ABCMdb

ABCC7 p.Arg117Leu

None has been submitted yet.

Publications

PMID: 10376575 [PubMed] Mak V et al: "Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia."

No. Sentence Comment

45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected. Login to comment
50 Of the 8 additional CFTR gene sequence alterations detected using extensive CFTR exon screening, 5 have been described rarely in the CF population (L206W [identified in 2 subjects], P67L, 1677delTA, R117L, and 4016insT).60 One mutation, D979A, was previously identified in a Vietnamese CBAVD patient.60 Interestingly, our CBAVD subject with D979A (also a carrier of IVS8-5T) was of Vietnamese descent as well. Login to comment
58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency. Login to comment
83 These severe CFTR gene mutations are associated with pancreatic insufficiency and are generally class 1 through 3 mutations: ⌬F508, W1282X, N1303K, S549R, 1677delTA, R117L, 4016insT, G544S, 2423delG, V754M, and 741T→G. Login to comment

PMID: 10970190 [PubMed] Boyne J et al: "Many deltaF508 heterozygote neonates with transient hypertrypsinaemia have a second, mild CFTR mutation."

No. Sentence Comment

538 These have been reported in patients with presenting phenotypes ranging from "cystic fibrosis" to oligospermia, but there have been too few cases Table 2 Compound heterozygotes detected Domain and mutation type Genotype Exon 1st IRT 2nd IRT Transmembrane, missense F508/P67L 3 129 34* F508/R117H 4 110 21* F508/R117H 4 84 34 F508/R117H 4 95 39 F508/R117H 4 104 40 F508/R117H 4 146 41 F508/R117H 4 104 48* F508/R117H 4 120 53 F508/R117H 4 111 54 F508/R117H 4 175 72* F508/R117L 4 129 70 F508/L967S 15 122 15 F508/F1052V 17b 189 29 F508/R1066H 17b 94 18 Transmembrane, nonsense F508/R75X 3 86 26 F508/R75X 3 171 27 F508/R851X 14a 112 76 Regulatory, missense F508/F693L 13 109 29 Alternate splice site F508/3849+10KB C→T i19 99 26* F508/3849+10KB C→T i19 112 36* None of these samples had the IVS8-5T variant sequence. Login to comment

PMID: 11157821 [PubMed] McCallum T et al: "Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations."

No. Sentence Comment

61 ThereW1282X; ∆F508; R553X; N1303K; 3849ϩ10 kb C-T; R117L; I506; R553G; R560K; 1811ϩ1G-C; 1774delCT; S549R; S549I; R1283K; were no significant correlations with ethnic origin. Login to comment

PMID: 11278813 [PubMed] Hammerle MM et al: "Disease-associated mutations in the extracytoplasmic loops of cystic fibrosis transmembrane conductance regulator do not impede biosynthetic processing but impair chloride channel stability."

No. Sentence Comment

75 TABLE I Oligonucleotide primers used to generate mutations Mutation Primer S108F GGAAGAATCATAGCTTtCTATGACCCGGATAAC Y109C AGAATCATAGCTTCCTgTGACCCGGATAACAAG D110H ATCATAGCTTCCTATcACCCGGATAACAAGGAG P111A ATAGCTTCCTATGACgCGGATAACAAGGAGGAA P111L ATAGCTTCCTATGACCtGGATAACAAGGAGGAA E116K CCGGATAACAAGGAGaAACGCTCTATCGCGATT R117C GATAACAAGGAGGAAtGCTCTATCGCGATTTAT R117H GATAACAAGGAGGAACaCTCTATCGCGATTTAT R117L GATAACAAGGAGGAACtCTCTATCGCGATTTAT R117P GATAACAAGGAGGAACcCTCTATCGCGATTTAT E217G ATGGGGCTAATCTGGGgGTTGTTACAGGCGTCT T908N TATGCAGTGATTATCAaCAGCACCAGTTCGTAT P1013L GTCGCAGTTTTACAACtCTACATCTTTGTTGCA FIG. 2. Login to comment
119 C, squares, R117C; circles, R117H; triangles, R117L; diamonds, R117P. Login to comment
142 Both R117C and R117L had very unstable open states like S108F and E116K with the cysteine substitution able to maintain openings FIG. 4. Login to comment
171 For example a nucleotide binding domain mutation, G551D, precludes virtually all TABLE II Relative charge transport capacity of mutants Mutants S108F Y109C D110H P111L P111A E116K R117H R117C R117L R117P E217G T908N P1013L Imutant/Iwt 100% 11 15 27 173 105 12 80 27 5 11 10 48 170 FIG. 5. Login to comment

PMID: 11883825 [PubMed] Padoan R et al: "Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis."

