Mol Biol. 2010 Feb 19;396(2):406-30. Epub 2009 Nov 26. Lewis HA, Wang C, Zhao X, Hamuro Y, Conners K, Kearins MC, Lu F, Sauder JM, Molnar KS, Coales SJ, Maloney PC, Guggino WB, Wetmore DR, Weber PC, Hunt JF
Structure and dynamics of NBD1 from CFTR characterized using crystallography and hydrogen/deuterium exchange mass spectrometry.
J Mol Biol. 2010 Feb 19;396(2):406-30. Epub 2009 Nov 26., 2010-02-19 [PMID:19944699]

Abstract [show]
The DeltaF508 mutation in nucleotide-binding domain 1 (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR) is the predominant cause of cystic fibrosis. Previous biophysical studies on human F508 and DeltaF508 domains showed only local structural changes restricted to residues 509-511 and only minor differences in folding rate and stability. These results were remarkable because DeltaF508 was widely assumed to perturb domain folding based on the fact that it prevents trafficking of CFTR out of the endoplasmic reticulum. However, the previously reported crystal structures did not come from matched F508 and DeltaF508 constructs, and the DeltaF508 structure contained additional mutations that were required to obtain sufficient protein solubility. In this article, we present additional biophysical studies of NBD1 designed to address these ambiguities. Mass spectral measurements of backbone amide (1)H/(2)H exchange rates in matched F508 and DeltaF508 constructs reveal that DeltaF508 increases backbone dynamics at residues 509-511 and the adjacent protein segments but not elsewhere in NBD1. These measurements also confirm a high level of flexibility in the protein segments exhibiting variable conformations in the crystal structures. We additionally present crystal structures of a broader set of human NBD1 constructs, including one harboring the native F508 residue and others harboring the DeltaF508 mutation in the presence of fewer and different solubilizing mutations. The only consistent conformational difference is observed at residues 509-511. The side chain of residue V510 in this loop is mostly buried in all non-DeltaF508 structures but completely solvent exposed in all DeltaF508 structures. These results reinforce the importance of the perturbation DeltaF508 causes in the surface topography of NBD1 in a region likely to mediate contact with the transmembrane domains of CFTR. However, they also suggest that increased exposure of the 509-511 loop and increased dynamics in its vicinity could promote aggregation in vitro and aberrant intermolecular interactions that impede trafficking in vivo.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Comparing these hNBD1 structures to each other and to wild-type murine NBD1 (mNBD1) suggested that the overall fold of NBD1 was retained in the ΔF508 mutant and that structural changes were localized near the site of the deleted phenylalanine residue.5 However, three of these solubility-enhancing mutations (G550E/ R553Q/R555K) were known to be in vivo suppressors of the trafficking defect caused by the ΔF508 mutation.51-53 Compared to mNBD1, no significant structural perturbations were observed in the vicinity of these suppressor mutation sites in the crystal structures of hNBD1, suggesting that they act indirectly to suppress the effects of the ΔF508 mutation.5 Indeed, folding studies of a wider variety of hNBD1 variants, including several without trafficking-suppressor mutations, indicated that these mutations increase the thermodynamic stability of NBD1,5 which could account for improved folding and maturation in vivo. Login to comment
41 This structure was obtained from the same hNBD1-7a protein construct that yielded the previously reported ΔF508 structure, which has seven solubilizing mutations including the three trafficking-suppressor mutations G550E/R553Q/R555K. Login to comment
133 The structures harboring the G550E/R553Q/ R555K suppressor mutation set are shown in bright green (F508) and bright red (ΔF508). Login to comment
139 This region contains F508, the LSGGQ signature sequence (at residues 548-552), and the G550E/ R553Q/R555K suppressor mutation sites. Login to comment
300 The G550E/R553Q/ R555K mutation set has been demonstrated to suppress the defective trafficking of ΔF508-CFTR (Fig. 11).51-53 Based on detailed structural, dynamic, and thermodynamic considerations presented in section ST12 in the Supplementary Information, we conclude that these suppressor mutations are unlikely to directly reverse a cryptic structural Fig. 9. Login to comment
352 The trafficking-suppressor mutations (G550E/R553Q/R555K) overlap the LSGGQ signature sequence located at residues 548-552 in hNBD1. Login to comment

[hide] Structures of a minimal human CFTR first nucleotid... Protein Eng Des Sel. 2010 May;23(5):375-84. Epub 2010 Feb 11. Atwell S, Brouillette CG, Conners K, Emtage S, Gheyi T, Guggino WB, Hendle J, Hunt JF, Lewis HA, Lu F, Protasevich II, Rodgers LA, Romero R, Wasserman SR, Weber PC, Wetmore D, Zhang FF, Zhao X
Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant.
Protein Eng Des Sel. 2010 May;23(5):375-84. Epub 2010 Feb 11., [PMID:20150177]

Abstract [show]
Upon removal of the regulatory insert (RI), the first nucleotide binding domain (NBD1) of human cystic fibrosis transmembrane conductance regulator (CFTR) can be heterologously expressed and purified in a form that remains stable without solubilizing mutations, stabilizing agents or the regulatory extension (RE). This protein, NBD1 387-646(Delta405-436), crystallizes as a homodimer with a head-to-tail association equivalent to the active conformation observed for NBDs from symmetric ATP transporters. The 1.7-A resolution X-ray structure shows how ATP occupies the signature LSGGQ half-site in CFTR NBD1. The DeltaF508 version of this protein also crystallizes as a homodimer and differs from the wild-type structure only in the vicinity of the disease-causing F508 deletion. A slightly longer construct crystallizes as a monomer. Comparisons of the homodimer structure with this and previously published monomeric structures show that the main effect of ATP binding at the signature site is to order the residues immediately preceding the signature sequence, residues 542-547, in a conformation compatible with nucleotide binding. These residues likely interact with a transmembrane domain intracellular loop in the full-length CFTR channel. The experiments described here show that removing the RI from NBD1 converts it into a well-behaved protein amenable to biophysical studies yielding deeper insights into CFTR function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
226 The 389-678(F409L, F429S, F433L, G550E, R553Q, R555K, H667R) (hNBD1-7a) structures are shown without (dark blue) and with the DF508 mutation (light blue) (H. Lewis, in preparation). Login to comment

[hide] The cystic fibrosis-causing mutation deltaF508 aff... J Biol Chem. 2010 Nov 12;285(46):35825-35. Epub 2010 Jul 28. Thibodeau PH, Richardson JM 3rd, Wang W, Millen L, Watson J, Mendoza JL, Du K, Fischman S, Senderowitz H, Lukacs GL, Kirk K, Thomas PJ
The cystic fibrosis-causing mutation deltaF508 affects multiple steps in cystic fibrosis transmembrane conductance regulator biogenesis.
J Biol Chem. 2010 Nov 12;285(46):35825-35. Epub 2010 Jul 28., 2010-11-12 [PMID:20667826]

Abstract [show]
The deletion of phenylalanine 508 in the first nucleotide binding domain of the cystic fibrosis transmembrane conductance regulator is directly associated with >90% of cystic fibrosis cases. This mutant protein fails to traffic out of the endoplasmic reticulum and is subsequently degraded by the proteasome. The effects of this mutation may be partially reversed by the application of exogenous osmolytes, expression at low temperature, and the introduction of second site suppressor mutations. However, the specific steps of folding and assembly of full-length cystic fibrosis transmembrane conductance regulator (CFTR) directly altered by the disease-causing mutation are unclear. To elucidate the effects of the DeltaF508 mutation, on various steps in CFTR folding, a series of misfolding and suppressor mutations in the nucleotide binding and transmembrane domains were evaluated for effects on the folding and maturation of the protein. The results indicate that the isolated NBD1 responds to both the DeltaF508 mutation and intradomain suppressors of this mutation. In addition, identification of a novel second site suppressor of the defect within the second transmembrane domain suggests that DeltaF508 also effects interdomain interactions critical for later steps in the biosynthesis of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 A single mutation, R553Q, was first identified in a patient homozygous for the ⌬F508 allele but having only a mild CF phenotype (18). Login to comment
20 Subsequently, in a screen for suppressor mutations of the ⌬F508 defect, the original R553Q suppressor mutation was identified as were I539T, * Thisworkwassupported,inwholeorinpart,byNationalInstitutesofHealth NIDDK Grants 49835 (to P. J. T.) and 75302 (to G. L. L.). Login to comment
34 Printed in the U.S.A. NOVEMBER 12, 2010•VOLUME 285•NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 35825 G550E, R553Q, and R555K (19-21). Login to comment
104 The introduction of the single mutations, G550E, R553M or R553Q, and R555K, has previously been shown to partially rescue the ⌬F508 trafficking defect in CFTR and restore channel activity at the plasma membrane (Fig. 1A) (19-21). Login to comment

[hide] Thermal unfolding studies show the disease causing... Protein Sci. 2010 Oct;19(10):1917-31. Protasevich I, Yang Z, Wang C, Atwell S, Zhao X, Emtage S, Wetmore D, Hunt JF, Brouillette CG
Thermal unfolding studies show the disease causing F508del mutation in CFTR thermodynamically destabilizes nucleotide-binding domain 1.
Protein Sci. 2010 Oct;19(10):1917-31., [PMID:20687133]

Abstract [show]
Misfolding and degradation of CFTR is the cause of disease in patients with the most prevalent CFTR mutation, an in-frame deletion of phenylalanine (F508del), located in the first nucleotide-binding domain of human CFTR (hNBD1). Studies of (F508del)CFTR cellular folding suggest that both intra- and inter-domain folding is impaired. (F508del)CFTR is a temperature-sensitive mutant, that is, lowering growth temperature, improves both export, and plasma membrane residence times. Yet, paradoxically, F508del does not alter the fold of isolated hNBD1 nor did it seem to perturb its unfolding transition in previous isothermal chemical denaturation studies. We therefore studied the in vitro thermal unfolding of matched hNBD1 constructs +/-F508del to shed light on the defective folding mechanism and the basis for the thermal instability of (F508del)CFTR. Using primarily differential scanning calorimetry (DSC) and circular dichroism, we show for all hNBD1 pairs studied, that F508del lowers the unfolding transition temperature (T(m)) by 6-7 degrees C and that unfolding occurs via a kinetically-controlled, irreversible transition in isolated monomers. A thermal unfolding mechanism is derived from nonlinear least squares fitting of comprehensive DSC data sets. All data are consistent with a simple three-state thermal unfolding mechanism for hNBD1 +/- F508del: N(+/-MgATP) <==> I(T)(+/-MgATP) --> A(T) --> (A(T))(n). The equilibrium unfolding to intermediate, I(T), is followed by the rate-determining, irreversible formation of a partially folded, aggregation-prone, monomeric state, A(T), for which aggregation to (A(T))(n) and further unfolding occur with no detectable heat change. Fitted parameters indicate that F508del thermodynamically destabilizes the native state, N, and accelerates the formation of A(T).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 hNBD1 Nameb Termini / Mutationsc Tm d DTm ¼ Tm D508 - Tm wt ( C) PDB ID 1 hNBD1-D(RI,RE) 2935c46917 387-646[D405-436] 57.7 þ 0.2 2PZE 1 (F508del)hNBD1D (RI,RE) 2935c47217 387-646[D405-436, F508del] 51.5 þ 0.3 À6.2 þ 0.3 2PZF 2 387-646[D405-436, V510D] 60.2 þ 0.4 2 387-646[D405-436, V510D, F508del] 53.0 þ 0.1 À7.2 þ 0.4 3 387-646[D405-436, F494N, Q637R] 59.2 3 387-646[D405-436, F494N, Q637R, F508del] 52.8 À6.4 4 387-646[D405-436, G550E, R553Q, R555K] 61.7 4 387-646[D405-436, G550E, R553Q, R555K,F508del] 55.7 À6.0 5 387-678[D405-436] 58.1 5 387-678[D405-436, F508del] 51.7 À6.2 6 hNBDI-315 2935c38217 389-678[F429S, F494N, Q637R] 49.8 þ 0.3 6 hNBDI-3F508del15 2935c37117 389-678[F429S, F494N, Q637R, F508del] 43.6 þ 0.1 À6.3 þ 0.3 2BBS 7 389-678[F429S, F494N, L636E5, Q637R] 50.5 þ 0.2 7 389-678[F429S, F494N, L636E, Q637R, F508del] 44.9 À6.2 þ 0.2 a DSC conducted at 1 mg/mL protein. Login to comment

[hide] Integrated biophysical studies implicate partial u... Protein Sci. 2010 Oct;19(10):1932-47. Wang C, Protasevich I, Yang Z, Seehausen D, Skalak T, Zhao X, Atwell S, Spencer Emtage J, Wetmore DR, Brouillette CG, Hunt JF
Integrated biophysical studies implicate partial unfolding of NBD1 of CFTR in the molecular pathogenesis of F508del cystic fibrosis.
Protein Sci. 2010 Oct;19(10):1932-47., [PMID:20687163]

