ABCMdb

ABCC7 p.Arg553Gln

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 10480369 [PubMed] Romey MC et al: "Complex allele [-102T>A+S549R(T>G)] is associated with milder forms of cystic fibrosis than allele S549R(T>G) alone."

No. Sentence Comment

79 For instance, the missense mutation R553Q, when carried on a ∆ F508 allele, has been shown to be associated with almost normal sweat electrolyte values in a patient with severe CF (Dörk et al. 1991), suggesting that R553Q may partially suppress the ∆F508 chloride transport defect in sweat glands of this patient. Login to comment
80 It was later demonstrated in a yeast expression system that the abnormal folding produced by ∆F508 can be partially corrected by the additional, "revertant" mutation R553Q (Teem et al. 1993). Login to comment

PMID: 11118444 [PubMed] Clain J et al: "Two mild cystic fibrosis-associated mutations result in severe cystic fibrosis when combined in cis and reveal a residue important for cystic fibrosis transmembrane conductance regulator processing and function."

No. Sentence Comment

125 DISCUSSION Complex alleles have been described clinically (R553Q- ⌬F508, ⌬F508-V1212I, and R334W-R1158X), and most of them are considered to reverse the phenotype, as they are associated with milder symptoms than the most common mutation in isolation. Login to comment

PMID: 12110684 [PubMed] DeCarvalho AC et al: "Mutations in the nucleotide binding domain 1 signature motif region rescue processing and functional defects of cystic fibrosis transmembrane conductance regulator delta f508."

No. Sentence Comment

103 Interestingly, the three ⌬F508 revertant mutations previously isolated using the STE6/CFTR system, R553Q, R553M, and R555K, are also located within the NBD1 signature motif (28, 29). Login to comment

PMID: 12940920 [PubMed] Rowntree RK et al: "The phenotypic consequences of CFTR mutations."

No. Sentence Comment

172 The first complex allele to be described was in 1991 where R553Q was detected on the same allele as F508 of a CF patient also carrying the R553X mutation (Dork et al. 1991). Login to comment
173 This patient exhibited pancreatic insufficiency and severe pulmonary disease but a borderline sweat test, suggesting that the R553Q mutation is somehow modulating the severity of CF disease normally associated with F508. Login to comment
174 Analysis of the crystal structure of the related ABC protein, HisP, showed that these two mutations are predicted to lie in adjacent α-helices and that R553Q lies in a region essential for the integrity of protein folding (Hung et al. 1998). Login to comment

PMID: 15528182 [PubMed] Lewis HA et al: "Impact of the deltaF508 mutation in first nucleotide-binding domain of human cystic fibrosis transmembrane conductance regulator on domain folding and structure."

No. Sentence Comment

73 We also investigated the effect of three suppressor mutations (G550E, R553Q, R555K) that have been observed to improve in vivo trafficking efficiency of STE6-CFTR chimeras containing the ⌬F508 mutation expressed in yeast (23-25). Login to comment
100 Crystal Structure of ⌬F508 hNBD1 Shows Minimal Conformational Changes but Substantive Changes in Surface Topography at the Putative Site of MSD1 Interaction-Crystals diffracting to a resolution of 2.3 Å were obtained for hNBD1-7a- ⌬F508, which contains seven mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of Phe-508 (see Table II). Login to comment
139 The three suppressor mutations (G550E, R553Q, R555K) occur either in or immediately following the LSGGQ signature sequence at the N terminus of ␣-helix 5. Login to comment

PMID: 15619636 [PubMed] Thibodeau PH et al: "Side chain and backbone contributions of Phe508 to CFTR folding."

No. Sentence Comment

148 Note added in proof: Crystal structures of the human F508A missense NBD1 (with solublizing mutations F429S and H667R) and the corrected ∆F508 NBD1 (with three known suppressor mutations G550E, R553Q and R555K, and the solublizing mutations F409L, F429S, F433L and H667R) have been reported51. Login to comment

PMID: 17021906 [PubMed] Constable PA et al: "Light and alcohol evoked electro-oculograms in cystic fibrosis."

No. Sentence Comment

204 In D508, the accompanying mutation R553Q confers stability to the protein so that it retains function by improving the folding and trafficking of CFTR to the plasma membrane [60]. Login to comment

PMID: 17244607 [PubMed] Zegarra-Moran O et al: "Functional analysis of mutations in the putative binding site for cystic fibrosis transmembrane conductance regulator potentiators. Interaction between activation and inhibition."

No. Sentence Comment

5 We found that all three mutants responded to cAMP, although the affinity of R553Q was higher than that of wild type CFTR. Login to comment
6 In R553Q and V1293G mutants, the dissociation constant of potentiators for the activating site was increased, whereas the dissociation constant for the inhibitory site was reduced. Login to comment
44 We found that the stimulating effect of potentiators was reduced for R553Q and V1293G. Login to comment
50 For mutations A554E and R553Q, CFTR cDNA was subcloned on pcDNA3.1. Login to comment
52 V1293G clones were selected and maintained in 800 ␮g/ml Zeocin, and A554E and R553Q constructs were selected and maintained in 1 mg/ml G418. Login to comment
53 Cell Cultures-FRT cells expressing wild type (WT), V1293G, A554E, or R553Q CFTR were cultured on 60-mm Petri dishes with Coon`s modified F12 containing 5% fetal bovine serum, 2 mM L-glutamine, 50 units/ml penicillin, and 50 ␮g/ml streptomycin and selection antibiotics, as described previously (15). Login to comment
86 Conversely, the dissociation constant for R553Q was significantly smaller. Login to comment
98 Continuous lines (WT, A554E, and V1293G) and broken lines (R553Q) indicate fitting of the data to Equation 1. Login to comment
100 Wild type A554E V1293G R553Q G551D n ϭ 5 n ϭ 4 n ϭ 4 n ϭ 6 n ϭ 7 Imax (␮A/cm2 ) 282.2 Ϯ 13.5 66.9 Ϯ 16.4a 70.2 Ϯ 14a 93.8 Ϯ 19a 10.1 Ϯ 2.8a Kd (␮M) 54.2 Ϯ 11.5 40.5 Ϯ 5.9 48.4 Ϯ 13.5 21.5 Ϯ 4.5a 74.2 Ϯ 12.1 I(20)/I(max) 0.3 Ϯ 0.04 0.34 Ϯ 0.03 0.32 Ϯ 0.05 0.51 Ϯ 0.05a 0.23 Ϯ 0.03 a p Ͻ 0.05. Login to comment
102 It is interesting to note that 20 ␮M CPTcAMP produced a similar current fraction (ϳ0.3) on mutants V1293G and A554E but half of the maximum current (ϳ0.5) on R553Q (see I(20)/ I(max) in Table 1), in agreement with the lower Kd of CPT-cAMP found on this mutant. Login to comment
108 In contrast, the protein with the adjacent residue mutated, R553Q, behaved in a completely different way. Login to comment
110 Mutant V1293G behavior was between A554E and R553Q. Login to comment
111 In fact, the two equilibrium constants were modified but less than in mutant R553Q (Table 2). Login to comment
120 In fact, the more the Ka value shifted toward higher concentrations, as in the case of genistein for R553Q, the more the Ki value shifted toward lower concentrations. Login to comment
123 A, representative traces showing the response of wild type CFTR and mutant R553Q to application of genistein. Login to comment
130 Compounds Protein n fA Ka Ki ␮M ␮M Genistein Wild type 5 1.33 Ϯ 0.41 3.08 Ϯ 0.74 562.4 Ϯ 111.1 A554E 6 2.75 Ϯ 0.62 4.58 Ϯ 0.51 408.6 Ϯ 84.8 V1293G 6 4.87 Ϯ 1.91 12 Ϯ 3.9a 270.5 Ϯ 36.4a R553Q 6 1.87 Ϯ 0.12 22.28 Ϯ 5.2a 119.9 Ϯ 34.9a UCCF029 Wild type 4 0.41 Ϯ 0.04 0.021 Ϯ 0.002 1036 Ϯ 523 A554E 4 1.56 Ϯ 0.45a 0.036 Ϯ 0.009 1519 Ϯ 651 V1293G 5 3.19 Ϯ 1.09 0.042 Ϯ 0.008 843 Ϯ 126 R553Q 5 1.08 Ϯ 0.17a 0.154 Ϯ 0.029a 547 Ϯ 99 Act-06 Wild type 5 0.8 Ϯ 0.17 0.69 Ϯ 0.33 439.6 Ϯ 108 A554E 4 1.67 Ϯ 0.42 0.74 Ϯ 0.25 319.1 Ϯ 42.4 V1293G 4 1.25 Ϯ 0.16 0.35 Ϯ 0.09 383.8 Ϯ 28.9 R553Q 6 1.77 Ϯ 0.47a 2.11 Ϯ 0.73 179.1 Ϯ 73.2a a Student`s t test indicated that these values were statistically different from those on WT CFTR with p Ͻ 0.05. Login to comment
149 Surprisingly, we found a lower equilibrium constant for CPT-cAMP on mutant R553Q (see Table 2). Login to comment
152 It is interesting to note that mutation R553Q is one of the CF mutations identified as ⌬Phe508 revertants (34). Login to comment
153 That means that introduction of R553Q mutation into human CFTR partially corrects the processing and gating defect caused by the ⌬Phe508 mutation, which has been suggested to modify the NBD1 surface that interacts with other CFTR domains (20). Login to comment
163 In fact, the mutation that produced a stronger shift of the affinity for these compounds was R553Q, where the charge was eliminated. Login to comment
167 The CFTR proteins are indicated in red, yellow, green, and blue for R553Q, V1293G, A554E and WT, respectively. Login to comment
176 Actually, we found that an increased Ka in R553Q and V1293G with respect to wild type CFTR is accompanied by a reduced Ki (Figs. Login to comment

