ABCMdb

ABCC7 p.Gln493*

ClinVar:	c.1478A>C , p.Gln493Pro ? , not provided c.1478A>G , p.Gln493Arg ? , not provided c.1477C>T , p.Gln493* D , Pathogenic
CF databases:	c.1477C>T , p.Gln493* D , CF-causing c.1478A>C , p.Gln493Pro (CFTR1) D , c.1478A>G , p.Gln493Arg (CFTR1) ? , This mutation was identified by DGGE and direct sequencing which was found in a Bulgarian CF chromosome.

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Hybridization of glass-tethered oligonucleotide pr... Mol Biotechnol. 1999 Feb;11(1):1-12. Maldonado-Rodriguez R, Espinosa-Lara M, Calixto-Suarez A, Beattie WG, Beattie KL
Hybridization of glass-tethered oligonucleotide probes to target strands preannealed with labeled auxiliary oligonucleotides.
Mol Biotechnol. 1999 Feb;11(1):1-12., [PMID:10367278]

Abstract [show]
In this article we introduce a strategy of preannealing labeled auxiliary oligonucleotides to single-stranded target DNA, prior to hybridization of the DNA target to oligonucleotide arrays (genosensors) formed on glass slides for the purpose of mutation analysis. Human genomic DNA samples from normal individuals and cystic fibrosis (CF) patients (including homozygous delta F508 and heterozygous delta F508/wild type (wt) in the region examined) were used. A PCR fragment of length 138 bp (wt) or 135 bp (mutant) was produced from exon 10 in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, using a new pair of polymerase chain reaction (PCR) primers. This fragment contains four of the most frequent mutation sites causing the disease (Q493X, delta I507, delta F508, and V520F). Each of these mutations was tested using a pair of nonamer (9-mer) probes covalently attached to glass slides, representing the normal (wt) and the mutant alleles. Single-stranded target DNA was isolated from the PCR fragment using one PCR primer labeled with biotin and a streptavidin minicolumn to capture the biotin-labeled strand. Prior to hybridization to the 9-mer array on a glass slide, the unlabeled target strand was preannealed with one, three, or four auxiliary oligonucleotides, at least one being labeled with 32P. As observed previously in several laboratories, the discrimination between normal (wt) and mutant alleles at each site using oligonucleotide array hybridization ranged from very good to poor, depending on the number and location of mismatches between probe and target. Terminal mismatches along the probe were difficult to discriminate, internal mismatches were more easily discriminated, and multiple mismatches were very well discriminated. An exceptionally intense hybridization signal was obtained with a 9-mer probe that hybridized contiguously (in tandem) with one auxiliary oligonucleotide preannealed to the target DNA. The increased stability is apparently caused by strong base stacking interactions between the "capture probe" and the auxiliary oligonucleotide. The presence of the delta F508 mutation was detected with this system, including discrimination between homozygous and heterozygous conditions. Base mismatch discrimination using the arrayed 9-mer probes was improved by increasing the temperature of hybridization from 15 to 25 degrees C. Auxiliary oligonucleotides, preannealed to the single-stranded template, may serve several purposes to enable a more robust genosensor-based DNA sequence analysis: 1. A convenient means of introducing label into the target DNA molecule. 2. Disruption of interfering short-range secondary structure in the region of analysis. 3. Covering up of redundant binding sites in the target strand (i.e., where a given probe has more than one complement within the target). 4. Tandem hybridization with the capture probe (providing contiguous stacking) as a means for achieving efficient mismatch discrimination at the terminal position of the capture probe (adjacent to the auxiliary oligonucleotide). By use of multiple auxiliary oligonucleotides, all of the above benefits can be derived simultaneously.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 This fragment contains four of the most frequent sites of mutations causing CF, Q493X, AI507, AF508, and V520F 07). Login to comment
57 The sequences of the eight 9-mer probes were as follows (the 5'-amino group is denoted by the character, "@": for mutation Q493X, probes CF10W 5'-@actgagaac and CF10M 5'-@taagaacag; for mutationAI507,probes CF11W 5-@aagatgata and CFllM 5-@ccaaagata; for mutation AF508, probes CF 12W 5- @ccaaagatg and CF12M 5'-@caccgatga; and for mutation V520F, probes CF13W 5-@atgacgctt and CF 13M 5-@gatgeagct. Login to comment
40 This fragment contains four of the most frequent sites of mutations causing CF, Q493X, AI507, AF508, and V520F 07). Login to comment
58 The sequences of the eight 9-mer probes were as follows (the 5'-amino group is denoted by the character, "@": for mutation Q493X, probes CF10W 5'-@actgagaac and CF10M 5'-@taagaacag; for mutationAI507,probes CF11W 5-@aagatgata and CFllM 5-@ccaaagata; for mutation AF508, probes CF 12W 5- @ccaaagatg and CF12M 5'-@caccgatga; and for mutation V520F, probes CF13W 5-@atgacgctt and CF 13M 5-@gatgeagct. Login to comment