No. Sentence Comment

40 Mutation Frequency (%) DelF508 54 N1303K 8 G542X 6.25 1717-1G ® A 2.50 R334W 1.75 2183AA ® G 1.50 R117H, L1077P, W1282X 1.25 D110E, R347P, E585X, 2789 ‡ 5G ® A 0.75 R352Q, R553X, R1066H, D1152H, R1158X, 1782delA, 1898 ‡ 1G ® A, 3659delC 0.50 G85E, R117L, G178R, D579G, H609R, Y1032C, V1153E, R1162X, 621 ‡ 1G ® T, 711 ‡ 1G ® T, 1845delAG o 1846delGA, 2143delT 0.25 Table2.Differencesinthethreestrategiesofneonatalscreening(audit1990-1999). Login to comment

PMID: 12014388 [PubMed] Padoan R et al: "Negative sweat test in hypertrypsinaemic infants with cystic fibrosis carrying rare CFTR mutations."

No. Sentence Comment

8 Molecular analysis identified the following genotypes: F508del/A309D, F508del/3849+ 10kbCfiT, F508del/R117H (in two patients), R117H/ L997F, and F508del/R117L. Login to comment
35 A subsequent expanded analysis of the CFTR gene, by means of DGGE analysis and sequencing, was performed on the remaining three chromosomes and identified the following CFTR alterations: R117L, L997F, and A309D. Login to comment
42 Table 1 Diagnostic features of patients Patient number Sex First IRT (ng/ml) (cut-off) Second IRT (ng/ml) (cut-off) Sweat test chloride (mmol/l) Age at sweat test Age at re-evaluation Symptoms Repeat sweat test chloride (mmol/l) Genotype 1 M 47 (40) 39 (30) 43 4 months 3 years and 3 months Chronic respiratory 64 DF508/A309D 2 M 174 (55) 112 (40) <60 4 months 6 years and 6 months Severe nasal polyposis 68 DF508/3849+ 10kbCfiT 3 F 56 (55) 64 (40) 34 4 months 5 years and 4 months Recurrent upper airways infections 55 DF508/R117H-7T 4 F 84 (80) 102 (40) 55 4 months 4 years No symptoms Not determined R117H-5T/L997F 5 F 142 (80) 81 (40) 37 3 months 20 months Recurrent upper airways infections 47 DF508/R117H-7T 6 F 90 (80) 55 (40) 36 2 months 18 months No symptoms 49 DF508/R117L Discussion Our retrospective evaluation of patients diagnosed beyond 1 year of age at our centre over a ca. 6-year period shows that hypertrypsinaemic newborns carrying at least one ''mild`` CFTR mutation may have a chloride sweat test below 60 mmol/l and a delayed CF diagnosis. Login to comment
43 Rare mutations in the CFTR gene were identified in six patients showing increased b-IRT on newborn screening and a normal sweat test: R117H (three cases), R117L, A309D, L997F and the intronic alteration 3849+10kbCfiT. Login to comment
44 In the whole CF population followed at the Milan CF Centre (580 patients), R117L, A309D and L997F have never been identified before, whereas R117H and 3849+10kbCfiT account for only 0.51% and 0.68% of alleles, respectively. Login to comment

PMID: 12151438 [PubMed] Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."

No. Sentence Comment

20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
34 The mutations in the 25 mutation panel were: ∆F508, G542X, N1303K, G551D, W1282X, 1717-1G→A, R553X, 621ϩ1G→T, R1162X, 2183AA→G, R117H, ∆I507, R560T, 3849ϩ10kbC→T, S549N, S549I, S549R, R1283M, R1283K, R553G, R560K, R117L, 1774delCT, 1811ϩ1G→C, and 4006-61del14. Login to comment

PMID: 15084222 [PubMed] D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."