PMID: 18463704 [PubMed] Serohijos AW et al: "Diminished self-chaperoning activity of the DeltaF508 mutant of CFTR results in protein misfolding."

No. Sentence Comment

46 However, even in the presence of correcting mutants (G550E, R553Q, and R555K) [10,15-17] in our model of NBD1-DF508, we still observe a significant change in dynamics at the folding transition. Login to comment

PMID: 18597042 [PubMed] Mornon JP et al: "Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces."

No. Sentence Comment

97 These mutations are actually located outside the NBD1 structure core, in the regulatory insertion (F409L, F429S, F433L) and extension (R667H), or in the signature sequence region (G550E, R553Q, R555K), whose local conformations in the crystal structure and in our model are perfectly superimposable. Login to comment

PMID: 19176844 [PubMed] Tummler B et al: "Transient correction of the basic defect in sweat glands in an individual with cystic fibrosis carrying the complex CFTR allele F508del-R553Q."

No. Sentence Comment

0 Transient correction of the basic defect in sweat glands in an individual with cystic fibrosis carrying the complex CFTR allele F508del-R553Q B Tu¨mmler,1,2 F Stanke,1 I Bronsveld,3 H Veeze,4 M Ballmann2 1 Klinische Forschergruppe, Medizinische Hochschule Hannover, Hannover, Germany; 2 Abteilung fu¨r Pa¨diatrische Pneumologie und Neonatologie, Medizinische Hochschule Hannover, Hannover, Germany; 3 Department of Pulmonology and Tuberculosis, Universitair Medisch Centrum Utrecht, Utrecht, The Netherlands; 4 Stichting Diabeter, Rotterdam, The Netherlands Correspondence to: Dr B Tu¨mmler, Klinische Forschergruppe, OE 6710, Medizinische Hochschule Hannover, Carl-Neuberg-Str 1, D-30625 Hannover, Germany; tuemmler.burkhard@ mh-hannover.de Received 17 January 2008 Accepted 2 June 2008 ABSTRACT The molecular pathology of mutant F508del CFTR is partially corrected in vitro by the secondary amino acid substitution R553Q in the ABC signature motif. Login to comment
1 An individual with the CFTR genotype R553X/F508del-R553Q showed the typical symptoms and electrophysiological anomalies of cystic fibrosis in the airways and intestine. Login to comment
2 Sweat chloride concentrations were normal early in life, but were later raised into the range that is diagnostic for cystic fibrosis, suggesting that R553Q could temporarily correct the basic defect in sweat glands. Login to comment
3 R553Q caused a delay in diagnosis because of false negative sweat tests but was not a disease reverting suppressor mutation as had been inferred from cellular models. Login to comment
5 Here we report on the 30 year course of a basic defect and disease in an individual with cystic fibrosis (CF) who was compound heterozygous for the cystic fibrosis transmembrane conductance regulator (CFTR) mutations R553X1 and the complex allele F508del-R553Q.2 The amino acid substitution R553Q resides within the ABC signature motif of CFTR.3 R553Q has been shown in heterologous model systems to partially correct the defective processing and anomalous ion channel gating of mutant F508del CFTR.4 Hence R553Q has been classified as a disease reverting suppressor mutation. Login to comment
23 The clinical characteristics of the R553X/F508del-R553Q subject were similar to those of R553X/F508del compound heterozygotes.2 Moreover, even in the sweat gland, the basic defect was corrected only early in life, but faded over the years, indicating that aging mechanisms abolished the rescue by R553Q in the morphologically inconspicuous tissue. Login to comment
24 In summary, R553Q rescued the molecular pathology of F508del CFTR in a cellular model, but it was not a disease reverting suppressor mutation in the affected individual. Login to comment

PMID: 19781595 [PubMed] Bisignano P et al: "Molecular dynamics analysis of the wild type and dF508 mutant structures of the human CFTR-nucleotide binding domain 1."

No. Sentence Comment

20 Structures were obtained by X-ray crystallography, at a resolution of 2.55 Å and 2.30 Å for WT and mutant, respectively. These structures are both characterized by the presence of seven mutations: F409L, F429S, F433L, G550E, R553Q, R555K and H667R which make them more soluble and therefore more easily crystallizable [6,7]. Login to comment
152 The chosen PDB entries,1XMJ and 2BBO, contain seven mutations, F409L, F429S, F433L, G550E, R553Q, R555K and H667R, that were introduced to the NBD1, wild type and dF508 used for this study, to facilitate the crystallization of the polypeptide [6]. Login to comment

PMID: 19944699 [PubMed] Lewis HA et al: "Structure and dynamics of NBD1 from CFTR characterized using crystallography and hydrogen/deuterium exchange mass spectrometry."

No. Sentence Comment

32 Comparing these hNBD1 structures to each other and to wild-type murine NBD1 (mNBD1) suggested that the overall fold of NBD1 was retained in the ΔF508 mutant and that structural changes were localized near the site of the deleted phenylalanine residue.5 However, three of these solubility-enhancing mutations (G550E/ R553Q/R555K) were known to be in vivo suppressors of the trafficking defect caused by the ΔF508 mutation.51-53 Compared to mNBD1, no significant structural perturbations were observed in the vicinity of these suppressor mutation sites in the crystal structures of hNBD1, suggesting that they act indirectly to suppress the effects of the ΔF508 mutation.5 Indeed, folding studies of a wider variety of hNBD1 variants, including several without trafficking-suppressor mutations, indicated that these mutations increase the thermodynamic stability of NBD1,5 which could account for improved folding and maturation in vivo. Login to comment
41 This structure was obtained from the same hNBD1-7a protein construct that yielded the previously reported ΔF508 structure, which has seven solubilizing mutations including the three trafficking-suppressor mutations G550E/R553Q/R555K. Login to comment
133 The structures harboring the G550E/R553Q/ R555K suppressor mutation set are shown in bright green (F508) and bright red (ΔF508). Login to comment
139 This region contains F508, the LSGGQ signature sequence (at residues 548-552), and the G550E/ R553Q/R555K suppressor mutation sites. Login to comment
300 The G550E/R553Q/ R555K mutation set has been demonstrated to suppress the defective trafficking of ΔF508-CFTR (Fig. 11).51-53 Based on detailed structural, dynamic, and thermodynamic considerations presented in section ST12 in the Supplementary Information, we conclude that these suppressor mutations are unlikely to directly reverse a cryptic structural Fig. 9. Login to comment
352 The trafficking-suppressor mutations (G550E/R553Q/R555K) overlap the LSGGQ signature sequence located at residues 548-552 in hNBD1. Login to comment

PMID: 20150177 [PubMed] Atwell S et al: "Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant."