Abstract [show]
The lethal genetic disease cystic fibrosis is caused predominantly by in-frame deletion of phenylalanine 508 in the cystic fibrosis transmembrane conductance regulator (CFTR). F508 is located in the first nucleotide-binding domain (NBD1) of CFTR, which functions as an ATP-gated chloride channel on the cell surface. The F508del mutation blocks CFTR export to the surface due to aberrant retention in the endoplasmic reticulum. While it was assumed that F508del interferes with NBD1 folding, biophysical studies of purified NBD1 have given conflicting results concerning the mutation's influence on domain folding and stability. We have conducted isothermal (this paper) and thermal (accompanying paper) denaturation studies of human NBD1 using a variety of biophysical techniques, including simultaneous circular dichroism, intrinsic fluorescence, and static light-scattering measurements. These studies show that, in the absence of ATP, NBD1 unfolds via two sequential conformational transitions. The first, which is strongly influenced by F508del, involves partial unfolding and leads to aggregation accompanied by an increase in tryptophan fluorescence. The second, which is not significantly influenced by F508del, involves full unfolding of NBD1. Mg-ATP binding delays the first transition, thereby offsetting the effect of F508del on domain stability. Evidence suggests that the initial partial unfolding transition is partially responsible for the poor in vitro solubility of human NBD1. Second-site mutations that increase the solubility of isolated F508del-NBD1 in vitro and suppress the trafficking defect of intact F508del-CFTR in vivo also stabilize the protein against this transition, supporting the hypothesize that it is responsible for the pathological trafficking of F508del-CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Moreover, three second-site mutations, selected by Teem and coworkers to reverse the in vivo trafficking defect caused by F508del,37 appeared to stabilize hNBD1 against chemical unfolding.15 Because this ''Teem suppressor triplet`` (G550E, R553Q, and R555K) does not significantly alter the structure of F508del-hNBD1,18 its effect increasing the thermodynamic stability of hNBD1 seems likely to be responsible for reversing the deleterious effects of the F508del mutation. Login to comment
155 Second-Site Solubilizing/Suppressor Mutations Delay the Initial Unfolding Transition Figure 4 shows the isothermal denaturation behavior of F508del-hNBD1-D(RI,RE) constructs harboring additional point mutations known to suppress the trafficking defect caused by the F508del mutation.32,37,39,40 The G550E, R553Q, and R555K mutations in the Teem suppressor triplet were isolated in vivo using a selection for mutations restoring the export of a yeast CFTR homolog bearing the equivalent of the F508del mutation. Login to comment
179 This research program led to the identification of several point mutations that improve the solubility and yield of purified hNBD1, including the Teem suppressor triplet (G550E, R553Q, and R555K) isolated as suppressors of the in vivo trafficking defect of F508del-CFTR.37 However, surprisingly, the other efficacious solubilizing mutations chosen exclusively on the basis of polarity and consistency with the CFTR sequence profile also generally suppress the defective in vivo trafficking of F508del-CFTR.32,39 This correlation is readily explained if the initial unfolding transition in hNBD1 (left side of Fig. 5) controls both aggregation of the purified domain in vitro and aberrant ER retention and degradation of intact CFTR in vivo. Login to comment

[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]

Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Both in vivo and in vitro studies have also highlighted cases in which there is one main mutation with the phenotypical effect that is worsened by a second mutation, which may even be a neutral variant when isolated, as occurs for F508C,38 R74W,41 S912L,44 and M470V.42 However, different effects have also been described, as in the case of the two M470 and R1235 variants, which give rise to a hyperactive CFTR when present on different alleles but have a suppressive effect when combined on the same allele.42 In addition, the finding of complex alleles in CFTR-RD seems to suggest that a second CFTR mutation may even lead to a partial reversion of the phenotype.43 Indeed, in a reduced number of complex alleles, the effect of the second mutation may partially correct the functional defect, thereby lessening the phenotypical effect, as has been demonstrated for the R553Q mutation in the [F508del; R553Q] complex allele by in vivo52 and in vitro53 studies and for the R553M mutation in the [F508del; R553M] complex allele by an in vitro study.53 A milder phenotypical effect has also been demonstrated for the [R334W; R1158X]54 and [-102T; S549R(TϾG)]55 complex alleles if compared with alleles carrying, respectively, isolated R1158X or S549R(TϾG). Login to comment

[hide] Biochemical and biophysical approaches to probe CF... Methods Mol Biol. 2011;741:365-76. Schmidt A, Mendoza JL, Thomas PJ
Biochemical and biophysical approaches to probe CFTR structure.
Methods Mol Biol. 2011;741:365-76., [PMID:21594797]

Abstract [show]
The cystic fibrosis transmembrane regulator (CFTR) is a multi-domain integral membrane protein central to epithelial fluid secretion (see Chapter 21). Its activity is defective in the recessive genetic disease cystic fibrosis (CF). The most common CF-causing mutation is F508del in the first nucleotide binding domain (NBD1) of CFTR. This mutation is found on at least one allele of more than 90% of all CF patients. It is known to interfere with the trafficking/maturation of CFTR through the secretory pathway, leading to a loss-of-function at the plasma membrane. Notably, correction of the trafficking defect by addition of intragenic second-site suppressor mutations, or the alteration of bulk solvent conditions, such as by reducing the temperature or adding osmolytes, leads to appearance of functional channels at the membrane--thus, the rescued F508del-CFTR retains measurable function. High-resolution structural models of NBD1 from X-ray crystallographic data indicate that F508 is exposed on the surface of the domain in a position predicted by homologous ABC transporter structures to lie at the interface with the intracellular loops (ICLs) connecting the transmembrane spans. Determining the relative impact of the F508del mutation directly on NBD1 folding or on steps of domain assembly or both domain folding and assembly requires methods for evaluating the structure and stability of the isolated domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 A single mutation, R553Q, was first identified in a patient, homozygous for the F508del allele, but having only a mild CF phenotype (20, 21). Login to comment
30 Subsequently, in a screen for suppressor mutations of the F508del defect, the original R553Q suppressor mutation was identified as were I539T, G550E, R553Q, and R555K (18, 19). Login to comment

[hide] Cystic fibrosis-type mutational analysis in the AT... J Biol Chem. 1994 Aug 12;269(32):20575-83. Hoof T, Demmer A, Hadam MR, Riordan JR, Tummler B
Cystic fibrosis-type mutational analysis in the ATP-binding cassette transporter signature of human P-glycoprotein MDR1.
J Biol Chem. 1994 Aug 12;269(32):20575-83., 1994-08-12 [PMID:7914197]

Abstract [show]
Members of the ATP-binding cassette transporter superfamily such as the P-glycoproteins (MDR) and the cystic fibrosis transmembrane conductance regulator (CFTR) share conserved sequence motifs in their nucleotide binding fold that are the major targets for CFTR mutations in patients with cystic fibrosis. Cystic fibrosis-type mutations were introduced at analogous positions into the human MDR1 gene. Heterologous expression of wild-type or mutated MDR1 revealed similar mRNA transcript levels in Chinese hamster ovary K1 recipients, but the subsequent processing was defective for all mutations that give rise to severe cystic fibrosis in the case of CFTR. Functional multidrug transporter MDR1, however, was obtained when amino acid substitutions were introduced into a less conserved position of the ATP-binding cassette transporter signature (codon 536 in MDR1). The profile of cross-resistance and chemosensitization was modulated in these codon 536 variants, which suggests that this region is involved in the drug transport function of P-glycoprotein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 K536R Deglycosylated form(blot) + ND (+) ND ND & + Mature glycosylated membrane protein (blot) + ND * ND ND + + Membrane protein on cell surface (FACS) + - * (+) ND + + Multidrug resistance and collateral sensitivity + - - - - + + CFTRb Wild-tvpe AF508 S549RG551DAF508-R553Q R553Q Partially glycosylated form + + + + + + Mature fully glycosylatedmembrane protein + ND ND + (+) + Chloride current: SPQ assay + - - - + + Chloride current: electrophysiological recordings + -b. +d,e,f +e.f + + Transfectionin CHO cells (this work). Login to comment
25 Besides the major mutationAF508, a cluster of missense mutations resides in the linker peptide(Fig. 1).AF508, S549R (Keremet al., 1990; Sangiuloet al.,19911,and G551D (Cuttingetal., 1990;Hamosh et al., 1992)were identified in patients withtypical pulmonary andgastrointestinalmanifestations of CFdiseasewhereas R553Q has been foundon the complex allele AF508-R553Qin a Cystic Fibrosis GeneticAnalysis Consortium,personal communication. Login to comment
169 In the CFTR gene from a CF patient with uncommon clinical characteristics we had detected at this codon position the variant R553Q on the AF508 chromosome (Dorket al., 1991).The compound heterozygous patient with the complex AF508-R553Q allele displayed sweat chloride concentrations in the upper normal range, but had typical gastrointestinal andpulmonary features of CF.Hence, we hypothesized that the substitutionof arginine 553 by a glutamine in loop 3 may partly compensate for the omission of phenylalanine 508in loop 2 (Dorket al., 1991).A recent independent studyby Teem et al. (1993) provides strong experimental supportfor this hypothesis. Login to comment

[hide] Are p.I148T, p.R74W and p.D1270N cystic fibrosis c... BMC Med Genet. 2004 Aug 2;5:19. Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Porst F, Des Georges M
Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations?
BMC Med Genet. 2004 Aug 2;5:19., 2004-08-02 [PMID:15287992]

Abstract [show]
BACKGROUND: To contribute further to the classification of three CFTR amino acid changes (p.I148T, p.R74W and p.D1270N) either as CF or CBAVD-causing mutations or as neutral variations. METHODS: The CFTR genes from individuals who carried at least one of these changes were extensively scanned by a well established DGGE assay followed by direct sequencing and familial segregation analysis of mutations and polymorphisms. RESULTS: Four CF patients (out of 1238) originally identified as carrying the p.I148T mutation in trans with a CF mutation had a second mutation (c.3199del6 or a novel mutation c.3395insA) on the p.I148T allele. We demonstrate here that the deletion c.3199del6 can also be associated with CF without p.I148T. Three CBAVD patients originally identified with the complex allele p.R74W-p.D1270N were also carrying p.V201M on this allele, by contrast with non CF or asymptomatic individuals including the mother of a CF child, who were carrying p.R74W-p.D1270N alone. CONCLUSION: These findings question p.I148T or p.R74W-p.D1270N as causing by themselves CF or CBAVD and emphazises the necessity to perform a complete scanning of CFTR genes and to assign the parental alleles when novel missense mutations are identified.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Another exemple is the revertant mutation p.R553Q which, when carried on the same gene as p.F508del, is associated with a CF phenotype with normal chloride concentration in sweat test [6] and which, when expressed in heterologous cells, can partially correct the processing and Cl-channel gating defects caused by the p.F508del mutation [7]. Login to comment

[hide] A neutral variant involved in a complex CFTR allel... Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3. Clain J, Lehmann-Che J, Girodon E, Lipecka J, Edelman A, Goossens M, Fanen P
A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype.
Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3., [PMID:15744523]

Abstract [show]
In order to further elucidate the contribution of complex alleles to the wide phenotypic variability of cystic fibrosis (CF), we investigated the structure-function relationships of a severe CF-associated complex allele [p.S912L;p.G1244V]. To evaluate the contribution of each mutation to the phenotype, cystic fibrosis transmembrane conductance regulator (CFTR) mutants were expressed in HeLa cells and analysed for protein processing and Cl- channel activity. Both p.G1244V and [p.S912L;p.G1244V] mutants had normal protein processing but markedly decreased Cl- channel activity compared with wild-type. Notably, the double mutant displayed a dramatic decrease in Cl- channel activity compared with p.G1244V (P<0.001). p.S912L had normal protein processing and no detectable impact on CFTR function. In other respects, the p.S912L variation was identified in compound heterozygosity with p.R709X in a healthy fertile man. Together, these data strongly support the view that p.S912L in isolation should be considered as a neutral variant but one that might significantly impair CFTR function when inherited in cis with another CFTR mutation. Our data also further document the contribution of complex alleles to the wide phenotypic variability of CF. The results of functional studies of such complex alleles in other genetic diseases are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 The combination of two missense mutations on the same chromo some has been described clinically to lessen ([p.R553Q;p.F508del], [p.R334W;p.R1158X]; Dork et al. 1991; Duarte et al. 1996) or worsen ([p.R74W;p.D1270N], [p.R347H;p.D979A]; Casals et al. 1995; Hojo et al. 1998) the phenotype of CF patients with regard to the commonest mutation alone (p.F508del, p.R1158X, p.D1270N, p.R347H). Login to comment