No. Sentence Comment

55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

PMID: 15880796 [PubMed] Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."

No. Sentence Comment

58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

PMID: 20706124 [PubMed] Lucarelli M et al: "A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation."

No. Sentence Comment

4 Results: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. Login to comment
55 RESULTS Genetic analysis, biochemical features of the mutations found, and state of conservation of L997F and R117L residues Five different CFTR mutations were found (those included in the CF-OLA panel were confirmed by sequencing) on one allele of the subjects analyzed (Table 1). Login to comment
63 The R117L (c.350GϾT) was found in four subjects on the same allele as L997F (as assessed by parents` analysis); it is a nonconservative Table1CFTRgenotypes,sweattestvalues,andclinicalassessmentofthesubjectsstudied SubjectGenotypeSex Averagesweat testvaluea (mEq/L) Semen analysis Uponenrollment AgeCause Clinicalsymptoms (withouttherapy) Respiratory manifestations Pulmonarybacterial isolatesByFEV1Byrx 1F508del/͓R117L;L997F͔M90Ϯ9OA5yrSymptomsDehydrationevents, bronchopneumonia, rhinosinusitis ModerateModerateAbsent 2c F508del/L997FF56Ϯ8ND2moNeonatalscreeningAbsentTooyoungMildAbsent 3F508del/L997FM42Ϯ5Tooyoung5moNeonatalscreeningAbsentTooyoungAbsentAbsent 4c F508del/L997FF35Ϯ4ND1moNeonatalscreeningAbsentTooyoungMildAbsent 5c F508del/L997FM32Ϯ1Tooyoung2moNeonatalscreeningAbsentTooyoungAbsentAbsent 6F508del/L997FM22Ϯ3Tooyoung8yrSymptomsBronchopneumonia,bronchitis, rhinosinusitis AbsentMildAbsent 7G85E/͓R117L;L997F͔M102Ϯ10OA7yrSymptomsProductivecoughTooyoungMildS.aureus 8G85E/L997FM21Ϯ4Tooyoung11moNeonatalscreeningProductivecoughTooyoungMildS.aureus(sporadic) 9W1282X/͓R117L;L997F͔M96Ϯ4OA33yrSymptomsCholelithiasis,productive cough,bronchopneumonia MildModerateS.aureus,P.aeruginosa 10W1282X/͓R117L;L997F͔F80Ϯ5ND36yrSymptomsBronchopneumoniaModerateModerateP.aeruginosa 11L320V/L997FM77Ϯ5Tooyoung3yrSymptomsRhinosinusitisTooyoungAbsentAbsent 12c S549R(AϾC)/L997FM39Ϯ6Tooyoung2moNeonatalscreeningAbsentTooyoungAbsentAbsent Nosubjecthadeitherpancreatitisorliverdisease.ClassificationofpulmonarysymptomsbyFEV1isasfollows:absent,Ͼ90%;mild,from70%to90%;moderate,from40%to70%;severe,Ͻ40%.Classificationofpulmonary symptomsbychestx-rayisasfollows:absent,noradiologicalsigns;mild,limitedairtrappingorperibronchialinfiltration;moderate,denseareasorbronchiectasisrestrictedtoonelobe;severe,denseareasorbronchiectasisin bothhemithoraxes.Theseverityofcysticfibrosiswasclassifiedasreportedin"MaterialsandMethods-Biochemical,microbiologic,andclinicalcharacterization"section. a Eachsweattestvalueisthemeanofrepeatedsweattestmeasurements(from2to4)onenrollmentandduringfollow-up. b TheBransfieldscorerangesfrom25,nodisease,to0,highlyseveredisease(forreferencesee"MaterialsandMethods"section).27 c Thesefoursubjectshavealreadybeenpartiallydescribed14andareincludedheremerelyforcomparisonpurposes. d AllthesubjectshadpancreaticsufficiencywiththeexceptionofSubject1whohadinitialPS,whichgraduallyevolvedintopancreaticinsufficiencyfrom12yearsofage. OA,obstructiveazoospermia;ND,notdetermined;PI,pancreaticinsufficiency;PS,pancreaticsufficiency. Login to comment