No. Sentence Comment

226 The 389-678(F409L, F429S, F433L, G550E, R553Q, R555K, H667R) (hNBD1-7a) structures are shown without (dark blue) and with the DF508 mutation (light blue) (H. Lewis, in preparation). Login to comment

PMID: 20667826 [PubMed] Thibodeau PH et al: "The cystic fibrosis-causing mutation deltaF508 affects multiple steps in cystic fibrosis transmembrane conductance regulator biogenesis."

No. Sentence Comment

19 A single mutation, R553Q, was first identified in a patient homozygous for the ⌬F508 allele but having only a mild CF phenotype (18). Login to comment
20 Subsequently, in a screen for suppressor mutations of the ⌬F508 defect, the original R553Q suppressor mutation was identified as were I539T, * Thisworkwassupported,inwholeorinpart,byNationalInstitutesofHealth NIDDK Grants 49835 (to P. J. T.) and 75302 (to G. L. L.). Login to comment
34 Printed in the U.S.A. NOVEMBER 12, 2010•VOLUME 285•NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 35825 G550E, R553Q, and R555K (19-21). Login to comment
104 The introduction of the single mutations, G550E, R553M or R553Q, and R555K, has previously been shown to partially rescue the ⌬F508 trafficking defect in CFTR and restore channel activity at the plasma membrane (Fig. 1A) (19-21). Login to comment

PMID: 20687133 [PubMed] Protasevich I et al: "Thermal unfolding studies show the disease causing F508del mutation in CFTR thermodynamically destabilizes nucleotide-binding domain 1."

No. Sentence Comment

44 hNBD1 Nameb Termini / Mutationsc Tm d DTm ¼ Tm D508 - Tm wt ( C) PDB ID 1 hNBD1-D(RI,RE) 2935c46917 387-646[D405-436] 57.7 þ 0.2 2PZE 1 (F508del)hNBD1D (RI,RE) 2935c47217 387-646[D405-436, F508del] 51.5 þ 0.3 À6.2 þ 0.3 2PZF 2 387-646[D405-436, V510D] 60.2 þ 0.4 2 387-646[D405-436, V510D, F508del] 53.0 þ 0.1 À7.2 þ 0.4 3 387-646[D405-436, F494N, Q637R] 59.2 3 387-646[D405-436, F494N, Q637R, F508del] 52.8 À6.4 4 387-646[D405-436, G550E, R553Q, R555K] 61.7 4 387-646[D405-436, G550E, R553Q, R555K,F508del] 55.7 À6.0 5 387-678[D405-436] 58.1 5 387-678[D405-436, F508del] 51.7 À6.2 6 hNBDI-315 2935c38217 389-678[F429S, F494N, Q637R] 49.8 þ 0.3 6 hNBDI-3F508del15 2935c37117 389-678[F429S, F494N, Q637R, F508del] 43.6 þ 0.1 À6.3 þ 0.3 2BBS 7 389-678[F429S, F494N, L636E5, Q637R] 50.5 þ 0.2 7 389-678[F429S, F494N, L636E, Q637R, F508del] 44.9 À6.2 þ 0.2 a DSC conducted at 1 mg/mL protein. Login to comment

PMID: 20687163 [PubMed] Wang C et al: "Integrated biophysical studies implicate partial unfolding of NBD1 of CFTR in the molecular pathogenesis of F508del cystic fibrosis."

No. Sentence Comment

26 Moreover, three second-site mutations, selected by Teem and coworkers to reverse the in vivo trafficking defect caused by F508del,37 appeared to stabilize hNBD1 against chemical unfolding.15 Because this ''Teem suppressor triplet`` (G550E, R553Q, and R555K) does not significantly alter the structure of F508del-hNBD1,18 its effect increasing the thermodynamic stability of hNBD1 seems likely to be responsible for reversing the deleterious effects of the F508del mutation. Login to comment
155 Second-Site Solubilizing/Suppressor Mutations Delay the Initial Unfolding Transition Figure 4 shows the isothermal denaturation behavior of F508del-hNBD1-D(RI,RE) constructs harboring additional point mutations known to suppress the trafficking defect caused by the F508del mutation.32,37,39,40 The G550E, R553Q, and R555K mutations in the Teem suppressor triplet were isolated in vivo using a selection for mutations restoring the export of a yeast CFTR homolog bearing the equivalent of the F508del mutation. Login to comment
179 This research program led to the identification of several point mutations that improve the solubility and yield of purified hNBD1, including the Teem suppressor triplet (G550E, R553Q, and R555K) isolated as suppressors of the in vivo trafficking defect of F508del-CFTR.37 However, surprisingly, the other efficacious solubilizing mutations chosen exclusively on the basis of polarity and consistency with the CFTR sequence profile also generally suppress the defective in vivo trafficking of F508del-CFTR.32,39 This correlation is readily explained if the initial unfolding transition in hNBD1 (left side of Fig. 5) controls both aggregation of the purified domain in vitro and aberrant ER retention and degradation of intact CFTR in vivo. Login to comment

PMID: 20706124 [PubMed] Lucarelli M et al: "A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation."

No. Sentence Comment

105 Both in vivo and in vitro studies have also highlighted cases in which there is one main mutation with the phenotypical effect that is worsened by a second mutation, which may even be a neutral variant when isolated, as occurs for F508C,38 R74W,41 S912L,44 and M470V.42 However, different effects have also been described, as in the case of the two M470 and R1235 variants, which give rise to a hyperactive CFTR when present on different alleles but have a suppressive effect when combined on the same allele.42 In addition, the finding of complex alleles in CFTR-RD seems to suggest that a second CFTR mutation may even lead to a partial reversion of the phenotype.43 Indeed, in a reduced number of complex alleles, the effect of the second mutation may partially correct the functional defect, thereby lessening the phenotypical effect, as has been demonstrated for the R553Q mutation in the [F508del; R553Q] complex allele by in vivo52 and in vitro53 studies and for the R553M mutation in the [F508del; R553M] complex allele by an in vitro study.53 A milder phenotypical effect has also been demonstrated for the [R334W; R1158X]54 and [-102T; S549R(TϾG)]55 complex alleles if compared with alleles carrying, respectively, isolated R1158X or S549R(TϾG). Login to comment

PMID: 21594797 [PubMed] Schmidt A et al: "Biochemical and biophysical approaches to probe CFTR structure."

No. Sentence Comment

29 A single mutation, R553Q, was first identified in a patient, homozygous for the F508del allele, but having only a mild CF phenotype (20, 21). Login to comment
30 Subsequently, in a screen for suppressor mutations of the F508del defect, the original R553Q suppressor mutation was identified as were I539T, G550E, R553Q, and R555K (18, 19). Login to comment

PMID: 7914197 [PubMed] Hoof T et al: "Cystic fibrosis-type mutational analysis in the ATP-binding cassette transporter signature of human P-glycoprotein MDR1."