[hide] Mutational analysis of the Saccharomyces cerevisia... Mol Microbiol. 1997 Aug;25(4):683-94. Wemmie JA, Moye-Rowley WS
Mutational analysis of the Saccharomyces cerevisiae ATP-binding cassette transporter protein Ycf1p.
Mol Microbiol. 1997 Aug;25(4):683-94., [PMID:9379898]

Abstract [show]
Ycf1p is a member of the ATP-binding cassette transporter family of membrane proteins. Strong sequence similarity has been observed between Ycf1p, the cystic fibrosis transmembrane conductance regulator (CFTR) and multidrug resistance protein (MRP). In this work, we have examined the functional significance of several of the conserved amino acid residues and the genetic requirements for Ycf1p subcellular localization. Biochemical fractionation experiments have established that Ycf1p, expressed at single-copy gene levels, co-fractionates with the vacuolar membrane and that this co-fractionation is independent of vps15, vps34 or end3 gene function. Several cystic fibrosis-associated alleles of the CFTR were introduced into Ycf1p and found to elicit defects analogous to those seen in the CFTR. An amino-terminal extension shared between Ycf1p and MRP, but absent from CFTR, was found to be required for Ycf1p function, but not its subcellular localization. Mutant forms of Ycf1p were also identified that exhibited enhanced biological function relative to the wild-type protein. These studies indicate that Ycf1p will provide a simple, genetically tractable model system for the study of the trafficking and function of ATP-binding cassette transporter proteins, such as the CFTR and MRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 These mutants corresponded to CFTR alterations known to be associated with cystic fibrosis (G551D and G551S in CFTR, G756D and G756S in Ycf1p) as well as lesions that either disturb normal function (K464M in CFTR, K669M in Ycf1p) or act to suppress the phenotype of ⌬F508 CFTR (R553Q and R553M in CFTR, K758Q and K758M in CFTR). Login to comment
161 The two ⌬F508 suppressor mutations isolated in this study were R553Q and R553M. Login to comment
193 (Paddon et al., 1996) has shown that the R553Q and R553M mutations do not act by correcting a mislocalization defect in the Ste6p-⌬F508 CFTR chimera. Login to comment

[hide] Correction of both NBD1 energetics and domain inte... Cell. 2012 Jan 20;148(1-2):150-63. Rabeh WM, Bossard F, Xu H, Okiyoneda T, Bagdany M, Mulvihill CM, Du K, di Bernardo S, Liu Y, Konermann L, Roldan A, Lukacs GL
Correction of both NBD1 energetics and domain interface is required to restore DeltaF508 CFTR folding and function.
Cell. 2012 Jan 20;148(1-2):150-63., [PMID:22265408]

Abstract [show]
The folding and misfolding mechanism of multidomain proteins remains poorly understood. Although thermodynamic instability of the first nucleotide-binding domain (NBD1) of DeltaF508 CFTR (cystic fibrosis transmembrane conductance regulator) partly accounts for the mutant channel degradation in the endoplasmic reticulum and is considered as a drug target in cystic fibrosis, the link between NBD1 and CFTR misfolding remains unclear. Here, we show that DeltaF508 destabilizes NBD1 both thermodynamically and kinetically, but correction of either defect alone is insufficient to restore DeltaF508 CFTR biogenesis. Instead, both DeltaF508-NBD1 energetic and the NBD1-MSD2 (membrane-spanning domain 2) interface stabilization are required for wild-type-like folding, processing, and transport function, suggesting a synergistic role of NBD1 energetics and topology in CFTR-coupled domain assembly. Identification of distinct structural deficiencies may explain the limited success of DeltaF508 CFTR corrector molecules and suggests structure-based combination corrector therapies. These results may serve as a framework for understanding the mechanism of interface mutation in multidomain membrane proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Both the R mutations (G550E, R553Q, and R555K) and S mutations (F409L, F429S, F433L, F494N, and H667R) could partially rescue the DF508 CFTR folding and functional defect (Lewis et al., 2005; Pissarra et al., 2008; Teem et al., 1993, 1996) and were assumed to stabilize the domain either alone or in combinations (1S, 3S, R, R1S, and R4S; see Figure 1B). Login to comment

[hide] Molecular basis for the ATPase activity of CFTR. Arch Biochem Biophys. 2008 Aug 1;476(1):95-100. Epub 2008 Apr 8. Cheung JC, Kim Chiaw P, Pasyk S, Bear CE
Molecular basis for the ATPase activity of CFTR.
Arch Biochem Biophys. 2008 Aug 1;476(1):95-100. Epub 2008 Apr 8., [PMID:18417076]

Abstract [show]
CFTR is a member of the ABC (ATP binding cassette) superfamily of transporters. It is a multidomain membrane protein, which utilizes ATP to regulate the flux of its substrate through the membrane. CFTR is distinct in that it functions as a channel and it possesses a unique regulatory R domain. There has been significant progress in understanding the molecular basis for CFTR activity as an ATPase. The dimeric complex of NBD structures seen in prokaryotic ABC transporters, together with the structure of an isolated CF-NBD1, provide a unifying molecular template to model the structural basis for the ATPase activity of CFTR. The dynamic nature of the interaction between the NBDs and the R domain has been revealed in NMR studies. On the other hand, understanding the mechanisms mediating the transmission of information from the cytosolic domains to the membrane and the channel gate of CFTR remains a central challenge.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 The construct generated had several mutations to increase solubility of the domain (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of F508. Login to comment

[hide] Solubilizing mutations used to crystallize one CFT... Chem Biol. 2008 Jan;15(1):62-9. Pissarra LS, Farinha CM, Xu Z, Schmidt A, Thibodeau PH, Cai Z, Thomas PJ, Sheppard DN, Amaral MD
Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation.
Chem Biol. 2008 Jan;15(1):62-9., [PMID:18215773]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) Cl(-) channel. F508del, the most frequent CF-causing mutation, disrupts both the processing and function of CFTR. Recently, the crystal structure of the first nucleotide-binding domain of CFTR bearing F508del (F508del-NBD1) was elucidated. Although F508del-NBD1 shows only minor conformational changes relative to that of wild-type NBD1, additional mutations (F494N/Q637R or F429S/F494N/Q637R) were required for domain solubility and crystallization. Here we show that these solubilizing mutations in cis with F508del partially rescue the trafficking defect of full-length F508del-CFTR and attenuate its gating defect. We interpret these data to suggest that the solubilizing mutations utilized to facilitate F508del-NBD1 production also assist folding of full-length F508del-CFTR protein. Thus, the available crystal structure of F508del-NBD1 might correspond to a partially corrected conformation of this domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 Some of these mutations represented sequence changes between human CFTR and CFTRs from other species, whereas others (G550E, R553Q, and R555K) had been previously identified as F508del-CFTR revertant mutations (Teem et al., 1996; deCarvalho et al., 2002; Chang et al., 1999). Login to comment
25 Of note, one of these revertants, R553Q, was found in an F508del-homozygous patient with mild CF disease (Do¨ rk et al., 1991). Login to comment

[hide] Defining the defect in F508 del CFTR: a soluble pr... Chem Biol. 2008 Jan;15(1):3-4. Deber CM, Cheung JC, Rath A
Defining the defect in F508 del CFTR: a soluble problem?
Chem Biol. 2008 Jan;15(1):3-4., [PMID:18215767]

Abstract [show]
Previously reported crystal structures of CFTR F508 del-NBD1 were determined in the presence of solubilizing mutations. In this issue of Chemistry & Biology, Pissarra et al. (2008) show that partial rescue of the trafficking and gating defects of full-length CFTR occurs in vivo upon recapitulation of the solubilizing F494N/Q637R or F428S/F494N/Q637R substitutions in cis with F508 del.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 The first human F508 del-NBD1 structure obtained carried seven additional mutations, three of which (suppressor mutations G550E, R553Q, and R555K) were known to rescue the F508 del-CFTR defect (Chang et al., 1999; DeCarvalho et al., 2002; Teem et al., 1996). Login to comment

[hide] Atypical CF and CF related diseases. Paediatr Respir Rev. 2006;7 Suppl 1:S144-6. Epub 2006 Jun 5. Kerem E
Atypical CF and CF related diseases.
Paediatr Respir Rev. 2006;7 Suppl 1:S144-6. Epub 2006 Jun 5., [PMID:16798544]

Abstract [show]
The clinical characteristics of atypical CF are: symptoms that may start in infancy but the disease become clinically significant only after 10 years of age, survival into adulthood, chronic sinopulmonary disease, pancreatic sufficiency, and sweat chloride <60 meq/L. Other patients may present with single organ involvement such as CBAVD, biliary cirrhosis and portal hypertension, chronic or recurrent pancreatitis, giant nasal polyposis or hypochloremic alkalosis. It is recommended to refer such patients for CFTR genotyping, however, absence of known common mutation does not rule out CFTR associated disease, since mutations causing atypical CF are rare and whole genome scan is required for their identification. Nasal PD measurements may be helpful to establish the diagnosis of these patients; however, measurements might be also atypical. Several explanations have been suggested to explain the atypical CF disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 One such mutation is the R553Q which when being present together with DF508 mutation on the same CFTR allele, is believed to have an attenuating effect on the clinical presentation of CF.9 Likewise, the 5T allele was shown to affect the disease severity of patients carrying the mutation R117H.10 In patients carrying the R117H mutation when the allele also contained the 5T variant the phenotype was mild CF whereas in patients carrying R117H together with the 7T variant the phenotype was CBAVD only. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Cystic fibrosis: a multiple exocrinopathy caused b... Am J Med. 1998 Jun;104(6):576-90. Schwiebert EM, Benos DJ, Fuller CM
Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein.
Am J Med. 1998 Jun;104(6):576-90., [PMID:9674722]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
223 They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X). Login to comment

[hide] Genetic findings in congenital bilateral aplasia o... Hum Mutat. 1998;11(6):480. de Meeus A, Guittard C, Desgeorges M, Carles S, Demaille J, Claustres M
Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online.
Hum Mutat. 1998;11(6):480., [PMID:10200050]

Abstract [show]
Congential bilateral aplasia of vas deferens (CBAVD), a form of male sterility, has been suggested to represent a "genital" form of cystic fibrosis (CF), as mutations in the CFTR gene have been identified in most patients with this condition. Interestingly, the 5T allele in intron 8 appeared to be the most frequent mutation associated with CBAVD. However, the molecular basis of CBAVD is not completely understood. We have analysed the complete coding and flanking CFTR sequences by PCR-DGGE in 64 men with CBAVD from southern France with the aim to list any sequence alteration. Fourty-two of the 64 patients (65.6%) had mutations on both copies of the CFTR gene, including one patient with two mutations in the same copy (DF508 + A1067T). The 5T allele was present in 21/64 cases (33%). Six of the 28 different mutations identified in this study had never been described previously, and appeared to be specific to CBAVD (P111L, M244K, A1364V, G544V, 2896insAG,-33G->A).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 The variability of the phenotypic expression could also be explained in some cases by the presence of an additional mutation in the CFTR gene, as it has been reported for the double mutant DF508-R553Q in which the R553Q mutation compensates the deleterious effect of the DF508 deletion (Dork et al. 1991). Login to comment

[hide] Modeling of nucleotide binding domains of ABC tran... J Bioenerg Biomembr. 1997 Oct;29(5):503-24. Bianchet MA, Ko YH, Amzel LM, Pedersen PL
Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR).
J Bioenerg Biomembr. 1997 Oct;29(5):503-24., [PMID:9511935]

Abstract [show]
Members of the ABC transporter superfamily contain two nucleotide binding domains. To date, the three dimensional structure of no member of this super-family has been elucidated. To gain structural insight, the known structures of several other nucleotides binding proteins can be used as a framework for modeling these domains. We have modeled both nucleotide binding domains of the protein CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) using the two similar domains of mitochondrial F1-ATPase. The models obtained, provide useful insights into the putative functions of these domains and their possible interaction as well as a rationale for the basis of Cystic Fibrosis causing mutations. First, the two nucleotide binding domains (folds) of CFTR are each predicted to span a 240-250 amino acid sequence rather than the 150-160 amino acid sequence originally proposed. Second, the first nucleotide binding fold, is predicted to catalyze significant rates of ATP hydrolysis as a catalytic base (E504) resides near the y phosphate of ATP. This prediction has been verified experimentally [Ko, Y.H., and Pedersen, P.L. (1995) J. Biol. Chem. 268, 24330-24338], providing support for the model. In contrast, the second nucleotide binding fold is predicted at best to be a weak ATPase as the glutamic acid residue is replaced with a glutamine. Third, F508, which when deleted causes approximately 70% of all cases of cystic fibrosis, is predicted to lie in a cleft near the nucleotide binding pocket. All other disease causing mutations within the two nucleotide binding domains of CFTR either reside near the Walker A and Walker B consensus motifs in the heart of the nucleotide binding pocket, or in the C motif which lies outside but near the nucleotide binding pocket. Finally, the two nucleotide binding domains of CFTR are predicted to interact, and in one of the two predicted orientations, F508 resides near the interface. This is the first report where both nucleotide binding domains of an ABC transporter and their putative domain-domain interactions have been modeled in three dimensions. The methods and the template used in this work can be used to analyze the structures and function of the nucleotide binding domains of all other members of the ABC transporter super-family.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
360 The CFTR NBD1 model that results (Fig. 6) gathers the disease causing mutations in three different clusters: (1) mutations affecting the nucleotide binding pocket and the putative general base: A455E, G458V, E504Q AI507 AF508 P574H; (2) mutations in motif C which are probably related to an interaction with region D: S549[R,N,I] G551[S,D], R553Q; and (3) mutations within or near motif B, L558S, A559T, R560T, Y563N and mutations S492F and G480C. Login to comment