[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining. Login to comment

[hide] Analysis of 31 CFTR mutations by polymerase chain ... J Med Screen. 1999;6(2):67-9. Gasparini P, Arbustini E, Restagno G, Zelante L, Stanziale P, Gatta L, Sbaiz L, Sedita AM, Banchieri N, Sapone L, Fiorucci GC, Brinson E, Shulse E, Rappaport E, Fortina P
Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis.
J Med Screen. 1999;6(2):67-9., [PMID:10444722]

Abstract [show]
OBJECTIVES: Molecular biological testing for genetic diseases has grown rapidly, but speed, accuracy, specificity, sensitivity, throughput, and cost become more important as large scale screening is considered. This is a pilot study of an assay for the simultaneous detection of up to 31 cystic fibrosis mutations in a multicentre population based screening of 4476 Italian newborns. METHODS: The assay is a polymerase chain reaction, followed by an oligonucleotide ligation assay (PCR/OLA) and finally a sequence coded separation. It allows the detection of up to 31 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Guthrie spots were used as a source of template DNA. RESULTS: 144 carriers were detected during the analysis of 4476 samples, which translates into a carrier frequency of 1/31.1. Forty two carriers were detected from 1341 samples in Pavia (1/31.9), 53 from 1574 in Turin (1/29.7), and 49 from 1561 in San Giovanni Rotondo (1/31.8). Fifteen different mutations were detected, the most common being delta F508 (0.625). Other common mutations included G542X (16 of 144), which was particularly common in southern Italy (14 of 49), N1303K (8 of 144), and R117H (8 of 144), detected only in the northern centres. CONCLUSIONS: PCR/OLA is a robust, accurate, user friendly method for cystic fibrosis screening of newborns using blood spots in a semiautomated way at a low cost per mutation (0.8 Euro).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia. Login to comment

[hide] Prenatal detection by real-time quantitative PCR a... Clin Chem. 2000 Sep;46(9):1417-20. Costes B, Girodon E, Vidaud D, Flori E, Ardalan A, Conteville P, Fanen P, Niel F, Vidaud M, Goossens M
Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19).
Clin Chem. 2000 Sep;46(9):1417-20., [PMID:10973878]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E. Login to comment

[hide] Cystic fibrosis in infertility: screening before a... Hum Reprod. 2000 Nov;15(11):2415-7. Lewis-Jones DI, Gazvani MR, Mountford R
Cystic fibrosis in infertility: screening before assisted reproduction: opinion.
Hum Reprod. 2000 Nov;15(11):2415-7., [PMID:11056144]