No. Sentence Comment

176 K536R Deglycosylated form(blot) + ND (+) ND ND & + Mature glycosylated membrane protein (blot) + ND * ND ND + + Membrane protein on cell surface (FACS) + - * (+) ND + + Multidrug resistance and collateral sensitivity + - - - - + + CFTRb Wild-tvpe AF508 S549RG551DAF508-R553Q R553Q Partially glycosylated form + + + + + + Mature fully glycosylatedmembrane protein + ND ND + (+) + Chloride current: SPQ assay + - - - + + Chloride current: electrophysiological recordings + -b. +d,e,f +e.f + + Transfectionin CHO cells (this work). Login to comment
25 Besides the major mutationAF508, a cluster of missense mutations resides in the linker peptide(Fig. 1).AF508, S549R (Keremet al., 1990; Sangiuloet al.,19911,and G551D (Cuttingetal., 1990;Hamosh et al., 1992)were identified in patients withtypical pulmonary andgastrointestinalmanifestations of CFdiseasewhereas R553Q has been foundon the complex allele AF508-R553Qin a Cystic Fibrosis GeneticAnalysis Consortium,personal communication. Login to comment
169 In the CFTR gene from a CF patient with uncommon clinical characteristics we had detected at this codon position the variant R553Q on the AF508 chromosome (Dorket al., 1991).The compound heterozygous patient with the complex AF508-R553Q allele displayed sweat chloride concentrations in the upper normal range, but had typical gastrointestinal andpulmonary features of CF.Hence, we hypothesized that the substitutionof arginine 553 by a glutamine in loop 3 may partly compensate for the omission of phenylalanine 508in loop 2 (Dorket al., 1991).A recent independent studyby Teem et al. (1993) provides strong experimental supportfor this hypothesis. Login to comment

PMID: 15287992 [PubMed] Claustres M et al: "Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations?"

No. Sentence Comment

16 Another exemple is the revertant mutation p.R553Q which, when carried on the same gene as p.F508del, is associated with a CF phenotype with normal chloride concentration in sweat test [6] and which, when expressed in heterologous cells, can partially correct the processing and Cl-channel gating defects caused by the p.F508del mutation [7]. Login to comment

PMID: 15744523 [PubMed] Clain J et al: "A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype."

No. Sentence Comment

12 The combination of two missense mutations on the same chromo some has been described clinically to lessen ([p.R553Q;p.F508del], [p.R334W;p.R1158X]; Dork et al. 1991; Duarte et al. 1996) or worsen ([p.R74W;p.D1270N], [p.R347H;p.D979A]; Casals et al. 1995; Hojo et al. 1998) the phenotype of CF patients with regard to the commonest mutation alone (p.F508del, p.R1158X, p.D1270N, p.R347H). Login to comment

PMID: 9379898 [PubMed] Wemmie JA et al: "Mutational analysis of the Saccharomyces cerevisiae ATP-binding cassette transporter protein Ycf1p."

No. Sentence Comment

133 These mutants corresponded to CFTR alterations known to be associated with cystic fibrosis (G551D and G551S in CFTR, G756D and G756S in Ycf1p) as well as lesions that either disturb normal function (K464M in CFTR, K669M in Ycf1p) or act to suppress the phenotype of ⌬F508 CFTR (R553Q and R553M in CFTR, K758Q and K758M in CFTR). Login to comment
161 The two ⌬F508 suppressor mutations isolated in this study were R553Q and R553M. Login to comment
193 (Paddon et al., 1996) has shown that the R553Q and R553M mutations do not act by correcting a mislocalization defect in the Ste6p-⌬F508 CFTR chimera. Login to comment

PMID: 22265408 [PubMed] Rabeh WM et al: "Correction of both NBD1 energetics and domain interface is required to restore DeltaF508 CFTR folding and function."

No. Sentence Comment

26 Both the R mutations (G550E, R553Q, and R555K) and S mutations (F409L, F429S, F433L, F494N, and H667R) could partially rescue the DF508 CFTR folding and functional defect (Lewis et al., 2005; Pissarra et al., 2008; Teem et al., 1993, 1996) and were assumed to stabilize the domain either alone or in combinations (1S, 3S, R, R1S, and R4S; see Figure 1B). Login to comment

PMID: 18417076 [PubMed] Cheung JC et al: "Molecular basis for the ATPase activity of CFTR."

No. Sentence Comment

107 The construct generated had several mutations to increase solubility of the domain (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of F508. Login to comment

PMID: 18215773 [PubMed] Pissarra LS et al: "Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation."

No. Sentence Comment

23 Some of these mutations represented sequence changes between human CFTR and CFTRs from other species, whereas others (G550E, R553Q, and R555K) had been previously identified as F508del-CFTR revertant mutations (Teem et al., 1996; deCarvalho et al., 2002; Chang et al., 1999). Login to comment
25 Of note, one of these revertants, R553Q, was found in an F508del-homozygous patient with mild CF disease (Do¨ rk et al., 1991). Login to comment

PMID: 18215767 [PubMed] Deber CM et al: "Defining the defect in F508 del CFTR: a soluble problem?"

No. Sentence Comment

18 The first human F508 del-NBD1 structure obtained carried seven additional mutations, three of which (suppressor mutations G550E, R553Q, and R555K) were known to rescue the F508 del-CFTR defect (Chang et al., 1999; DeCarvalho et al., 2002; Teem et al., 1996). Login to comment

PMID: 16798544 [PubMed] Kerem E et al: "Atypical CF and CF related diseases."

No. Sentence Comment

42 One such mutation is the R553Q which when being present together with DF508 mutation on the same CFTR allele, is believed to have an attenuating effect on the clinical presentation of CF.9 Likewise, the 5T allele was shown to affect the disease severity of patients carrying the mutation R117H.10 In patients carrying the R117H mutation when the allele also contained the 5T variant the phenotype was mild CF whereas in patients carrying R117H together with the 7T variant the phenotype was CBAVD only. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

PMID: 9674722 [PubMed] Schwiebert EM et al: "Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein."

No. Sentence Comment

223 They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X). Login to comment

PMID: 10200050 [PubMed] de Meeus A et al: "Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online."

No. Sentence Comment

63 The variability of the phenotypic expression could also be explained in some cases by the presence of an additional mutation in the CFTR gene, as it has been reported for the double mutant DF508-R553Q in which the R553Q mutation compensates the deleterious effect of the DF508 deletion (Dork et al. 1991). Login to comment

PMID: 9511935 [PubMed] Bianchet MA et al: "Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR)."

No. Sentence Comment

360 The CFTR NBD1 model that results (Fig. 6) gathers the disease causing mutations in three different clusters: (1) mutations affecting the nucleotide binding pocket and the putative general base: A455E, G458V, E504Q AI507 AF508 P574H; (2) mutations in motif C which are probably related to an interaction with region D: S549[R,N,I] G551[S,D], R553Q; and (3) mutations within or near motif B, L558S, A559T, R560T, Y563N and mutations S492F and G480C. Login to comment

PMID: 9511928 [PubMed] Seibert FS et al: "Cystic fibrosis: channel, catalytic, and folding properties of the CFTR protein."

No. Sentence Comment

178 (1993) were able to identify two mutations, NBF1-located R553M and R553Q, which when introduced into AF508-CFTR partially restored the function of these chimeras. Login to comment
180 Interestingly,in one patient a combination of the AF508 and the R553Q mutations was found on the same chromosome and this patient showed a mixed phenotype of severe lung and pancreatic disease, but normal sweat chloride (Dork etal, 1991). Login to comment

PMID: 9188468 [PubMed] Qu BH et al: "Localization and suppression of a kinetic defect in cystic fibrosis transmembrane conductance regulator folding."