[hide] Cystic fibrosis: channel, catalytic, and folding p... J Bioenerg Biomembr. 1997 Oct;29(5):429-42. Seibert FS, Loo TW, Clarke DM, Riordan JR
Cystic fibrosis: channel, catalytic, and folding properties of the CFTR protein.
J Bioenerg Biomembr. 1997 Oct;29(5):429-42., [PMID:9511928]

Abstract [show]
The identification and characterization of the CFTR gene and protein have provided not only a major impetus to the dissection of the molecular pathophysiology of cystic fibrosis (CF) but also a new perspective on the structure and function of the large superfamily of membrane transport proteins to which it belongs. While the mechanism of the active vectorial translocation of many hydrophobic substrates by several of these transporters remains nearly as perplexing as it has for several decades, considerable insight has been gained into the control of the bidirectional permeation of chloride ions through a single CFTR channel by the phosphorylation of the R-domain and ATP interactions at the two nucleotide binding domains. However, details of these catalytic and allosteric mechanisms remain to be elucidated and await the replacement of two-dimensional conceptualizations with three dimensional structure information. Secondary and tertiary structure determination is required both for the understanding of the mechanism of action of the molecule and to enable a more complete appreciation of the misfolding and misprocessing of mutant CFTR molecules. This is the primary cause of the disease in the majority of the patients and hence understanding the details of the cotranslational interactions with multiple molecular chaperones, the ubiquitin-proteasome pathway and other components of the quality control machinery at the endoplasmic reticulum could provide a basis for the development of new therapeutic interventions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
178 (1993) were able to identify two mutations, NBF1-located R553M and R553Q, which when introduced into AF508-CFTR partially restored the function of these chimeras. Login to comment
180 Interestingly,in one patient a combination of the AF508 and the R553Q mutations was found on the same chromosome and this patient showed a mixed phenotype of severe lung and pancreatic disease, but normal sweat chloride (Dork etal, 1991). Login to comment

[hide] Localization and suppression of a kinetic defect i... J Biol Chem. 1997 Jun 20;272(25):15739-44. Qu BH, Strickland EH, Thomas PJ
Localization and suppression of a kinetic defect in cystic fibrosis transmembrane conductance regulator folding.
J Biol Chem. 1997 Jun 20;272(25):15739-44., [PMID:9188468]

Abstract [show]
A growing body of evidence indicates that the most common cystic fibrosis-causing mutation, DeltaF508, alters the ability of the cystic fibrosis transmembrane conductance regulator (CFTR) protein to fold and transit to the plasma membrane. Here we present evidence that the DeltaF508 mutation affects a step on the folding pathway prior to formation of the ATP binding site in the nucleotide binding domain (NBD). Notably, stabilization of the native state with 4 mM ATP does not alter the temperature-dependent folding yield of the mutant DeltaF508 NBD1 in vitro. In contrast, glycerol, which promotes DeltaF508-CFTR maturation in vivo, increases the folding yield of NBD1DeltaF and reduces the off pathway rate in vitro, although it does not significantly alter the free energy of stability. Likewise a second site mutation, R553M, which corrects the maturation defect in vivo, is a superfolder which counters the effects of DeltaF508 on the temperature-dependent folding yield in vitro, but does not significantly alter the free energy of stability. A disease-causing mutation, G551D, which does not alter the maturation of CFTR in vivo but rather its function as a chloride channel, and the S549R maturation mutation have no discernible effect on the folding of the domain. These results demonstrate that DeltaF508 is a kinetic folding mutation that affects a step early in the process, and that there is a significant energy barrier between the native state and the step affected by the mutation precluding the use of native state ligands to promote folding. The implications for protein folding in general are that the primary sequence may not necessarily simply define the most stable native structure, but rather a stable structure that is kinetically accessible.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 In a German pancreas-insufficient patient homozygous for ⌬F508 with typical gastrointestinal and pulmonary disease but sweat chloride in the normal range a second site mutation of R553Q was found on one ⌬F508-CFTR allele (15). Login to comment
17 Two mutations at this position, R553M and R553Q, revert the mating phenotype of a ⌬F508 STE6-CFTR chimera in yeast (16). Login to comment

[hide] Rapid characterization of the variable length poly... Hum Mutat. 1997;10(2):108-15. Friedman KJ, Heim RA, Knowles MR, Silverman LM
Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease.
Hum Mutat. 1997;10(2):108-15., [PMID:9259194]

Abstract [show]
The CFTR intron 8 variable length polythymidine tract modulates the cystic fibrosis (CF) phenotype associated with the mutation R117H. To explore whether other mutations reside on multiple intron 8 backgrounds with discernible impacts on phenotype, we developed an allele-specific PCR assay to characterize this locus. Our approach types samples rapidly without the use or radioisotopes. Polythymidine alleles were identified for mutations either associated with a wide range of clinical phenotypes (R117H, R347P, G85E, D1152H, R334W, 2789 + 5 G > A, 3849 + 10kb C > T), and/or located at hypermutable CpG loci (R117H, 3845 + 10kb C > T, R553X, R334W, S945L and R75Q). R117H was detected in cis with each of three alleles (5T, 7T, 9T) at the intron 8 locus. The novel R117H-9T association was detected in a 10-month African-American male with borderline-to-mildly elevated sweat chloride values (approximately 50-66 mEq/L). All other mutations studied were associated with 7T except 3849 + 10kb C > T, which was detected on both 7T and 9T backgrounds, but not 5T. Three individuals with a delta F508/3849 + 10kb C > T genotype were 9T,9T and had pancreatic sufficiency and normal sweat chloride values, whereas 15 others who carried 3849 + 10kb C > T on a 7T background had variable pancreatic function (sufficient, n = 12, insufficient, n = 3), and variable sweat chloride values (normal, n = 12, elevated, n = 3). Surprisingly, when not associated with known CFTR mutations, 5T was detected with elevated frequency among individuals with sinopulmonary disease of ill-defined etiology, but with some characteristics of variant CF. In summary, the 5T allele was not found in cis with CF-causing mutations besides R117H, but an elevated 5T allele frequency in variant CF patients suggests 5T may be associated with disease in some situations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 In the context of CF, the R553Q sequence variant in exon 11 has been demonstrated in vitro partially to ameliorate the phenotype of a ∆F508 homozygote (Teem et al., 1993). Login to comment

[hide] Analysis of the localization of STE6/CFTR chimeras... Mol Microbiol. 1996 Mar;19(5):1007-17. Paddon C, Loayza D, Vangelista L, Solari R, Michaelis S
Analysis of the localization of STE6/CFTR chimeras in a Saccharomyces cerevisiae model for the cystic fibrosis defect CFTR delta F508.
Mol Microbiol. 1996 Mar;19(5):1007-17., [PMID:8830258]

Abstract [show]
The use of yeast as a model system to study mammalian proteins is attractive, because yeast genetic tools can be utilized if a suitable phenotype is created. STE6, the Saccharomyces cerevisiae a-factor mating pheromone transporter, and CFTR, the mammalian cystic fibrosis transmembrane conductance regulator, are both members of the ATP binding cassette (ABC) superfamily. Teem et al. (1993) described a yeast model for studying a mutant form of the cystic fibrosis protein, CFTR delta F508. The model involved expression of a chimeric molecule in which a portion of yeast STE6 was replaced with the corresponding region from mammalian CFTR. The STE6/CFTR chimera complemented a ste6 mutant strain for mating, indicating that it could export a-factor. However, mating efficiency was dramatically reduced upon introduction of delta F508, providing a yeast phenotype for this mutation. In human cells, the delta F508 mutation results in retention of CFTR in the endoplasmic reticulum (ER), and possibly in reduction of its chloride-channel activity. Here we examine the basis for the differences in STE6 activity promoted by the wild-type and mutant STE6/CFTR chimeras. By analysis of protein stability and subcellular localization, we find that the mutant chimera is not ER-retained in yeast. We conclude that the molecular basis for the reduced mating of the STE6/CFTR delta F508 chimera must reflect a reduction in its capacity to transport a-factor, rather than mistrafficking. Thus, STE6/CFTR delta F508 in yeast appears to be a good genetic model to probe certain aspects of protein function, but not to study protein localization.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
166 These revertant mutations (R553 M and R553Q) lie in the CFTR-portion of NBD1 in the chimeric molecule. Login to comment
183 Teem et al. (1993) speculated that loss of F508 may alter the structure of NBD1 in a manner that is partially compensated for by the R553Q or R553 M suppressor mutations which they isolated. Login to comment

[hide] Complex cystic fibrosis allele R334W-R1158X result... Hum Mutat. 1996;8(2):134-9. Duarte A, Amaral M, Barreto C, Pacheco P, Lavinha J
Complex cystic fibrosis allele R334W-R1158X results in reduced levels of correctly processed mRNA in a pancreatic sufficient patient.
Hum Mutat. 1996;8(2):134-9., [PMID:8844211]

Abstract [show]
CFTR alleles containing two mutations have been very rarely found in cystic fibrosis (CF) patients. They provide an opportunity to study the effect of two in cis-interacting gene defects on gene expression. Here, we describe a three-generation CF family with a complex CFTR allele that has not been previously described, containing the missense mutation R334W in exon 7 and the nonsense mutation R1158X in exon 19. Lymphocyte RNA analysis showed that (1) the mRNA corresponding to the complex allele is present although at markedly reduced levels; and (2) the nonsense mutation does not lead to detectable skipping of exon 19. The clinical picture of the patients with the genotype R334W-R1158X/delta F508 is characterized by pancreatic sufficiency and an atypical course of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 The first published complex allele in the CFTR gene (Dork et al., 1991) consisted of an alteration (R553Q) that partially reverted the phenotypic effects of the AF508 mutation (Teem et al., 1993).The sameseems to apply to the AF508- V1212I allele (Macek et al., 1993). Login to comment

[hide] Double mutant alleles: are they rare? Hum Mol Genet. 1995 Jul;4(7):1169-71. Savov A, Angelicheva D, Balassopoulou A, Jordanova A, Noussia-Arvanitakis S, Kalaydjieva L
Double mutant alleles: are they rare?
Hum Mol Genet. 1995 Jul;4(7):1169-71., [PMID:8528204]

Abstract [show]
The presence of two different mutations carried by the same CF allele has been demonstrated in four out of 44 Bulgarian CF patients during a systematic search of the entire coding sequence of the CFTR gene. Two of the double mutant alleles include one nonsense and one missense mutation and although the nonsense mutation can be considered to be the main defect, the amino acid substitutions are good candidates for disease-causing mutations as well. One double mutant carries two missense mutations whose contribution to the CF phenotype is difficult to evaluate. The findings suggest that double mutant alleles may be more common than expected and could account for some of the problems in phenotype-genotype correlations. Such alleles may have important implications for molecular diagnosis and genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 An additional nucleotide substitution, R553Q, has been shown to result in lower sweat electrolyte values in a patient homozygous for AF5O8 (4) and a combination of a neutral amino acid polymorphism (F508C) with another missense mutation (SI25IN) has been found to result in cystic fibrosis (5). Login to comment

[hide] Is congenital bilateral absence of vas deferens a ... Am J Hum Genet. 1995 Jan;56(1):272-7. Mercier B, Verlingue C, Lissens W, Silber SJ, Novelli G, Bonduelle M, Audrezet MP, Ferec C
Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients.
Am J Hum Genet. 1995 Jan;56(1):272-7., [PMID:7529962]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is an important cause of sterility in men. Although the genetic basis of this condition is still unclear, it has been shown recently that some of these patients carry mutations in their cystic fibrosis transmembrane conductance regulator (CFTR) genes. To extend this observation, we have analyzed the entire coding sequence of the CFTR gene in a cohort of 67 men with CBAVD, who are otherwise healthy. We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). We have shown that 42% of subjects were carriers of one CFTR allele and that 24% are compound heterozygous for CFTR alleles. Thus, we have been unable to identify 76% of these patients as carrying two CFTR mutations. Furthermore, we have described the segregation of CFTR haplotypes in the family of one CBAVD male; in this family are two male siblings, with identical CFTR loci but displaying different phenotypes, one of them being fertile and the other sterile. The data presented in this family, indicating a discordance between the CBAVD phenotype and a marked carrier (delta F508) chromosome, support the involvement of another gene(s), in the etiology of CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 Dork and coworkers (1991) identified an individual bearing both the AF508 and R553Q mutations on the same allele. Login to comment