66 Because the position of R117L is in the first extracellular loop exposed to the aqueous extracellular environment, the substituting amino acid will have a lower fit than the original one. Login to comment
70 Both the isolated L997F and the [R117L; L997F] complex allele were associated with the 470V allele in all subjects. Login to comment
79 However, the extended genetic analysis detected the R117L mutation on the same allele as the L997F mutation in Subjects 1, 7, 9, and 10, thereby revealing a new complex allele of the CFTR gene (an example of the sequencing analysis is shown in Fig. 1). Login to comment
81 The four subjects with the [R117L; L997F] complex Fig. 1. Login to comment
89 Subject 1, with a F508del/[R117L; L997F] genotype and the highest sweat test value, displayed clinically severe CF with late pancreatic insufficiency, whereas the five subjects with the F508del/L997F genotype and lower sweat test values displayed either a milder form of CF (Subject 6) or CFTR-RD (Subjects 2, 3, and 4) or no disease at all (Subject 5). Login to comment
108 Five different CFTR mutations of the 117 CFTR amino acid are known: R117C, R117G, R117H, R117L, and R117P.37 All these mutations have previously been reported to be more likely to cause CFTR-RD than CF.13,37,46,56 However, R117H and R117C have been shown to yield high sweat test values and CF, even severe, if cis-acting with the T5 variant tract in CFTR intron 8.45,46 If we bear in mind that the pH range of airway surface fluid is pH 6.7-7.0,57,58 these mutations of the R117 CFTR residue represent both conservative and nonconservative substitutions. Login to comment
109 In particular, the R117L is a nonconservative substitution that changes the basic residue to a hydrophobic residue. Login to comment
111 A possible molecular mechanism for the reduced effect of the isolated R117L mutation may be that only 11 of the 15 amino acids that constitute the first extracellular loop domain in which the R117 residue is located have a charged or a polar side chain, whereas the other four are hydrophobic. Login to comment
114 In these four cases, the mild effects of the isolated L997F and R117L mutations cumulate in the complex allele with a cis-acting effect, thereby inducing a well-defined, strong effect on both the Cl-transport (producing the highest sweat test values in the entire case series) and clinical outcome, resulting in CF (from mild to severe). Login to comment
145 Whenever a L997F mutation is found, the search for the R117L mutation must be undertaken (and vice versa); if the complex allele is found, the onset of CF (in a mild or severe form) with high sweat test value is likely. Login to comment