No. Sentence Comment

16 In a German pancreas-insufficient patient homozygous for ⌬F508 with typical gastrointestinal and pulmonary disease but sweat chloride in the normal range a second site mutation of R553Q was found on one ⌬F508-CFTR allele (15). Login to comment
17 Two mutations at this position, R553M and R553Q, revert the mating phenotype of a ⌬F508 STE6-CFTR chimera in yeast (16). Login to comment

PMID: 9259194 [PubMed] Friedman KJ et al: "Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease."

No. Sentence Comment

20 In the context of CF, the R553Q sequence variant in exon 11 has been demonstrated in vitro partially to ameliorate the phenotype of a ∆F508 homozygote (Teem et al., 1993). Login to comment

PMID: 8830258 [PubMed] Paddon C et al: "Analysis of the localization of STE6/CFTR chimeras in a Saccharomyces cerevisiae model for the cystic fibrosis defect CFTR delta F508."

No. Sentence Comment

166 These revertant mutations (R553 M and R553Q) lie in the CFTR-portion of NBD1 in the chimeric molecule. Login to comment
183 Teem et al. (1993) speculated that loss of F508 may alter the structure of NBD1 in a manner that is partially compensated for by the R553Q or R553 M suppressor mutations which they isolated. Login to comment

PMID: 8844211 [PubMed] Duarte A et al: "Complex cystic fibrosis allele R334W-R1158X results in reduced levels of correctly processed mRNA in a pancreatic sufficient patient."

No. Sentence Comment

37 The first published complex allele in the CFTR gene (Dork et al., 1991) consisted of an alteration (R553Q) that partially reverted the phenotypic effects of the AF508 mutation (Teem et al., 1993).The sameseems to apply to the AF508- V1212I allele (Macek et al., 1993). Login to comment

PMID: 8528204 [PubMed] Savov A et al: "Double mutant alleles: are they rare?"

No. Sentence Comment

50 An additional nucleotide substitution, R553Q, has been shown to result in lower sweat electrolyte values in a patient homozygous for AF5O8 (4) and a combination of a neutral amino acid polymorphism (F508C) with another missense mutation (SI25IN) has been found to result in cystic fibrosis (5). Login to comment

PMID: 7529962 [PubMed] Mercier B et al: "Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients."

No. Sentence Comment

119 Dork and coworkers (1991) identified an individual bearing both the AF508 and R553Q mutations on the same allele. Login to comment

PMID: 8825494 [PubMed] Zielenski J et al: "Cystic fibrosis: genotypic and phenotypic variations."

No. Sentence Comment

586 The fIrst example is R553Q, which is found on an allele carrying . Login to comment
593 Not surprisingly, Rl17H is associated with CF only when the allele also contains Table 2 Examples of complex alleles in the CfTR gene Principal Second site mutationa Location alteration Location Reference R75X exon 3 125G --.. C promoter 57 405 + IG --.. A intron 3 3030G --.. A exon 15 57 R1l7H exon 4 129G --.. C promoter 203 RI17H exon 4 IVS8 : 5T or 7T intron 8 101 R297Q exon 7 IVS8 : 5T or 7T intron 8 60 aF508 exon 10 R553Q exon II 59 aF508 exon 10 1I027T exon I7a 57 8F508 exon 10 deletion of D7S8 500 kb 3' of 186 CfTR S549N exon II R75Q exon 3 205a L619S exon 13 1716G � A exon 10 57 G628R (G � C) exon 13 SI235R exon 19 47 2184insA exon 13 IVS:5T exon 9 J Zielenski, J Bal, 0 Markiewicz, L-C Tsui, unpublished data A800G exon 13 IVS8 : 5T or 7T intran 8 31 S912L exon 15 GI244V exon 20 149 GlO69R exon 17b L88X exon 3 149 3732deiA exon 19 Kl200E exon 19 70 3849 + IOkbC � intron 19 R668C exon 13 57 T SI251N exon 20 F508C exon 10 94 The status of principal mutation may not be clear in every case; e.g. G628R(G --> C) vs S1235R. Login to comment

PMID: 7526685 [PubMed] Morral N et al: "Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene."

No. Sentence Comment

108 )-.T R347L Audrezet et al. 1993 G--S-C R347P Dean et al. 1990 1789 ......... C--.G R553G C. Ferec, personal communication CI-T R553X Cutting et al. 1990 1790 ......... G---A R553Q Dork et al.1991a 3328 ......... C-OT R1066C Fanen et al. 1992 3329 ......... G-.A R1066H Ferec et al. 1992 GT R1066L Mercier et al. 1993 3340 ......... CT R1070W M. Macek, Jr., unpublished data 3341 ......... G-A R1070Q Mercier et al. 1993 a This change is a polymorphism, not a disease mutation. Login to comment

PMID: 7525450 [PubMed] Dork T et al: "Detection of more than 50 different CFTR mutations in a large group of German cystic fibrosis patients."

No. Sentence Comment

120 There are, however, only six additional CFTR mutations with a frequency of approximately 1% or more of the CF chromosomes; two nonsense mutations, G542X and R553X, and the missense mutations G551D and NI303K were predominantly seen in severely affected patients, whereas the transmembrane missense mutation R347P and the splice mutation 3849 + 10 kB C---~T Table 2 Rare sequence variants in the CFTR promoter and coding region Sequence variant Nucleotide change Location Frequency Associated mutatiow' Reference 125 G--+C G--~C at 125 Promoter 1 (0.1%) R75X F508C T--~G at 1655 Exon 10 2 (0.3%) S1251N 1716 G---)A G---~Aat 1716 Exon 10 1 (0.1%) L619S R553Q G-~A at 1790 Exon I 1 I (0.1%) * R668C C--~T at 2134 Exon 13 1 (0.1%) 3849+10 kB C--eT 3030 G---~A G--+A at 3030 Exon 15 1 (0.1%) 405+1 G--~A I1027 T T--~C at 3212 Exon 17a 2 (0.3%) * 3417 A-+T A--->Tat 3417 Exon 17b 1 (0.1%) Unknown 4002 A--eG A--~G at 4002 Exon 20 2 (0.3%) Unknown Cutting et al. (1992) Kobayashi et al. (1990) Kerem et al. (1990) D6rk et al. ( 1991) Fanen et al. (1992) Chillon et al. (1992) Fanen et al. (1992) This study Ferec et al. (1992) ~'Marked (*) sequence variations were present on AF508 chromosomes were the most frequent in pancreas-sufficient patients. Login to comment

PMID: 7522998 [PubMed] Tsongalis GJ et al: "Association of pancreatic adenocarcinoma, mild lung disease, and delta F508 mutation in a cystic fibrosis patient."

No. Sentence Comment

87 Furthermore, evidence indicates that a sequence variation in exon 11, R553Q, can serve to partially alleviate the deleterious effects of a LiF508 allele (19, 20). Login to comment

PMID: 7521710 [PubMed] Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."

No. Sentence Comment

46 cd,e,f.gformatjon of heteroduplexes in DNA samples containing the following mutations increases the sensitivity to 100%: 1833delT; E827X; Q1291R; G551D, R553X, R553Q; I1234V, 3850-3T-G; respectively. Login to comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

PMID: 7686820 [PubMed] Welsh MJ et al: "Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis."

No. Sentence Comment

89 In a study identifying second-site revertants of the AF508 mutation using STEG-CFTR chimeras in yeast, R553M and, to a lesser extent, R553Q partially reversed the localization and functional effects of the AF508 mutation (Teem et al., 1993). Login to comment

PMID: 7682896 [PubMed] Teem JL et al: "Identification of revertants for the cystic fibrosis delta F508 mutation using STE6-CFTR chimeras in yeast."