[hide] Cystic fibrosis: genotypic and phenotypic variatio... Annu Rev Genet. 1995;29:777-807. Zielenski J, Tsui LC
Cystic fibrosis: genotypic and phenotypic variations.
Annu Rev Genet. 1995;29:777-807., [PMID:8825494]

Abstract [show]
Cystic fibrosis (CF) is a common genetic disorder in the Caucasian population. The gene was identified in 1989 on the basis of its map location on chromosome 7. The encoded gene product, named cystic fibrosis transmembrane conductance regulator (CFTR), corresponds to a cAMP-regulated chloride channel found almost exclusively in the secretory epithelial cells. Although the major mutation that results in a single amino acid deletion (F508) accounts for 70% of the disease alleles, more than 550 additional mutant alleles of different forms have been detected. Many of these mutations can be divided into five general classes in terms of their demonstrated or presumed molecular consequences. In addition, a good correlation has been found between CFTR genotype and one of the clinical variables--pancreatic function status. An unexpected finding, however, is the documentation of CFTR mutations in patients with atypical CF disease presentations, including congenital absence of vas deferens and several pulmonary diseases. Thus, the implication of CFTR mutation is more profound than CF alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
586 The fIrst example is R553Q, which is found on an allele carrying . Login to comment
593 Not surprisingly, Rl17H is associated with CF only when the allele also contains Table 2 Examples of complex alleles in the CfTR gene Principal Second site mutationa Location alteration Location Reference R75X exon 3 125G --.. C promoter 57 405 + IG --.. A intron 3 3030G --.. A exon 15 57 R1l7H exon 4 129G --.. C promoter 203 RI17H exon 4 IVS8 : 5T or 7T intron 8 101 R297Q exon 7 IVS8 : 5T or 7T intron 8 60 aF508 exon 10 R553Q exon II 59 aF508 exon 10 1I027T exon I7a 57 8F508 exon 10 deletion of D7S8 500 kb 3' of 186 CfTR S549N exon II R75Q exon 3 205a L619S exon 13 1716G � A exon 10 57 G628R (G � C) exon 13 SI235R exon 19 47 2184insA exon 13 IVS:5T exon 9 J Zielenski, J Bal, 0 Markiewicz, L-C Tsui, unpublished data A800G exon 13 IVS8 : 5T or 7T intran 8 31 S912L exon 15 GI244V exon 20 149 GlO69R exon 17b L88X exon 3 149 3732deiA exon 19 Kl200E exon 19 70 3849 + IOkbC � intron 19 R668C exon 13 57 T SI251N exon 20 F508C exon 10 94 The status of principal mutation may not be clear in every case; e.g. G628R(G --> C) vs S1235R. Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 )-.T R347L Audrezet et al. 1993 G--S-C R347P Dean et al. 1990 1789 ......... C--.G R553G C. Ferec, personal communication CI-T R553X Cutting et al. 1990 1790 ......... G---A R553Q Dork et al.1991a 3328 ......... C-OT R1066C Fanen et al. 1992 3329 ......... G-.A R1066H Ferec et al. 1992 GT R1066L Mercier et al. 1993 3340 ......... CT R1070W M. Macek, Jr., unpublished data 3341 ......... G-A R1070Q Mercier et al. 1993 a This change is a polymorphism, not a disease mutation. Login to comment

[hide] Detection of more than 50 different CFTR mutations... Hum Genet. 1994 Nov;94(5):533-42. Dork T, Mekus F, Schmidt K, Bosshammer J, Fislage R, Heuer T, Dziadek V, Neumann T, Kalin N, Wulbrand U, et al.
Detection of more than 50 different CFTR mutations in a large group of German cystic fibrosis patients.
Hum Genet. 1994 Nov;94(5):533-42., [PMID:7525450]

Abstract [show]
We have conducted a comprehensive study of the molecular basis of cystic fibrosis (CF) in 350 German CF patients. A screening approach based on single-strand conformation analysis and direct sequencing of genomic polymerase chain reaction products has allowed us to detect the molecular defects on 95.4% of the CF chromosomes within the coding region and splice sites of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The spectrum of sequence changes comprises 54 different mutations, including 17 missense mutations, 14 nonsense mutations, 11 frameshift mutations, 10 splice site variants and two amino acid deletions. Eleven of these mutations have not previously been described. Our results reflect the marked mutational heterogeneity of CF in a large sample of patients from a non-isolated population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 There are, however, only six additional CFTR mutations with a frequency of approximately 1% or more of the CF chromosomes; two nonsense mutations, G542X and R553X, and the missense mutations G551D and NI303K were predominantly seen in severely affected patients, whereas the transmembrane missense mutation R347P and the splice mutation 3849 + 10 kB C---~T Table 2 Rare sequence variants in the CFTR promoter and coding region Sequence variant Nucleotide change Location Frequency Associated mutatiow' Reference 125 G--+C G--~C at 125 Promoter 1 (0.1%) R75X F508C T--~G at 1655 Exon 10 2 (0.3%) S1251N 1716 G---)A G---~Aat 1716 Exon 10 1 (0.1%) L619S R553Q G-~A at 1790 Exon I 1 I (0.1%) * R668C C--~T at 2134 Exon 13 1 (0.1%) 3849+10 kB C--eT 3030 G---~A G--+A at 3030 Exon 15 1 (0.1%) 405+1 G--~A I1027 T T--~C at 3212 Exon 17a 2 (0.3%) * 3417 A-+T A--->Tat 3417 Exon 17b 1 (0.1%) Unknown 4002 A--eG A--~G at 4002 Exon 20 2 (0.3%) Unknown Cutting et al. (1992) Kobayashi et al. (1990) Kerem et al. (1990) D6rk et al. ( 1991) Fanen et al. (1992) Chillon et al. (1992) Fanen et al. (1992) This study Ferec et al. (1992) ~'Marked (*) sequence variations were present on AF508 chromosomes were the most frequent in pancreas-sufficient patients. Login to comment

[hide] Association of pancreatic adenocarcinoma, mild lun... Clin Chem. 1994 Oct;40(10):1972-4. Tsongalis GJ, Faber G, Dalldorf FG, Friedman KJ, Silverman LM, Yankaskas JR
Association of pancreatic adenocarcinoma, mild lung disease, and delta F508 mutation in a cystic fibrosis patient.
Clin Chem. 1994 Oct;40(10):1972-4., [PMID:7522998]

Abstract [show]
A case of adenocarcinoma of the pancreas and mild lung disease in a 39-year-old man homozygous for the delta F508 cystic fibrosis mutation is presented. Cystic fibrosis is the most common lethal genetic disease in Caucasians, and is most commonly associated with severe obstructive lung disease. To our knowledge, this is only the fifth case of adenocarcinoma of the pancreas in a CF patient to be reported and the first case for which molecular data are available. The rare incidence of this type of malignancy in the general population suggests a possible association of CF with this malignant disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Furthermore, evidence indicates that a sequence variation in exon 11, R553Q, can serve to partially alleviate the deleterious effects of a LiF508 allele (19, 20). Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 cd,e,f.gformatjon of heteroduplexes in DNA samples containing the following mutations increases the sensitivity to 100%: 1833delT; E827X; Q1291R; G551D, R553X, R553Q; I1234V, 3850-3T-G; respectively. Login to comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] Molecular mechanisms of CFTR chloride channel dysf... Cell. 1993 Jul 2;73(7):1251-4. Welsh MJ, Smith AE
Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis.
Cell. 1993 Jul 2;73(7):1251-4., [PMID:7686820]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 In a study identifying second-site revertants of the AF508 mutation using STEG-CFTR chimeras in yeast, R553M and, to a lesser extent, R553Q partially reversed the localization and functional effects of the AF508 mutation (Teem et al., 1993). Login to comment

[hide] Identification of revertants for the cystic fibros... Cell. 1993 Apr 23;73(2):335-46. Teem JL, Berger HA, Ostedgaard LS, Rich DP, Tsui LC, Welsh MJ
Identification of revertants for the cystic fibrosis delta F508 mutation using STE6-CFTR chimeras in yeast.
Cell. 1993 Apr 23;73(2):335-46., [PMID:7682896]