Abstract [show]
Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasians. In 97-98% of men with CF, bilateral congenital absence of the vas deferens (CBAVD) blocks the transport of spermatozoa resulting in azoospermia. Abnormalities in sperm parameters have also been identified in males with CF. To date, over 800 disease-causing mutations of the CF transmembrane conductance regulator (CFTR) gene have been identified (also called ABCC7). Current legislation suggests that prior to intracytoplasmic sperm injection (ICSI) treatment, men with CBAVD or unexplained oligozoospermia should be considered for screening. If the male is negative with routine screening then the female partner is not screened. This is fundamentally wrong because if the female is screened and is found to be CF positive on routine testing, her partner would then need the fullest possible investigation of the CFTR gene. It is ideal to screen both partners in cases of oligozoospermia. However, if the resources are stretched, then only the female needs to be routinely screened because if she is negative, then the couple's residual risk of having a CF or CBAVD child will be reduced to 1:960. Only when the female is found to be a carrier does the male partner need routine screening followed by full testing for known mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Q493X D1152H Gregg, R.G., Wilfond, B.S., Farell, P.M. et al. (1993) Application of DNA 1717-1G→A 4326∆TC analysis in a population-screening program for neonatal diagnosis of cystic R56OT 4279insA fibrosis (CF): comparison of screening protocols. Login to comment

[hide] Polymorphism of cystic fibrosis gene in Japanese p... Dig Dis Sci. 2000 Oct;45(10):2007-12. Kimura S, Okabayashi Y, Inushima K, Yutsudo Y, Kasuga M
Polymorphism of cystic fibrosis gene in Japanese patients with chronic pancreatitis.
Dig Dis Sci. 2000 Oct;45(10):2007-12., [PMID:11117575]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and the 5T genotype of the polythymidine tract at the exon 9 splice branch/acceptor site are shown to be associated with chronic pancreatitis in Caucasian patients. In contrast to Western countries, cystic fibrosis is extremely rare in Japan. In this study, we investigated the association of mutations or polymorphisms of the CFTR gene with chronic pancreatitis in Japanese patients. Forty-seven patients with chronic pancreatitis (alcohol-related in 31, idiopathic in 14, and familial in 2) were examined for the deltaF508 and R117H mutations and polymorphisms of intron 8. DNA was extracted from leukocytes. Mutations and polymorphisms were examined by the allele-specific polymerase chain reactions and confirmed by direct sequencing. None of the patients had deltaF508 or R117H mutations in the CFTR gene. All of 47 healthy Japanese showed the homozygous 7T/7T genotype, whereas the frequencies of 5T, 7T, and 9T alleles were 0.043, 0.894, and 0.064 in the patients, respectively. The difference in allele frequency is statistically significant. Therefore, the present study indicates the association of polymorphism of the polythymidine tract in intron 8 of the CFTR gene with chronic pancreatitis in Japanese patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Other mutations included R117H in two patients and Q493X, R553X, R560T, and 621 ϩ 1(G-to-T) in one patient each. Login to comment

[hide] Comprehensive mutation screening in a cystic fibro... Pediatrics. 2001 Feb;107(2):280-6. Wine JJ, Kuo E, Hurlock G, Moss RB
Comprehensive mutation screening in a cystic fibrosis center.
Pediatrics. 2001 Feb;107(2):280-6., [PMID:11158459]