No. Sentence Comment

4 We isolated two AF508 revertant mutations (R553M and R553Q) that restored mating; both were located within the CFTR NBDl sequence. Login to comment
92 It is possible that other mutations within the R553-L558 region of the H5-AF508 plasmid could also result in increased mating efficiency; however, we proceeded to analyze the R553Q and R553M mutants in greater detail without further mutagenesis of the R553-L558 region. Login to comment
94 Whereas the mating efficiency of the H5-AF508 yeast strain is approximately lo/a of the H5 strain, yeast containing the H5-AF508/R553Q and H5-AF508/R553M plasmids mated at 3% and 3204 respec- 330 tively. Login to comment
96 However, when the mutations R553Q and R553M press the AF508 mating defect. Login to comment
97 The R553M mutation were introduced into CFTRAF508 (CFTRAF508/R553Q alone had little effect on H5 (H5R553M); when this mutant and CFTRAF508/R553M, respectively), CAMP-dependent was transformed into yeast, no further increase in mating anion permeability was restored. Login to comment
101 The R553Q and R553M mutations partially correct the defect in the H5-AF508 chimera and should also correct the defect in CFTRAF508 if a similar structure exists for NBDl in both proteins. Login to comment
102 As a test of this hypothesis, we introduced the R553Q and R553M mutations into CFTRAF508 cDNA and transfected mammalian cells with these constructs to determine whether the revertant mutations would correct the defect in CAMP-regulated Cl- transport of CFTRAF508. Login to comment
105 First, the initial rate of halide efflux after CAMP stimulation was less for CFTRAF508IR553M and CFTRAF508/R553Q than for wild-type CFTR (Figure 3). Login to comment
108 Thus, CAMP-stimulated halide efflux from the CFTRAF5081 R553Q- and CFTRAF508/R553Mtransfected cells was less efficient than that in cells transfected with wild-type CFTR.ThisobservationsuggeststhattheAF508CI-channel defect was only partially reversed by the reversion mutations. Login to comment
109 R553Q and R553M Suppress the CFTRAF508 Anion Transport Defect We assessed the effect of the R553Q and R553M mutations on CFTR function by assaying for CAMP-stimulated halide efflux using the halide-sensitive fluorophore 8-methoxy-N-(3sulfopropyl)-quinolinium (SPQ) (Illsley and Verkman, 1987). Login to comment
110 Expression of CFTR cDNA containing either the R553Q or the R553M mutation alone (without the AF508 mutation) in HeLa cells generated CAMP-stimulated halide efflux like wild-type CFTR (Figure 3). Login to comment
112 Relative Mating Efficiency of AF5OS Revertants Genotype H5R553M H5-AF508/R553M H&AF508/R553Q HSAF508 Mating Efficiency Relative to H5 (%) 77.4 f 3.7 34.2 f 7.0 3.2 i 0.8 1.1 f 0.5 Mating efficiencies were determined by quantitative mating assays and are expressed as a percentage relative to H5 (100%). Login to comment
118 Correction of CFTRAF508 Processing and Localization Cl- transport by CFTRAF508 containing the R553Q and R553M mutations would be detected only if the processing defect of CFTRAF508 was suppressed. Login to comment
122 CFTRAF508 is only present as the unglycosylated band A and the core glycosyl- 6000 -CFTR - AF508/R553M -c- R553M + AF508lR553Q I R553Q ,+ AF508 0 0 2 4 6 6 10 12 TIME (MIN) ated band B protein, consistent with its failure to traverse the Golgi complex and reach the plasma membrane (Cheng et al., 1990) (Figure 4). Login to comment
124 Analysis of Processed Forms of CFTR (A) Expression of wild-type CFTR (lane I), CFlWR553M (lane 2) CFTR/R553Q (lane 3) and CFTRAF508 (lane 4) in HeLa cells. Login to comment
140 R553Q and R553M mutations alone (without the AF508 mutation). Login to comment
141 As shown in Figure 4A, band C is present in cells expressing wild-type CFTR (lane 1) and also mutant CFTR containing either the R553Q or R553M mutation (lanes 2 and 3). Login to comment
146 We were not able to consistently detect band C CFTR in cells expressing CFTRAF508/R553Q, possibly owing to limitation8 in the sensitivity of the assay. Login to comment
154 For CFTRAF508/R553Q, plasma membrane staining of CFTR was weak and variable and could not be demonstrated consistently (Figure 5D). Login to comment
160 form and suggest that the amount of CFTRAF508/R553Q Single-Channel Analysis of at the plasma membrane is exceedingly low. Login to comment
161 Thus, these CFTRAF508/R553Q CFTR data indicate that only the CFTRAF508/R553M mutant is To determine whether the suppressor mutations altered detectable in the plasma membrane at levels greater than the single-channel properties of CFTRAF508, the re- that observed for CFTRAF508. Login to comment
162 vertant mutant CFTRAF508/R553Q was expressed in A R553Q c AF508/R553Q Y---M W---I w---m m--k w----m m-----v w---w 60mV 4OmV 20mV OmV -20 mV -40 mV -60 mV -60 mV -100 mV -120 mV 1P d 1 .4ms Figure 6. Login to comment
174 We chose the R553Q mutant because, as discussed below, it has been observed in a CF patient. Login to comment
185 The results also indicate that, as predicted by the functional analysis of CFTRAF508/R553Q by the SPQ halide efflux assay above, at least some CFTRAF508/R5530 is localized in the plasma membrane. Login to comment
186 Following activation with PKA and ATP, we measured the P, for CFfRIR553Q and CFTRAF508/R553Q at different MgATP concentrations. Login to comment
187 Figures 7A and 78 show examples of the activity of single channels at different concentrations of MgATP; as the concentration of MgATP increased, both CFTRIR553Q and CFTRAF508/R553Q spent more time in the open state. Login to comment
188 Figure 7C shows that the P, of CFTRIR553Q Cl- channels was similar to that previously reported for wild-type CFTR Cl- channels (An- Cdl A R553Q B AF508/R553Q Figure 7. Login to comment
193 A single CFTWR553Q Cl-channel (A) and a single CFTFtAF506/R553Q Cl-channel (6) are shown at different MgATP concentrations. Login to comment
198 Thus, the R553Q mutation corrected the functional defect in gating of the CFTRAF508 Cl- channels. Login to comment
208 Although the R553Q revertant was less eff icient at correcting processing of CFTRAF508 as measured by the amount of fully processed CFTR present and by immunocytochemistry, it produced functional channels as measured by the SPQ halide efflux assay. Login to comment
209 In addition, R553Q corrected the altered gating of CFTRAF508. Login to comment
213 We speculate that the R553Q mutation must change the conformation of the CFTRAF5081 R553Q protein sufficiently to revert gating to normal and that both CFTRAF508lR553Q and CFTRAF508lR553M must adopt a conformation that allows at least some of the mutant protein to escape the cellular quality control mechanisms. Login to comment
215 The CFTRAF508 revertant mutations R553Q and R553M were initially identified as revertants of the mating defect in yeast containing the H5-AF508 chimera, suggesting that the structure of NBDl in the chimera (and the effect of CF mutations on NBDl structure) resembles that of CFTR. Login to comment
223 Because wild-type phenotypes were observed with R553Q and R553M mutations alone, these mutations may be compensatory mutations that cause no detectable phenotype themselves. Login to comment
235 Interestingly, a CF patient with both the AF508 and R553Q mutations on the same chromosome has been described (Dork et al., 1991). Login to comment
239 It is interesting to speculate that the R553Q mutation may partially suppress the AF508 Cl- transport defect in the sweat gland in this patient, but is unable to suppress the defect in other affected tissues, such as the lung and pancreas, sufficiently to prevent clinical disease. Login to comment
240 Although the R553Q mutation corrected the defect in the P, of CFTRAF508, it was less effective than R553M in correcting the processing defect of CFTRAF508. Login to comment
241 Thus, the in vivo effect of the R553Q mutation on processing and function of CFTRAF508 might be quite small. Login to comment
242 However, a combination of restored CFTRAF508 channel function and improved processing might be sufficient to allow some of the CFTRAF508/R553Q mutant protein to reach the plasma membrane, where it could mediate Cl- transport in the duct of the sweat gland. Login to comment
243 In this regard, one might predict that the R553M mutation (or the AF508/R553Q on both chromosomes) might have a greater effect in suppressing the AF508 Cl- transport defect in the sweat gland and other organs. Login to comment
275 Two such colonies were identified (which contained the R553Q and R553M mutations), plasmid DNA was isolated from each, and the DNA sequence of the NED1 region was determined. Login to comment
284 To express CFTR in HeLa cells transiently, cells were infected with recombinant vaccinia virus (vTF7-3) to express the T7 bacteriophage RNA polymerase and then transfected with plasmid DNA containing either wild-type CFTR (pTM-CFTR-4) or CFTR mutants (pTMCFTRAF508, pTMCFTRAF508/R553Q, pTMCFTRAF508/R553M, pTMCFTR/R553Q, and pTMCFTWR553M) under the control of the T7 promoter, essentially as described in Rich et al. (1990). Login to comment

PMID: 1279852 [PubMed] Tsui LC et al: "The spectrum of cystic fibrosis mutations."