Abstract [show]
Mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis; the most common mutation is deletion of phenylalanine at position 508 (delta F508). We constructed STE6-CFTR chimeras with portions of the first nucleotide-binding domain (NBD1) of the yeast STE6 a-factor transporter replaced by portions of CFTR NBD1. The chimeras were functional in yeast, but mating efficiency decreased when delta F508 was introduced into NBD1. We isolated two delta F508 revertant mutations (R553M and R553Q) that restored mating; both were located within the CFTR NBD1 sequence. Introduction of these revertant mutations into human CFTR partially corrected the processing and Cl- channel gating defects caused by the delta F508 mutation. These results suggest that the NBD1s of CFTR and STE6 share a similar structure and function and that, in CFTR, the regions containing F508 and R553 interact. They also indicate that the abnormal conformation produced by delta F508 can be partially corrected by additional alterations in the protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 We isolated two AF508 revertant mutations (R553M and R553Q) that restored mating; both were located within the CFTR NBDl sequence. Login to comment
92 It is possible that other mutations within the R553-L558 region of the H5-AF508 plasmid could also result in increased mating efficiency; however, we proceeded to analyze the R553Q and R553M mutants in greater detail without further mutagenesis of the R553-L558 region. Login to comment
94 Whereas the mating efficiency of the H5-AF508 yeast strain is approximately lo/a of the H5 strain, yeast containing the H5-AF508/R553Q and H5-AF508/R553M plasmids mated at 3% and 3204 respec- 330 tively. Login to comment
96 However, when the mutations R553Q and R553M press the AF508 mating defect. Login to comment
97 The R553M mutation were introduced into CFTRAF508 (CFTRAF508/R553Q alone had little effect on H5 (H5R553M); when this mutant and CFTRAF508/R553M, respectively), CAMP-dependent was transformed into yeast, no further increase in mating anion permeability was restored. Login to comment
101 The R553Q and R553M mutations partially correct the defect in the H5-AF508 chimera and should also correct the defect in CFTRAF508 if a similar structure exists for NBDl in both proteins. Login to comment
102 As a test of this hypothesis, we introduced the R553Q and R553M mutations into CFTRAF508 cDNA and transfected mammalian cells with these constructs to determine whether the revertant mutations would correct the defect in CAMP-regulated Cl- transport of CFTRAF508. Login to comment
105 First, the initial rate of halide efflux after CAMP stimulation was less for CFTRAF508IR553M and CFTRAF508/R553Q than for wild-type CFTR (Figure 3). Login to comment
108 Thus, CAMP-stimulated halide efflux from the CFTRAF5081 R553Q- and CFTRAF508/R553Mtransfected cells was less efficient than that in cells transfected with wild-type CFTR.ThisobservationsuggeststhattheAF508CI-channel defect was only partially reversed by the reversion mutations. Login to comment
109 R553Q and R553M Suppress the CFTRAF508 Anion Transport Defect We assessed the effect of the R553Q and R553M mutations on CFTR function by assaying for CAMP-stimulated halide efflux using the halide-sensitive fluorophore 8-methoxy-N-(3sulfopropyl)-quinolinium (SPQ) (Illsley and Verkman, 1987). Login to comment
110 Expression of CFTR cDNA containing either the R553Q or the R553M mutation alone (without the AF508 mutation) in HeLa cells generated CAMP-stimulated halide efflux like wild-type CFTR (Figure 3). Login to comment
112 Relative Mating Efficiency of AF5OS Revertants Genotype H5R553M H5-AF508/R553M H&AF508/R553Q HSAF508 Mating Efficiency Relative to H5 (%) 77.4 f 3.7 34.2 f 7.0 3.2 i 0.8 1.1 f 0.5 Mating efficiencies were determined by quantitative mating assays and are expressed as a percentage relative to H5 (100%). Login to comment
118 Correction of CFTRAF508 Processing and Localization Cl- transport by CFTRAF508 containing the R553Q and R553M mutations would be detected only if the processing defect of CFTRAF508 was suppressed. Login to comment
122 CFTRAF508 is only present as the unglycosylated band A and the core glycosyl- 6000 -CFTR - AF508/R553M -c- R553M + AF508lR553Q I R553Q ,+ AF508 0 0 2 4 6 6 10 12 TIME (MIN) ated band B protein, consistent with its failure to traverse the Golgi complex and reach the plasma membrane (Cheng et al., 1990) (Figure 4). Login to comment
124 Analysis of Processed Forms of CFTR (A) Expression of wild-type CFTR (lane I), CFlWR553M (lane 2) CFTR/R553Q (lane 3) and CFTRAF508 (lane 4) in HeLa cells. Login to comment
140 R553Q and R553M mutations alone (without the AF508 mutation). Login to comment
141 As shown in Figure 4A, band C is present in cells expressing wild-type CFTR (lane 1) and also mutant CFTR containing either the R553Q or R553M mutation (lanes 2 and 3). Login to comment
146 We were not able to consistently detect band C CFTR in cells expressing CFTRAF508/R553Q, possibly owing to limitation8 in the sensitivity of the assay. Login to comment
154 For CFTRAF508/R553Q, plasma membrane staining of CFTR was weak and variable and could not be demonstrated consistently (Figure 5D). Login to comment
160 form and suggest that the amount of CFTRAF508/R553Q Single-Channel Analysis of at the plasma membrane is exceedingly low. Login to comment
161 Thus, these CFTRAF508/R553Q CFTR data indicate that only the CFTRAF508/R553M mutant is To determine whether the suppressor mutations altered detectable in the plasma membrane at levels greater than the single-channel properties of CFTRAF508, the re- that observed for CFTRAF508. Login to comment
162 vertant mutant CFTRAF508/R553Q was expressed in A R553Q c AF508/R553Q Y---M W---I w---m m--k w----m m-----v w---w 60mV 4OmV 20mV OmV -20 mV -40 mV -60 mV -60 mV -100 mV -120 mV 1P d 1 .4ms Figure 6. Login to comment
174 We chose the R553Q mutant because, as discussed below, it has been observed in a CF patient. Login to comment
185 The results also indicate that, as predicted by the functional analysis of CFTRAF508/R553Q by the SPQ halide efflux assay above, at least some CFTRAF508/R5530 is localized in the plasma membrane. Login to comment
186 Following activation with PKA and ATP, we measured the P, for CFfRIR553Q and CFTRAF508/R553Q at different MgATP concentrations. Login to comment
187 Figures 7A and 78 show examples of the activity of single channels at different concentrations of MgATP; as the concentration of MgATP increased, both CFTRIR553Q and CFTRAF508/R553Q spent more time in the open state. Login to comment
188 Figure 7C shows that the P, of CFTRIR553Q Cl- channels was similar to that previously reported for wild-type CFTR Cl- channels (An- Cdl A R553Q B AF508/R553Q Figure 7. Login to comment
193 A single CFTWR553Q Cl-channel (A) and a single CFTFtAF506/R553Q Cl-channel (6) are shown at different MgATP concentrations. Login to comment
198 Thus, the R553Q mutation corrected the functional defect in gating of the CFTRAF508 Cl- channels. Login to comment
208 Although the R553Q revertant was less eff icient at correcting processing of CFTRAF508 as measured by the amount of fully processed CFTR present and by immunocytochemistry, it produced functional channels as measured by the SPQ halide efflux assay. Login to comment
209 In addition, R553Q corrected the altered gating of CFTRAF508. Login to comment
213 We speculate that the R553Q mutation must change the conformation of the CFTRAF5081 R553Q protein sufficiently to revert gating to normal and that both CFTRAF508lR553Q and CFTRAF508lR553M must adopt a conformation that allows at least some of the mutant protein to escape the cellular quality control mechanisms. Login to comment
215 The CFTRAF508 revertant mutations R553Q and R553M were initially identified as revertants of the mating defect in yeast containing the H5-AF508 chimera, suggesting that the structure of NBDl in the chimera (and the effect of CF mutations on NBDl structure) resembles that of CFTR. Login to comment
223 Because wild-type phenotypes were observed with R553Q and R553M mutations alone, these mutations may be compensatory mutations that cause no detectable phenotype themselves. Login to comment
235 Interestingly, a CF patient with both the AF508 and R553Q mutations on the same chromosome has been described (Dork et al., 1991). Login to comment
239 It is interesting to speculate that the R553Q mutation may partially suppress the AF508 Cl- transport defect in the sweat gland in this patient, but is unable to suppress the defect in other affected tissues, such as the lung and pancreas, sufficiently to prevent clinical disease. Login to comment
240 Although the R553Q mutation corrected the defect in the P, of CFTRAF508, it was less effective than R553M in correcting the processing defect of CFTRAF508. Login to comment
241 Thus, the in vivo effect of the R553Q mutation on processing and function of CFTRAF508 might be quite small. Login to comment
242 However, a combination of restored CFTRAF508 channel function and improved processing might be sufficient to allow some of the CFTRAF508/R553Q mutant protein to reach the plasma membrane, where it could mediate Cl- transport in the duct of the sweat gland. Login to comment
243 In this regard, one might predict that the R553M mutation (or the AF508/R553Q on both chromosomes) might have a greater effect in suppressing the AF508 Cl- transport defect in the sweat gland and other organs. Login to comment
275 Two such colonies were identified (which contained the R553Q and R553M mutations), plasmid DNA was isolated from each, and the DNA sequence of the NED1 region was determined. Login to comment
284 To express CFTR in HeLa cells transiently, cells were infected with recombinant vaccinia virus (vTF7-3) to express the T7 bacteriophage RNA polymerase and then transfected with plasmid DNA containing either wild-type CFTR (pTM-CFTR-4) or CFTR mutants (pTMCFTRAF508, pTMCFTRAF508/R553Q, pTMCFTRAF508/R553M, pTMCFTR/R553Q, and pTMCFTWR553M) under the control of the T7 promoter, essentially as described in Rich et al. (1990). Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 8 NO. 11 m []~EVIEWS G551D R553Q G551S I L558S aI~7 S5491 I I 1&559T A455F E5040 I&F508 V520F SS49NII IIR560T PS74H I G458V G480C $492F /" • ss,9 II III* oa. / III / NBF1 ~t ~t NBF2 I I I I I III I I I 11234V G1244E IS1255P D1270N II I Q1291H N1303K G1349D S1251N W1282R] F1286S N1303H Q1283M, FIG[] Cystic fibrosis (missense) mutations located within the two presumptive ATP-binding domains (NBF1 and NBF2) of CFTR. Login to comment

[hide] Milestones in cystic fibrosis. Br Med Bull. 1992 Oct;48(4):717-37. Super M
Milestones in cystic fibrosis.
Br Med Bull. 1992 Oct;48(4):717-37., [PMID:1281032]

Abstract [show]
The study of cystic fibrosis (CF) provides a fascinating insight into developments in medicine in the 20th century. Milestones include the first clear clinical descriptions in the 1930s, discovery of a sweat electrolyte abnormality, establishing the autosomal recessive mode of inheritance and improvements in treatment. Microdissection experiments on sweat glands allowed the main defect to be delineated as one of chloride transport. Location of the gene to chromosome 7 made prenatal diagnosis feasible and carrier detection in siblings. The CF gene--its product being the cystic fibrosis transmembrane conductance regulator (CFTR), and its major mutation Delta F508 was discovered in 1989. World-wide collaboration has resulted in discovery of more than 150 further mutations. Incorporation of CFTR into non-chloride transporting insect cells by conferring chloride transport, proved it a chloride channel. CFTR incorporated into adenovirus results in correction of the chloride transport defect in airway cells, bringing gene therapy closer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
166 Interestingly the mutation R553Q, associated with Delta F508 downstream resulted in an apparently milder phenotype than usual (Tummler, personal communication). Login to comment

[hide] Cystic fibrosis with three mutations in the cystic... Hum Genet. 1991 Aug;87(4):441-6. Dork T, Wulbrand U, Richter T, Neumann T, Wolfes H, Wulf B, Maass G, Tummler B
Cystic fibrosis with three mutations in the cystic fibrosis transmembrane conductance regulator gene.
Hum Genet. 1991 Aug;87(4):441-6., [PMID:1715308]

Abstract [show]
Three mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene were discovered in a pancreas-insufficient patient with cystic fibrosis (CF) who displayed an uncommon combination of almost normal chloride concentration in sweat tests and typical symptoms of gastrointestinal and pulmonary disease. The R553Q mutation was found on the maternal delta F508-CFTR gene. Codon 553 is located within a consensus motif of the ATP-binding cassette transport proteins at a less conserved position. Other members of this protein superfamily contain a glutamine instead of arginine at the homologous position, suggesting a modulating rather than disease-causing role of the R553Q mutation in CFTR. The amplification refractory mutation system did not detect the R553Q mutation in a further 65 normal, 113 delta F508, and 91 non-delta F508 CF chromosomes. The index case carried the R553X nonsense mutation on the paternal chromosome. The R553X mutation was present on a further 9 out of 86 German non-delta F508 CF chromosomes linked with the XV2c-KM19-Mp6d9-J44-GATT haplotypes 2-2-2-1-1 and 1-1-2-1-2. The location of R553X on separate haplotypes including both alleles of the intragenic GATT repeat suggests an ancient and/or multiple origins of the R553X mutations. The association of the genotype of the CFTR mutation and the clinical phenotype was assessed for the patients carrying the related genotypes delta F508/delta F508 (n = 80), delta F508/R553X (n = 9) and delta F508-R553Q/R553X (n = 1). In compound heterozygotes, the median chloride concentration in pilocarpine iontophoresis sweat tests was significantly lower than in the delta F508 homozygotes (P less than 0.01). The patient groups were significantly different with respect to the distributions of the centiles for height (P less than 0.001) and weight (P less than 0.01) as the most sensitive predictors of the course and prognosis in CF. Growth retardation was more pronounced in the compound heterozygotes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 The R553Q mutation was found on the maternal AF508-CFTR gene. Login to comment
4 Other members of this protein superfamily contain a glutamine instead of arginine at the homologous position, suggesting a modulating rather than disease-causing role of the R553Q mutation in CFTR. Login to comment
5 The amplification refractory mutation system did not detect the R553Q mutation in a further 65 normal, 113 AF508, and 91 non-AF508 CF chromosomes. Login to comment
9 The association of the genotype of the CFTR mutation and the clinical phenotype was assessed for the patients carrying the related genotypes AF508/AF508 (n = 80), AF508/R553X (n = 9) and AF508-R553Q/R553X (n = 1). Login to comment
32 The R553Q mutation was detected by the amplification refractory mutation system (ARMS) (Newton et al. 1989) using the flanking intron primer 11i-5 as the common primer, and the primer sequences 5'- CACCTTGCTAAAGAAATTCTTCCTC-3' for the normal allele and 5'-CACCTTGCTAAAGAAATI'CTTCCTC-3'for the R553Q allele (35 cycles of PCR, 30 s at 62~ 45 s at 72~ 90 s at 91~ 214-bp product). Login to comment
34 The presence of the R553X and R553Q mutations was verified by direct genomic sequencing of the PCR product (Gyllenstein and Erlich 1988). Login to comment
50 The R553Q mutation In one patient who was harboring the R553X mutation, another nucleotide change was detected at the same codon of CFTR (Fig. 1). Login to comment
51 Guanine 1790 was substituted by an adenine, changing arginine 553 to a glutamine (R553Q). Login to comment
52 Sequence analysis of the parental samples revealed that the R553Q mutation was present on the maternal AF508 CF chromosome, whereas the paternal chromosome carried the R553X mutation. Login to comment
53 Hence, the patient with the AF508-R553Q/R553X mutations is the first known CF patient to have inherited three sequence alterations compared with the wild-type CFTR sequence. Login to comment
54 The AF508-R553Q allele was found to carry the haplotype 1-1-2-1-2-2-1-1-1-2 for the polymorphic marker loci " J3.11 (MspI)-J3.11 (TaqI)-GATT-J44-D9-KM19-XV2c- metH (MspI)-metH (TaqI)-metD (TaqI). Login to comment
55 The location of Gln553 on this typical AF508-1inked haplotype sugA A C G Contro[ R553X R553X/R553Q _,,,,i-- 1789C-T w, 790 G-A Fig. 1. Login to comment
57 ARMS analysisof the inheritanceof the R553Q mutation in a CF family. Login to comment
61 ARMS-M mutant product;ARMS-N normalproduct gests the origin of the R553Q mutation to be a AF508-CFTR gene. Login to comment
62 In order to test this hypothesis, our panel of N and CF chromosomes was screened for the presence of the R553Q mutation. Login to comment
63 Since R553Q is nested in a duster of other CF mutations, such as G551D and R553X (Cutting et al. 1990), ARMS (Newton et al. 1989) was applied for the specific detection of the R553Q mutation (Fig. 2). Login to comment
64 Using allele-specific primers and the 11i-5 downstream flanking intron primer for amplification of genomic DNA by PCR, the R553Q mutation was not detected on a further 65 normal, 113 AF508 CF and 91 non-AF508 CF chromosomes. Login to comment
65 Hence, the substitution of arginine 553 by glutamine is an infrequent sequence alteration in CFTR. Login to comment
78 The index case of genotype AF508-R553Q/R553X displays an unusual combination of almost normal sweat test values and severe clinical disease. Login to comment
80 In order to assess the severity of CF disease in quantitative terms, the clinical features of the index case AF508-R553Q/R553X were compared with those of patients who carry the related genotypes of CFTR mutations, AF508/AF508 or AF508/ R553X (Table 1). Login to comment
91 The comparison of the three genotypes suggests that the nonsense mutation R553X rather than AF508 or AF508-R553Q is associated with retardation of growth and development in the compound heterozygotes. Login to comment
95 Anthropometricdata and score refer to the patients' last visit to the CF Clinic (3/90-9/90) AF508/AF508 AF508/R553X AF508-R553Q/R553X Median Range (n = 80) Median Range (n = 9) (singlecase) Age 14.1 2.8-31.5 13.9 7.2-18.1 12.0 Age at diagnosis (years) 0.5 0 - 4.6 0.8 0.13.8 6.9 Sweat test (mmol chloride/I)a 109 78-160 86 80-109 63 Height percentile 48 199 14 740 10 Weight percentile 29 197 8 228 15 Chrispin Norman score of chest X-ray 9 032 11 520 9 Lung function parametersb FEV1 (% predicted) 73 18-114 (n = 65) 64 44-102 75 VC (% predicted) 84 33-118 (n = 65) 78 57-102 85 a Mean value of at least three independent pilocarpine iontophoresis sweat tests b Average values of the forced expiratoryvolume in 1 s (FEV1) and of the forced vital capacity (VC) of the last five pulmonary function tests excluding episodes of airway infections (Rich et al. 1990; Drumm et al. 1990). Login to comment
101 The disease-causing mutations in CFTR are obligatorily associated with the defect in chloride transport; hence, the almost normal sweat chloride concentration in this patient suggests that the substitution of arginine 553 by glutamine neither is a neutral polymorphism nor does it cause disease, but rather it modulates the function and/or processing of the AF508-CFTR gene product. Login to comment
111 The R553Q mutation that we have discovered in our CF patient with borderline sweat tests abolishes this charge and slightly decreases the polarity of the predicted loop 3. Login to comment
119 Hence, if both loops provide essential contacts for promoting channel-mediated chloride transport, it is reasonable to assume that the substitution of arginine 553 by glutamine may partly compensate for the deleterious effect of the omission of phenylalanine 508 of CFTR with respect to anion permeability of the apical membrane of epithelia. Login to comment