Abstract [show]
OBJECTIVES AND BACKGROUND: The identities of a cystic fibrosis (CF) patient's CFTR mutations can influence therapeutic strategies, but because >800 CFTR mutations exist, cost-effective, comprehensive screening requires a multistage approach. Single-strand conformation polymorphism and heteroduplex analysis (SSCP/HA) can be an important part of mutation detection, but must be calibrated within each laboratory. The sensitivity of a combined commercial-SSCP/HA approach to genotyping in a large, ethnically diverse US center CF population has not been established. STUDY DESIGN: We screened all 27 CFTR exons in 10 human participants who had an unequivocal CF diagnosis including a positive sweat chloride test and at least 1 unknown allele after commercial testing for the 70 most common mutations by SSCP/HA. These participants were compared with 7 participants who had negative sweat tests but at least 1 other CF-like symptom meriting complete genotyping. RESULTS: For the 10 CF participants, we detected 11 of 16 unknown alleles (69%) and all 4 of the known alleles (100%), for an overall rate of 75% inpatients not fully genotyped by conventional 70 mutation screen. For 7 participants with negative sweat tests, we confirmed 1 identified mutation in 14 alleles and detected 3 additional mutations. Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, DeltaF508, 451-458Delta8 bp, 5T, 663DeltaT, exon 13 frameshift, 1261+1G-->A and 3272-26A-->G). Three of these mutations were novel (G970D, L1093P, and 451-458Delta8 bp(1)). Thirteen other changes were detected, including the novel changes 1812-3 ins T, 4096-278 ins T, 4096-265 ins TG, and 4096-180 T-->G. CONCLUSION: When combined with the 70 mutation Genzyme test, SSCP/HA analysis allows for detection of >95% of the mutations in an ethnically heterogeneous CF center population. We discuss 5 possible explanations that could account for the few remaining undetected mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 Mutations in the Stanford CF Mutation Database After Screening With the Genzyme70 Assay Mutation n % n % ⌬F508 353 67.11% 353 67.11% Splice mutations 16 3.04% 621ϩ1 G3T 5 0.95% 1717-1 G3A 5 0.95% 2789ϩ5 G3A 1 0.19% 1898ϩ1 G3A 1 0.19% 3849ϩ10 kb C3T 4 0.76% Stop mutations 31 5.89% Q493X 1 0.19% G542X 13 2.47% R553X 4 0.76% R1162X 1 0.19% W1282X 10 1.90% S1455X 2 0.38% Insertions/deletions 9 1.71% 681 del C 1 0.19% 2184 del A 2 0.38% 3859 del C 5 0.95% 3905 ins T 1 0.19% Missense mutations 33 6.27% G85E 4 0.76% R117H 3 0.57% R334W 6 1.14% G551D 14 2.66% R560T 3 0.57% N1303K 3 0.57% Unknown mutations 84 15.97% 84 15.97% Total 526 100.00% 526 100.00% ARTICLES tients with positive sweat tests were selected for SSCP/HA analysis based on clinical status, ethnicity, and previous screening with the Genzyme70 assay. Login to comment

[hide] The molecular basis of cystic fibrosis in South Af... Clin Genet. 2001 Jan;59(1):37-41. Goldman A, Labrum R, Claustres M, Desgeorges M, Guittard C, Wallace A, Ramsay M
The molecular basis of cystic fibrosis in South Africa.
Clin Genet. 2001 Jan;59(1):37-41., [PMID:11168023]

Abstract [show]
The spectrum of CFTR mutations in three South African populations is presented. To date. a total of 192 white patients (384 chromosomes) with confirmed CF have been tested. deltaF508 accounts for 76% of the CF chromosomes in this group, with 3272-26A-->G, 394delTT and G542X occurring at the following frequencies: 4, 3.6 and 1.3%, respectively. A further 11 mutations account for 6% of CF chromosomes. A total of 91% of the CF-causing mutations can now be detected in the South African white population. Haplotype analysis suggests a founder effect in South Africans of European origin for the two common CFTR mutations, 3272-26A-->G and 394delTT. The diagnosis of CF has been confirmed in 14 coloured and 12 black CF patients. In the coloured population, both the deltaF508 and 3120 + 1G-->A mutations occur at appreciable frequencies of 43 and 29%, respectively. In the black population, the most common CF-causing mutation, the 3120 + 1G-->A mutation, occurs at an estimated frequency of 46%. Four other mutations have been detected, resulting in the identification of a total of 62.5% of mutations in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Five mutations, 394delTT, Q493X, 3272-26AG, 3120+1GA and 2789+5GA were detected. Login to comment
40 White and coloured patients with unidentified CF mutations were tested for 15 mutations including 394delTT, Q493X, 3272-26A G, 3120+1GA as well as 11 other mutations, R117H, R334W, G542X, G551D, R553X, 621+ 1GT, W1282X, N1303K, 1717-1GA, R1162X, 3849+10kbCT. Login to comment
52 The Q493X mutation was detected using ARMS PCR as described by Kerem et al. (10). Login to comment
58 Frequency of CFTR mutations in white CF chromosomes Mutation Number of chromosomes Frequency (%) DF508 291 76 3272-26AG 16 4 394delTT 14 3.6 G542X 5 1.3 R553X 4 1 1W1282X 4 14N1303K G551D 3 0.8 3120+1GA 2 0.5 R117H 1 0.3 Q493X 1 0.3 S549N 1 0.3 621+1GT 1 0.3 1717-1GA 1 0.3 2789+5GA 1 0.3 91Total 349/384 Table 2. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
128 By comparison, eight "African" mutations accounted for a similar percentage of the chromosomes analyzed (23%) in the study by Macek et al.6 In contrast, 11 of the 20 mutations detected in this study are considered to be "Caucasian" mutations and account for 10.5% of the chromosomes analyzed (R117H, 621 ϩ 1GϾT, R334W, Q493X, G551D, 1812-1GϾA, 1898 ϩ 1GϾA, R1066C, R1158X, R1162X, and 3905insT). Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... Am J Gastroenterol. 2001 Sep;96(9):2657-61. Truninger K, Malik N, Ammann RW, Muellhaupt B, Seifert B, Muller HJ, Blum HE
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
Am J Gastroenterol. 2001 Sep;96(9):2657-61., [PMID:11569691]