PMID: 22892530 [PubMed] Sobczynska-Tomaszewska A et al: "Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy."

No. Sentence Comment

57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

PMID: 7526685 [PubMed] Morral N et al: "Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene."

No. Sentence Comment

107 1990 G--*-T R117L G. Novelli, personal communication 1171 ......... CT R347C C. Ferec, personal communication 1172 ......... G--A R347H Cremonesi et al. 1992 G I. Login to comment

PMID: 23361109 [PubMed] Sorio C et al: "Impaired CFTR function in mild cystic fibrosis associated with the S977F/T5TG12complex allele in trans with F508del mutation."

No. Sentence Comment

41 L977F has been associated with CF and a complex allele (R117L,L977F) has recently been described that could account for the variable phenotype [10]. Login to comment
42 The presence of R117L was excluded in our patient. Login to comment

PMID: 23613805 [PubMed] Schippa S et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients."

No. Sentence Comment

37 Patient Sex Age (years) CFTR allele, = CFTR allele, R Criterion I(a) Criterion II (1 = severe, 0 = mild)(b) Pancreatic status(d) FEV1% BMI 1 M 17 F508del M1V 2 (1) 1 65 17.91 2 F 23 F508del Y569D 2 (1) 0 97 18.66 3 (s1)(c) F 20 P1013L F508del 2 (0) 0 87 18.67 4 M 11 F508del L997F (without R117L) 2 0 0 110 21.33 5 (s1)(c) M 11 P1013L F508del 2 (0) 0 100 23.14 6 M 8 R553X F508del 2 1 0 80 15.87 7 M 3 F508del unknown 2 (0) 0 nd nd 8 F 33 F508del F508del 1 1 1 73 18.61 9 M 10 F508del L1077P 2 1 0 94 19.79 10 M 9 F508del G542X 2 1 1 100 16.00 11 F 9 4167delCTAAGCC L1065P 3 nd 1 76 14.57 12 F 14 R117C (without (TG)12T5) F508del 2 0 0 94 18.44 13 F 11 F508del 991del5 2 1 1 109 17.80 14 M 42 (TG)12T5 F508del 2 0 0 106 23.78 15 (s2)(c) M 9 F508del F508del 1 1 1 82 15.45 16 M 10 F508del R347P 2 (0) 0 89 15.91 17 (s2)(c) F 6 F508del F508del 1 1 1 110 15.20 18 (s3)(c) M 39 2789+5G.A N1303K 3 nd 0 105 19.33 19 (s3)(c) F 41 2789+5G.A N1303K 3 nd 0 80 19.47 20 F 26 N1303K W1282X 3 nd 1 90 19.57 21 M 7 CFTRdele2,3 (21 kb) N1303K 3 nd 1 107 12.85 22 F 9 F508del L997F (without R117L) 2 0 0 113 25.21 23 M 7 P5L W1282X 3 nd 0 89 22.31 24 M 9 2789+5G.A F508del 2 (1) 1 97 15.60 25 F 2 F508del F508del 1 1 1 nd nd 26 F 32 N1303K N1303K 3 nd 1 107 21.22 27 M 14 L1065R T338I 3 nd 0 116 21.50 28 M 12 711+3A.G S549R(A.C) 3 nd 0 97 20.00 29 M 13 unknown R117H (without (TG)12T5) 3 nd 0 104 19.36 30 M 14 F508del G542X 2 1 1 84 21.87 31 F 13 F508del F508del 1 1 1 85 18.00 32 F 41 2789+5G.A N1303K 3 nd 1 84 21.08 33 F 21 L1065P F508del 2 (0) 0 62 18.29 34 F 50 D1152H F508del 2 (0) 0 63 23.74 35 M 29 F508del 2790-2A.G 2 (1) 0 92 24.46 36 F 45 unknown W1282X 3 nd 0 69 23.42 a (Hm = 1; Ht = 2; N = 3). Login to comment

PMID: 25824995 [PubMed] Salinas DB et al: "Benign outcome among positive cystic fibrosis newborn screen children with non-CF-causing variants."

No. Sentence Comment

87 In another example, the combination of R117L and L997F on the same allele causes a more severe phenotype than L997F alone, though this combination was not observed in this study [23]. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

294 The [R117L;L997F] (p. Login to comment
295 [Arg117Leu; Leu997Phe]) complex allele (28) was found in 6 patients (1 CF-PI and 5 CF-PS). Login to comment
298 The R117L (p.Arg117Leu) was only found in the complex allele. Login to comment
299 The L997F (p.Leu997Phe), with no R117L (p.Arg117Leu) in cis, was found in 13 patients (2 CF-PS, 8 CFTR-RD and 3 CBAVD). Login to comment
366 [227_228insT;1210-14TG[12];1210-12T[5]] uncertain: CF-PI and/or CF-PS and/or CFTR-RD 359insT nd; T5 varying clinical consequence G85E c.254G>A CF-PI,CF-PS CF-causing p.Gly85Glu D110H c.328G>C CF-PS CF-causing p.Asp110His R117C c.349C>T CF-PS CF-causing p.Arg117Cys R117H c.350G>A CFTR-RD varying clinical consequence p.Arg117His [R117L;L997F] c. Login to comment
367 [350G>T;2991G>C] CF-PI,CF-PS R117L nd; L997F non CF-causing p. Login to comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment
424 The three actually discrepant alleles were L997F (p.Leu997Phe), without the R117L (p.Arg117Leu) in cis, L206W (p.Leu206Trp) and T338I (p.Thr338Ile). Login to comment