[hide] Effects of the gout-causing Q141K polymorphism and... Biochem Biophys Res Commun. 2013 Jul 19;437(1):140-5. doi: 10.1016/j.bbrc.2013.06.054. Epub 2013 Jun 22. Saranko H, Tordai H, Telbisz A, Ozvegy-Laczka C, Erdos G, Sarkadi B, Hegedus T
Effects of the gout-causing Q141K polymorphism and a CFTR DeltaF508 mimicking mutation on the processing and stability of the ABCG2 protein.
Biochem Biophys Res Commun. 2013 Jul 19;437(1):140-5. doi: 10.1016/j.bbrc.2013.06.054. Epub 2013 Jun 22., [PMID:23800412]

Abstract [show]
ABCG2 is an important multidrug transporter involved also in urate transport, thus its mutations can lead to the development of gout and may also alter general drug absorption, distribution and excretion. The frequent ABCG2 polymorphism, Q141K, is associated with an elevated risk of gout and has been controversially reported to reduce the plasma membrane expression and/or the transport function of the protein. In the present work we examined the stability and cellular processing of the Q141K ABCG2 variant, as well as that of the DeltaF142 ABCG2, corresponding to the DeltaF508 mutation in the CFTR (ABCC7) protein, causing cystic fibrosis. The processing and localization of full length ABCG2 variants were investigated in mammalian cells, followed by Western blotting and confocal microscopy, respectively. Folding and stability were examined by limited proteolysis of Sf9 insect cell membranes expressing these ABCG2 constructs. Stability of isolated nucleotide binding domains, expressed in and purified from bacteria, was studied by CD spectroscopy. We find that the Q141K variant has a mild processing defect which can be rescued by low temperature, a slightly reduced activity, and a mild folding defect, especially affecting the NBD. In contrast, the DeltaF142 mutant has major processing and folding defects, and no ATPase function. We suggest that although these mutations are both localized within the NBD, based on molecular modeling their contribution to the ABCG2 structure and function is different, thus rescue strategies may be devised accordingly.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Therefore all these three mutations were introduced into the corresponding regions of the ABCG2 DF142 construct (3R: G188E, R191Q, and R193K). Login to comment

[hide] Laboratory tests for the diagnosis of cystic fibro... Am J Clin Pathol. 2002 Jun;117 Suppl:S109-15. Wang L, Freedman SD
Laboratory tests for the diagnosis of cystic fibrosis.
Am J Clin Pathol. 2002 Jun;117 Suppl:S109-15., [PMID:14569807]

Abstract [show]
Cystic fibrosis (CF) remains the most common life-limiting inherited disease in America. Making an accurate, early diagnosis is essential to the management of the disease. The diagnostic criteria for CF require the presence of 1 or more typical clinical features, a family history of CF, or a positive newborn screening test, plus laboratory evidence of the CF transmembrane conductance regulator (CFTR) dysfunction. In the past, the laboratory test of abnormal CFTR function was based largely on an elevated sweat chloride test result. The recent development of a genotypic CFTR mutation screen has greatly improved diagnostic accuracy. Increased screening of the CFTR locus has led to the recognition of a number of atypical CF disorders. Recently, a 2-tiered newborn screening protocol including CFTR genotyping has become popular, increasing the likelihood of early diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 For example, the complex allele R553Q-delta F508 has been shown to revert partially or ameliorate the phenotype of delta F508 mutation.15 Other revertants (delta F508-V1212I and R334W-R1158X) associated with mild or atypical CF have also been described.16,17 Nasal Potential-Difference Measurements This is a functional test for the CFTR gene product. Login to comment

[hide] Rescue of functional DeltaF508-CFTR channels by co... FEBS Lett. 2003 Nov 6;554(1-2):173-8. Owsianik G, Cao L, Nilius B
Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells.
FEBS Lett. 2003 Nov 6;554(1-2):173-8., [PMID:14596935]

Abstract [show]
The most frequent mutant variant of the cystic fibrosis transmembrane conductance regulator (CFTR), DeltaF508-CFTR, is misprocessed and subsequently degraded in the endoplasmic reticulum. Using the patch-clamp technique, we showed that co-expressions of DeltaF508-CFTR with the N-terminal CFTR truncates containing bi-arginine (RXR) retention/retrieval motifs result in a functional rescue of the DeltaF508-CFTR mutant channel in COS-1 cells. This DeltaF508-CFTR rescue process was strongly impaired when truncated CFTR constructs possessed either the DeltaF508 mutation or arginine-to-lysine mutations in RXRs. In conclusions, our data demonstrated that expression of truncated CFTR constructs could be a novel promising approach to improve maturation of DeltaF508-CFTR channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
153 The fact that second-site mutations in NBD1 of vF508-CFTR partially correct processing and functional defects of this mutant channel strongly supports this latter hypothesis (note that R553Q and R553M mutations correspond to the arginine in the RAR motif) [16^18]. Login to comment

[hide] Rescue of F508del CFTR: Commentary on "F508del CFT... Biochim Biophys Acta. 2006 May;1758(5):563-4. Epub 2006 Apr 7. Tummler B
Rescue of F508del CFTR: Commentary on "F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive".
Biochim Biophys Acta. 2006 May;1758(5):563-4. Epub 2006 Apr 7., [PMID:16712779]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 doi:10.1016/j.bbamem.2006.03.033 Hegedus' finding also provides a clue why second-site mutations in the RXR motif in the dodecapetide of NBF1 such as R553Q, R553M and R555K partially corrected the F508del CFTR mutant phenotype in model systems [16] and in CF patients [17]. Login to comment
25 CFTR mutation analysis uncovered the mutation R553Q on one F508del CF chromosome of this patient. Login to comment

[hide] Requirements for efficient correction of DeltaF508... Cell. 2012 Jan 20;148(1-2):164-74. doi: 10.1016/j.cell.2011.11.023. Mendoza JL, Schmidt A, Li Q, Nuvaga E, Barrett T, Bridges RJ, Feranchak AP, Brautigam CA, Thomas PJ
Requirements for efficient correction of DeltaF508 CFTR revealed by analyses of evolved sequences.
Cell. 2012 Jan 20;148(1-2):164-74. doi: 10.1016/j.cell.2011.11.023., [PMID:22265409]

Abstract [show]
Misfolding of DeltaF508 cystic fibrosis (CF) transmembrane conductance regulator (CFTR) underlies pathology in most CF patients. F508 resides in the first nucleotide-binding domain (NBD1) of CFTR near a predicted interface with the fourth intracellular loop (ICL4). Efforts to identify small molecules that restore function by correcting the folding defect have revealed an apparent efficacy ceiling. To understand the mechanistic basis of this obstacle, positions statistically coupled to 508, in evolved sequences, were identified and assessed for their impact on both NBD1 and CFTR folding. The results indicate that both NBD1 folding and interaction with ICL4 are altered by the DeltaF508 mutation and that correction of either individual process is only partially effective. By contrast, combination of mutations that counteract both defects restores DeltaF508 maturation and function to wild-type levels. These results provide a mechanistic rationale for the limited efficacy of extant corrector compounds and suggest approaches for identifying compounds that correct both defective steps.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 A patient with a less severe form of CF had DF508-R553Q on one allele and a nonsense mutation on the other (Do &#a8; rk et al., 1991). Login to comment
17 A mating screen in yeast utilizing a CFTR-Ste6 chimera identified the same R553Q mutation as a suppressor of the loss-of-mating DF508 phenotype (Teem et al., 1993). Login to comment

[hide] Functional Rescue of F508del-CFTR Using Small Mole... Front Pharmacol. 2012 Sep 26;3:160. doi: 10.3389/fphar.2012.00160. eCollection 2012. Molinski S, Eckford PD, Pasyk S, Ahmadi S, Chin S, Bear CE
Functional Rescue of F508del-CFTR Using Small Molecule Correctors.
Front Pharmacol. 2012 Sep 26;3:160. doi: 10.3389/fphar.2012.00160. eCollection 2012., [PMID:23055971]

Abstract [show]
High-throughput screens for small molecules that are effective in "correcting" the functional expression of F508del-CFTR have yielded several promising hits. Two such compounds are currently in clinical trial. Despite this success, it is clear that further advances will be required in order to restore 50% or greater of wild-type CFTR function to the airways of patients harboring the F508del-CFTR protein. Progress will be enhanced by our better understanding of the molecular and cellular defects caused by the F508del mutation, present in 90% of CF patients. The goal of this chapter is to review the current understanding of defects caused by F508del in the CFTR protein and in CFTR-mediated interactions important for its biosynthesis, trafficking, channel function, and stability at the cell surface. Finally, we will discuss the gaps in our knowledge regarding the mechanism of action of existing correctors, the unmet need to discover compounds which restore proper CFTR structure and function in CF affected tissues and new strategies for therapy development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 The first stabilizing mutations were identified in the ABC conserved, canonical subdomains, and cluster in the b1;-helical subdomain (G550R, R553Q, R555K), in the b3; switch (F494N), and ATP binding core subdomain (Q637R). Login to comment
59 Similarly, the second site mutations, previously discussed with regard to their efficacy in stabilizing the isolated F508del-NBD1, i.e., the second site mutations in the ABC conserved core ATP binding subdomains (G550E, R553Q, and R555K) also promote improved processing of the full-length F508del-CFTR. Login to comment

[hide] Mechanisms of CFTR Folding at the Endoplasmic Reti... Front Pharmacol. 2012 Dec 13;3:201. doi: 10.3389/fphar.2012.00201. eCollection 2012. Kim SJ, Skach WR
Mechanisms of CFTR Folding at the Endoplasmic Reticulum.
Front Pharmacol. 2012 Dec 13;3:201. doi: 10.3389/fphar.2012.00201. eCollection 2012., [PMID:23248597]