No. Sentence Comment

123 8 NO. 11 m []~EVIEWS G551D R553Q G551S I L558S aI~7 S5491 I I 1&559T A455F E5040 I&F508 V520F SS49NII IIR560T PS74H I G458V G480C $492F /" • ss,9 II III* oa. / III / NBF1 ~t ~t NBF2 I I I I I III I I I 11234V G1244E IS1255P D1270N II I Q1291H N1303K G1349D S1251N W1282R] F1286S N1303H Q1283M, FIG[] Cystic fibrosis (missense) mutations located within the two presumptive ATP-binding domains (NBF1 and NBF2) of CFTR. Login to comment

PMID: 1281032 [PubMed] Super M et al: "Milestones in cystic fibrosis."

No. Sentence Comment

166 Interestingly the mutation R553Q, associated with Delta F508 downstream resulted in an apparently milder phenotype than usual (Tummler, personal communication). Login to comment

PMID: 1715308 [PubMed] Dork T et al: "Cystic fibrosis with three mutations in the cystic fibrosis transmembrane conductance regulator gene."

No. Sentence Comment

2 The R553Q mutation was found on the maternal AF508-CFTR gene. Login to comment
4 Other members of this protein superfamily contain a glutamine instead of arginine at the homologous position, suggesting a modulating rather than disease-causing role of the R553Q mutation in CFTR. Login to comment
5 The amplification refractory mutation system did not detect the R553Q mutation in a further 65 normal, 113 AF508, and 91 non-AF508 CF chromosomes. Login to comment
9 The association of the genotype of the CFTR mutation and the clinical phenotype was assessed for the patients carrying the related genotypes AF508/AF508 (n = 80), AF508/R553X (n = 9) and AF508-R553Q/R553X (n = 1). Login to comment
32 The R553Q mutation was detected by the amplification refractory mutation system (ARMS) (Newton et al. 1989) using the flanking intron primer 11i-5 as the common primer, and the primer sequences 5'- CACCTTGCTAAAGAAATTCTTCCTC-3' for the normal allele and 5'-CACCTTGCTAAAGAAATI'CTTCCTC-3'for the R553Q allele (35 cycles of PCR, 30 s at 62~ 45 s at 72~ 90 s at 91~ 214-bp product). Login to comment
34 The presence of the R553X and R553Q mutations was verified by direct genomic sequencing of the PCR product (Gyllenstein and Erlich 1988). Login to comment
50 The R553Q mutation In one patient who was harboring the R553X mutation, another nucleotide change was detected at the same codon of CFTR (Fig. 1). Login to comment
51 Guanine 1790 was substituted by an adenine, changing arginine 553 to a glutamine (R553Q). Login to comment
52 Sequence analysis of the parental samples revealed that the R553Q mutation was present on the maternal AF508 CF chromosome, whereas the paternal chromosome carried the R553X mutation. Login to comment
53 Hence, the patient with the AF508-R553Q/R553X mutations is the first known CF patient to have inherited three sequence alterations compared with the wild-type CFTR sequence. Login to comment
54 The AF508-R553Q allele was found to carry the haplotype 1-1-2-1-2-2-1-1-1-2 for the polymorphic marker loci " J3.11 (MspI)-J3.11 (TaqI)-GATT-J44-D9-KM19-XV2c- metH (MspI)-metH (TaqI)-metD (TaqI). Login to comment
55 The location of Gln553 on this typical AF508-1inked haplotype sugA A C G Contro[ R553X R553X/R553Q _,,,,i-- 1789C-T w, 790 G-A Fig. 1. Login to comment
57 ARMS analysisof the inheritanceof the R553Q mutation in a CF family. Login to comment
61 ARMS-M mutant product;ARMS-N normalproduct gests the origin of the R553Q mutation to be a AF508-CFTR gene. Login to comment
62 In order to test this hypothesis, our panel of N and CF chromosomes was screened for the presence of the R553Q mutation. Login to comment
63 Since R553Q is nested in a duster of other CF mutations, such as G551D and R553X (Cutting et al. 1990), ARMS (Newton et al. 1989) was applied for the specific detection of the R553Q mutation (Fig. 2). Login to comment
64 Using allele-specific primers and the 11i-5 downstream flanking intron primer for amplification of genomic DNA by PCR, the R553Q mutation was not detected on a further 65 normal, 113 AF508 CF and 91 non-AF508 CF chromosomes. Login to comment
65 Hence, the substitution of arginine 553 by glutamine is an infrequent sequence alteration in CFTR. Login to comment
78 The index case of genotype AF508-R553Q/R553X displays an unusual combination of almost normal sweat test values and severe clinical disease. Login to comment
80 In order to assess the severity of CF disease in quantitative terms, the clinical features of the index case AF508-R553Q/R553X were compared with those of patients who carry the related genotypes of CFTR mutations, AF508/AF508 or AF508/ R553X (Table 1). Login to comment
91 The comparison of the three genotypes suggests that the nonsense mutation R553X rather than AF508 or AF508-R553Q is associated with retardation of growth and development in the compound heterozygotes. Login to comment
95 Anthropometricdata and score refer to the patients' last visit to the CF Clinic (3/90-9/90) AF508/AF508 AF508/R553X AF508-R553Q/R553X Median Range (n = 80) Median Range (n = 9) (singlecase) Age 14.1 2.8-31.5 13.9 7.2-18.1 12.0 Age at diagnosis (years) 0.5 0 - 4.6 0.8 0.13.8 6.9 Sweat test (mmol chloride/I)a 109 78-160 86 80-109 63 Height percentile 48 199 14 740 10 Weight percentile 29 197 8 228 15 Chrispin Norman score of chest X-ray 9 032 11 520 9 Lung function parametersb FEV1 (% predicted) 73 18-114 (n = 65) 64 44-102 75 VC (% predicted) 84 33-118 (n = 65) 78 57-102 85 a Mean value of at least three independent pilocarpine iontophoresis sweat tests b Average values of the forced expiratoryvolume in 1 s (FEV1) and of the forced vital capacity (VC) of the last five pulmonary function tests excluding episodes of airway infections (Rich et al. 1990; Drumm et al. 1990). Login to comment
101 The disease-causing mutations in CFTR are obligatorily associated with the defect in chloride transport; hence, the almost normal sweat chloride concentration in this patient suggests that the substitution of arginine 553 by glutamine neither is a neutral polymorphism nor does it cause disease, but rather it modulates the function and/or processing of the AF508-CFTR gene product. Login to comment
111 The R553Q mutation that we have discovered in our CF patient with borderline sweat tests abolishes this charge and slightly decreases the polarity of the predicted loop 3. Login to comment
119 Hence, if both loops provide essential contacts for promoting channel-mediated chloride transport, it is reasonable to assume that the substitution of arginine 553 by glutamine may partly compensate for the deleterious effect of the omission of phenylalanine 508 of CFTR with respect to anion permeability of the apical membrane of epithelia. Login to comment

PMID: 23800412 [PubMed] Saranko H et al: "Effects of the gout-causing Q141K polymorphism and a CFTR DeltaF508 mimicking mutation on the processing and stability of the ABCG2 protein."

No. Sentence Comment

113 Therefore all these three mutations were introduced into the corresponding regions of the ABCG2 DF142 construct (3R: G188E, R191Q, and R193K). Login to comment

PMID: 14569807 [PubMed] Wang L et al: "Laboratory tests for the diagnosis of cystic fibrosis."

No. Sentence Comment

67 For example, the complex allele R553Q-delta F508 has been shown to revert partially or ameliorate the phenotype of delta F508 mutation.15 Other revertants (delta F508-V1212I and R334W-R1158X) associated with mild or atypical CF have also been described.16,17 Nasal Potential-Difference Measurements This is a functional test for the CFTR gene product. Login to comment

PMID: 14596935 [PubMed] Owsianik G et al: "Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells."

No. Sentence Comment

153 The fact that second-site mutations in NBD1 of vF508-CFTR partially correct processing and functional defects of this mutant channel strongly supports this latter hypothesis (note that R553Q and R553M mutations correspond to the arginine in the RAR motif) [16^18]. Login to comment

PMID: 16712779 [PubMed] Tummler B et al: "Rescue of F508del CFTR: Commentary on "F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive"."

No. Sentence Comment

23 doi:10.1016/j.bbamem.2006.03.033 Hegedus' finding also provides a clue why second-site mutations in the RXR motif in the dodecapetide of NBF1 such as R553Q, R553M and R555K partially corrected the F508del CFTR mutant phenotype in model systems [16] and in CF patients [17]. Login to comment
25 CFTR mutation analysis uncovered the mutation R553Q on one F508del CF chromosome of this patient. Login to comment

PMID: 22265409 [PubMed] Mendoza JL et al: "Requirements for efficient correction of DeltaF508 CFTR revealed by analyses of evolved sequences."

No. Sentence Comment

16 A patient with a less severe form of CF had DF508-R553Q on one allele and a nonsense mutation on the other (Do &#a8; rk et al., 1991). Login to comment
17 A mating screen in yeast utilizing a CFTR-Ste6 chimera identified the same R553Q mutation as a suppressor of the loss-of-mating DF508 phenotype (Teem et al., 1993). Login to comment

PMID: 23055971 [PubMed] Molinski S et al: "Functional Rescue of F508del-CFTR Using Small Molecule Correctors."

No. Sentence Comment

34 The first stabilizing mutations were identified in the ABC conserved, canonical subdomains, and cluster in the b1;-helical subdomain (G550R, R553Q, R555K), in the b3; switch (F494N), and ATP binding core subdomain (Q637R). Login to comment
59 Similarly, the second site mutations, previously discussed with regard to their efficacy in stabilizing the isolated F508del-NBD1, i.e., the second site mutations in the ABC conserved core ATP binding subdomains (G550E, R553Q, and R555K) also promote improved processing of the full-length F508del-CFTR. Login to comment

PMID: 23248597 [PubMed] Kim SJ et al: "Mechanisms of CFTR Folding at the Endoplasmic Reticulum."

No. Sentence Comment

122 Mutations that increase NBD1 solubility and/or thermodynamic stability (I539T, G550E, R553Q, and others; Teem et al., 1993; DeCarvalho et al., 2002; Roxo-Rosa et al., 2006; Pissarra et al., 2008; Hoelen et al., 2010) and/or decrease backbone flexibility (Aleksandrov et al., 2012) can enhance both NBD1 folding yield in cells and trafficking efficiency of full length WT as well as ࢞F508 CFTR (Figure 3B). Login to comment

PMID: 23378596 [PubMed] Hunt JF et al: "Cystic fibrosis transmembrane conductance regulator (ABCC7) structure."

No. Sentence Comment

163 One such set, called the Teem set, comprised three point mutations (G550E/ R553Q/R555K) that previously were shown to promote improved biogenesis of F508del CFTR in tissue cultures cells, presumably by improving the stability of the protein (Teem et al. 1993; DeCarvalho et al. 2002). Login to comment
236 Note that the structures shown here contain seven point mutations included in hNBD1 constructs because of their beneficial influence on yield during purification-F409L, F429S, F433L, G550E, R553Q, R555K, and H667R. Login to comment
275 A series of second-site mutations in NBD1 have parallel effects in rescuing the trafficking defect in CFTR in vivo (DeCarvalho et al. 2002; Pissarra et al. 2008; Aleksandrov et al. 2010) and inhibiting molten globule formation by isolated NBD1 in vitro (G550E/R553Q/R555K, F494N/Q637R, or V510D) (Protasevich et al. 2010; Wang et al. 2010). Login to comment

PMID: 23457292 [PubMed] Chong PA et al: "Dynamics intrinsic to cystic fibrosis transmembrane conductance regulator function and stability."

No. Sentence Comment

200 Many of the suppressor mutations, like G550E, R553Q, and R555K (Teem et al. 1993, 1996), which are relatively distant from the F508 position, increase NBD1 thermal stability and reverse some of the processing and functional defects, presumably without reverting the surface changes caused by deletion of F508. Login to comment

PMID: 23865422 [PubMed] Loo TW et al: "Bithiazole correctors rescue CFTR mutants by two different mechanisms."

No. Sentence Comment

24 It should be noted, however, that the ƊNBD2 CFTR used in this study was different from that used by Okiyoneda et al.18 The ƊNBD2 CFTR constructs in our study did not contain the G550E, R553Q, R555K, and F494N mutations or the three hemagglutinin tags in the fourth extracellular loop that could influence CFTR corrector interactions. Login to comment

PMID: 24513531 [PubMed] Moran O et al: "On the structural organization of the intracellular domains of CFTR."

No. Sentence Comment

1241 However, as the native preparation of NBD1 and NBD2 tend to precipitate at relatively low concentration (>2.5 mg/ml; Galeno et al., 2011; Galfr&#e8; et al., 2012), to obtain protein concentrations compatible with the crystallization conditions, three to seven revertant mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R, Roxo-Rosa et al., 2006; F429S, F494N, Q637R, Pissarra et al., 2008) have been introduced into the NBD1. Login to comment

PMID: 24949105 [PubMed] Cebotaru L et al: "Complement yourself: Transcomplementation rescues partially folded mutant proteins."

No. Sentence Comment

77 Using a mutagenesis approach, they were able to isolate two mutants, R553M and R553Q, which in combination with ƊF508 restored mating. Login to comment

PMID: 25083918 [PubMed] He L et al: "Restoration of NBD1 thermal stability is necessary and sufficient to correct F508 CFTR folding and assembly."

No. Sentence Comment

66 S492P/I539T; 5-G550E/R553Q/R555K; 6-combo. Login to comment
74 (*) In full-length CFTR, R553M was introduced instead of R553Q in isolated NBD1. Login to comment
75 Based on our single mutation analysis, the Tm difference between G550E/R553Q/R555K and G550E/R553M/R555K is less than 1 &#b0;C. Fig. 3. Login to comment

PMID: 26149808 [PubMed] Chong PA et al: "Deletion of Phenylalanine 508 in the First Nucleotide-binding Domain of the Cystic Fibrosis Transmembrane Conductance Regulator Increases Conformational Exchange and Inhibits Dimerization."

No. Sentence Comment

38 Evidence that NBD1 destabilization is problematic for proper processing was provided by NBD1-thermostabilizing mutations distant from the F508del site, including G550E, R553Q, R555K, and deletion of the RI. Login to comment