Abstract [show]
In the past decade much has been learned about how Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) folds and misfolds as the etiologic cause of cystic fibrosis (CF). CFTR folding is complex and hierarchical, takes place in multiple cellular compartments and physical environments, and involves several large networks of folding machineries. Insertion of transmembrane (TM) segments into the endoplasmic reticulum (ER) membrane and tertiary folding of cytosolic domains begin cotranslationally as the nascent polypeptide emerges from the ribosome, whereas posttranslational folding establishes critical domain-domain contacts needed to form a physiologically stable structure. Within the membrane, N- and C-terminal TM helices are sorted into bundles that project from the cytosol to form docking sites for nucleotide binding domains, NBD1 and NBD2, which in turn form a sandwich dimer for ATP binding. While tertiary folding is required for domain assembly, proper domain assembly also reciprocally affects folding of individual domains analogous to a jig-saw puzzle wherein the structure of each interlocking piece influences its neighbors. Superimposed on this process is an elaborate proteostatic network of cellular chaperones and folding machineries that facilitate the timing and coordination of specific folding steps in and across the ER membrane. While the details of this process require further refinement, we finally have a useful framework to understand key folding defect(s) caused by DeltaF508 that provides a molecular target(s) for the next generation of CFTR small molecule correctors aimed at the specific defect present in the majority of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
122 Mutations that increase NBD1 solubility and/or thermodynamic stability (I539T, G550E, R553Q, and others; Teem et al., 1993; DeCarvalho et al., 2002; Roxo-Rosa et al., 2006; Pissarra et al., 2008; Hoelen et al., 2010) and/or decrease backbone flexibility (Aleksandrov et al., 2012) can enhance both NBD1 folding yield in cells and trafficking efficiency of full length WT as well as ࢞F508 CFTR (Figure 3B). Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Cold Spring Harb Perspect Med. 2013 Feb 1;3(2):a009514. doi: 10.1101/cshperspect.a009514. Hunt JF, Wang C, Ford RC
Cystic fibrosis transmembrane conductance regulator (ABCC7) structure.
Cold Spring Harb Perspect Med. 2013 Feb 1;3(2):a009514. doi: 10.1101/cshperspect.a009514., [PMID:23378596]

Abstract [show]
Structural studies of the cystic fibrosis transmembrane conductance regulator (CFTR) are reviewed. Like many membrane proteins, full-length CFTR has proven to be difficult to express and purify, hence much of the structural data available is for the more tractable, independently expressed soluble domains. Therefore, this chapter covers structural data for individual CFTR domains in addition to the sparser data available for the full-length protein. To set the context for these studies, we will start by reviewing structural information on model proteins from the ATP-binding cassette (ABC) transporter superfamily, to which CFTR belongs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
163 One such set, called the Teem set, comprised three point mutations (G550E/ R553Q/R555K) that previously were shown to promote improved biogenesis of F508del CFTR in tissue cultures cells, presumably by improving the stability of the protein (Teem et al. 1993; DeCarvalho et al. 2002). Login to comment
236 Note that the structures shown here contain seven point mutations included in hNBD1 constructs because of their beneficial influence on yield during purification-F409L, F429S, F433L, G550E, R553Q, R555K, and H667R. Login to comment
275 A series of second-site mutations in NBD1 have parallel effects in rescuing the trafficking defect in CFTR in vivo (DeCarvalho et al. 2002; Pissarra et al. 2008; Aleksandrov et al. 2010) and inhibiting molten globule formation by isolated NBD1 in vitro (G550E/R553Q/R555K, F494N/Q637R, or V510D) (Protasevich et al. 2010; Wang et al. 2010). Login to comment

[hide] Dynamics intrinsic to cystic fibrosis transmembran... Cold Spring Harb Perspect Med. 2013 Mar 1;3(3):a009522. doi: 10.1101/cshperspect.a009522. Chong PA, Kota P, Dokholyan NV, Forman-Kay JD
Dynamics intrinsic to cystic fibrosis transmembrane conductance regulator function and stability.
Cold Spring Harb Perspect Med. 2013 Mar 1;3(3):a009522. doi: 10.1101/cshperspect.a009522., [PMID:23457292]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) requires dynamic fluctuations between states in its gating cycle for proper channel function, including changes in the interactions between the nucleotide-binding domains (NBDs) and between the intracellular domain (ICD) coupling helices and NBDs. Such motions are also linked with fluctuating phosphorylation-dependent binding of CFTR's disordered regulatory (R) region to the NBDs and partners. Folding of CFTR is highly inefficient, with the marginally stable NBD1 sampling excited states or folding intermediates that are aggregation-prone. The severe CF-causing F508del mutation exacerbates the folding inefficiency of CFTR and leads to impaired channel regulation and function, partly as a result of perturbed NBD1-ICD interactions and enhanced sampling of these NBD1 excited states. Increased knowledge of the dynamics within CFTR will expand our understanding of the regulated channel gating of the protein as well as of the F508del defects in folding and function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
200 Many of the suppressor mutations, like G550E, R553Q, and R555K (Teem et al. 1993, 1996), which are relatively distant from the F508 position, increase NBD1 thermal stability and reverse some of the processing and functional defects, presumably without reverting the surface changes caused by deletion of F508. Login to comment

[hide] Bithiazole correctors rescue CFTR mutants by two d... Biochemistry. 2013 Aug 6;52(31):5161-3. doi: 10.1021/bi4008758. Epub 2013 Jul 22. Loo TW, Bartlett MC, Clarke DM
Bithiazole correctors rescue CFTR mutants by two different mechanisms.
Biochemistry. 2013 Aug 6;52(31):5161-3. doi: 10.1021/bi4008758. Epub 2013 Jul 22., [PMID:23865422]

Abstract [show]
Better correctors are needed to repair cystic fibrosis transmembrane conductance regulator (CFTR) processing mutants that cause cystic fibrosis. Determining where the correctors bind to CFTR would aid in the development of new correctors. A recent study reported that the second nucleotide-binding domain (NBD2) was involved in binding of bithiazole correctors. Here, we show that bithiazole correctors could also rescue CFTR mutants that lacked NBD2. These results suggest that bithiazoles rescue CFTR mutants by two different mechanisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 It should be noted, however, that the ƊNBD2 CFTR used in this study was different from that used by Okiyoneda et al.18 The ƊNBD2 CFTR constructs in our study did not contain the G550E, R553Q, R555K, and F494N mutations or the three hemagglutinin tags in the fourth extracellular loop that could influence CFTR corrector interactions. Login to comment

[hide] On the structural organization of the intracellula... Int J Biochem Cell Biol. 2014 Jul;52:7-14. doi: 10.1016/j.biocel.2014.01.024. Epub 2014 Feb 7. Moran O
On the structural organization of the intracellular domains of CFTR.
Int J Biochem Cell Biol. 2014 Jul;52:7-14. doi: 10.1016/j.biocel.2014.01.024. Epub 2014 Feb 7., [PMID:24513531]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a multidomain membrane protein forming an anion selective channel. Mutations in the gene encoding CFTR cause cystic fibrosis (CF). The intracellular side of CFTR constitutes about 80% of the total mass of the protein. This region includes domains involved in ATP-dependent gating and regulatory protein kinase-A phosphorylation sites. The high-resolution molecular structure of CFTR has not yet been solved. However, a range of lower resolution structural data, as well as functional biochemical and electrophysiological data, are now available. This information has enabled the proposition of a working model for the structural architecture of the intracellular domains of the CFTR protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1241 However, as the native preparation of NBD1 and NBD2 tend to precipitate at relatively low concentration (>2.5 mg/ml; Galeno et al., 2011; Galfr&#e8; et al., 2012), to obtain protein concentrations compatible with the crystallization conditions, three to seven revertant mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R, Roxo-Rosa et al., 2006; F429S, F494N, Q637R, Pissarra et al., 2008) have been introduced into the NBD1. Login to comment

[hide] Complement yourself: Transcomplementation rescues ... Biophys Rev. 2014 Mar 1;6(1):169-180. Cebotaru L, Guggino WB
Complement yourself: Transcomplementation rescues partially folded mutant proteins.
Biophys Rev. 2014 Mar 1;6(1):169-180., [PMID:24949105]

Abstract [show]
Cystic Fibrosis (CF) is an autosomal disease associated with malfunction in fluid and electrolyte transport across several mucosal membranes. The most common mutation in CF is an in-frame three-base pair deletion that removes a phenylalanine at position 508 in the first nucleotide-binding domain of the cystic fibrosis conductance regulator (CFTR) chloride channel. This mutation has been studied extensively and leads to biosynthetic arrest of the protein in the endoplasmic reticulum and severely reduced channel activity. This review discusses a novel method of rescuing DeltaF508 with transcomplementation, which occurs when smaller fragments of CFTR containing the wild-type nucleotide binding domain are co-expressed with the DeltaF508 deletion mutant. Transcomplementation rescues the processing and channel activity of DeltaF508 and reduces its rate of degradation in airway epithelial cells. To apply transcomplementation as a therapy would require that the cDNA encoding the truncated CFTR be delivered to cells. We also discuss a gene therapeutic approach based on delivery of a truncated form of CFTR to airway cells using adeno-associated viral vectors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Using a mutagenesis approach, they were able to isolate two mutants, R553M and R553Q, which in combination with ƊF508 restored mating. Login to comment

[hide] Restoration of NBD1 thermal stability is necessary... J Mol Biol. 2015 Jan 16;427(1):106-20. doi: 10.1016/j.jmb.2014.07.026. Epub 2014 Jul 30. He L, Aleksandrov AA, An J, Cui L, Yang Z, Brouillette CG, Riordan JR
Restoration of NBD1 thermal stability is necessary and sufficient to correct F508 CFTR folding and assembly.
J Mol Biol. 2015 Jan 16;427(1):106-20. doi: 10.1016/j.jmb.2014.07.026. Epub 2014 Jul 30., [PMID:25083918]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) (ABCC7), unique among ABC exporters as an ion channel, regulates ion and fluid transport in epithelial tissues. Loss of function due to mutations in the cftr gene causes cystic fibrosis. The most common cystic-fibrosis-causing mutation, the deletion of F508 (DeltaF508) from the first nucleotide binding domain (NBD1) of CFTR, results in misfolding of the protein and clearance by cellular quality control systems. The DeltaF508 mutation has two major impacts on CFTR: reduced thermal stability of NBD1 and disruption of its interface with membrane-spanning domains (MSDs). It is unknown if these two defects are independent and need to be targeted separately. To address this question, we varied the extent of stabilization of NBD1 using different second-site mutations and NBD1 binding small molecules with or without NBD1/MSD interface mutation. Combinations of different NBD1 changes had additive corrective effects on F508 maturation that correlated with their ability to increase NBD1 thermostability. These effects were much larger than those caused by interface modification alone and accounted for most of the correction achieved by modifying both the domain and the interface. Thus, NBD1 stabilization plays a dominant role in overcoming the DeltaF508 defect. Furthermore, the dual target approach resulted in a locked-open ion channel that was constitutively active in the absence of the normally obligatory dependence on phosphorylation by protein kinase A. Thus, simultaneous targeting of both the domain and the interface, as well as being non-essential for correction of biogenesis, may disrupt normal regulation of channel function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 S492P/I539T; 5-G550E/R553Q/R555K; 6-combo. Login to comment
74 (*) In full-length CFTR, R553M was introduced instead of R553Q in isolated NBD1. Login to comment
75 Based on our single mutation analysis, the Tm difference between G550E/R553Q/R555K and G550E/R553M/R555K is less than 1 &#b0;C. Fig. 3. Login to comment

[hide] Deletion of Phenylalanine 508 in the First Nucleot... J Biol Chem. 2015 Sep 18;290(38):22862-78. doi: 10.1074/jbc.M115.641134. Epub 2015 Jul 6. Chong PA, Farber PJ, Vernon RM, Hudson RP, Mittermaier AK, Forman-Kay JD
Deletion of Phenylalanine 508 in the First Nucleotide-binding Domain of the Cystic Fibrosis Transmembrane Conductance Regulator Increases Conformational Exchange and Inhibits Dimerization.
J Biol Chem. 2015 Sep 18;290(38):22862-78. doi: 10.1074/jbc.M115.641134. Epub 2015 Jul 6., [PMID:26149808]

Abstract [show]
Deletion of Phe-508 (F508del) in the first nucleotide-binding domain (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR) results in destabilization of the domain, intramolecular interactions involving the domain, and the entire channel. The destabilization caused by F508del manifests itself in defective channel processing and channel gating defects. Here, we present NMR studies of the effect of F508del and the I539T stabilizing mutation on NBD1 dynamics, with a view to understanding these changes in stability. Qualitatively, F508del NMR spectra exhibit significantly more peak broadening than WT spectra due to the enhanced intermediate time scale (millisecond to microsecond) motions in the mutant. Unexpectedly, studies of fast (nanosecond to picosecond) motions revealed that F508del NBD1 tumbles more rapidly in solution than WT NBD1. Whereas F508del tumbles at a rate nearly consistent with the monomeric state, the WT protein tumbles significantly more slowly. Paramagnetic relaxation enhancement experiments confirm that NBD1 homodimerizes in solution in the expected head-to-tail orientation. NMR spectra of WT NBD1 reveal significant concentration-dependent chemical shift perturbations consistent with NBD1 dimerization. Chemical shift analysis suggests that the more rapid tumbling of F508del is the result of an impaired ability to dimerize. Based on previously published crystal structures and NMR spectra of various NBD1 mutants, we propose that deletion of Phe-508 affects Q-loop conformational sampling in a manner that inhibits dimerization. These results provide a potential mechanism for inhibition of channel opening by F508del and support the dimer interface as a target for cystic fibrosis therapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Evidence that NBD1 destabilization is problematic for proper processing was provided by NBD1-thermostabilizing mutations distant from the F508del site, including G550E, R553Q, R555K, and deletion of the RI. Login to comment