Abstract [show]
OBJECTIVE: Several studies have reported an increased frequency of cystic fibrosis gene mutations in idiopathic but not in alcoholic chronic pancreatitis. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis has not been analyzed. The aim of our study was to determine the frequency of cystic fibrosis gene mutations in patients with chronic pancreatitis with long-term follow-up and to see whether patients with mutations have a clinically different natural course compared to those without mutations. METHODS: Eighty two patients with chronic pancreatitis and 11 patients with recurrent acute pancreatitis of our well defined pancreatitis cohort were screened for the 31 most common cystic fibrosis gene mutations. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis was assessed. RESULTS: A cystic fibrosis gene mutation was detected in five of 49 patients with alcoholic chronic pancreatitis (10.2%; 2.3 times the expected frequency) and in three of 14 patients with idiopathic-juvenile chronic pancreatitis (21.4%; 4.8 times the expected frequency). No mutations were found in the remaining patients with chronic pancreatitis of rare causes, hereditary pancreatitis, and recurrent acute pancreatitis. The frequency of pancreatic calcifications was significantly higher in patients with alcoholic chronic pancreatitis without mutations. This result was not confirmed in patients with idiopathic-juvenile chronic pancreatitis. The duration of pain and the frequency of exocrine and endocrine insufficiency was comparable in both subgroups irrespective of the mutation status. CONCLUSION: Our data indicate a significantly increased frequency of cystic fibrosis gene mutations both in patients with alcoholic and idiopathic-juvenile chronic pancreatitis. The natural course was similar in patients with mutations compared to those without mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A. Login to comment

[hide] Analysis of exocrine pancreatic function in cystic... Eur J Clin Invest. 2001 Sep;31(9):796-801. Walkowiak J, Herzig KH, Witt M, Pogorzelski A, Piotrowski R, Barra E, Sobczynska-Tomaszewska A, Trawinska-Bartnicka M, Strzykala K, Cichy W, Sands D, Rutkiewicz E, Krawczynski M
Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency.
Eur J Clin Invest. 2001 Sep;31(9):796-801., [PMID:11589722]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common cause of exocrine pancreatic insufficiency in childhood. The aim of the present study is to evaluate the correlation between genotype and exocrine pancreatic insufficiency in CF patients. The special emphasis was put on the analysis of mild CFTR mutations. DESIGN: The study comprised 394 CF patients and 105 healthy subjects (HS). Elastase-1 concentrations were measured in all subjects. RESULTS: Severe pancreatic insufficiency was associated with the presence of two CFTR gene mutations (DeltaF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717-1G-A, R533X, W1282X, 621GT, 2183AAG, R560T, 2184insA and DeltaI507, G551D, 895T) and mild insufficiency with the presence of at least one mutation (R117H, 3171insC, A155P2, 138insL, 296 + 1G-A, E92GK, E217G, 2789 + 5G-A. 3849 + 1kbC-T/3849 + 1kbC-T) genotype resulted in high elastase-1-values. However, in case of patients with genotype DeltaF508/3849 + 10kbC-T, 1717-1GA/3849 + 10kbC-T as well as with DeltaF508/R334W, both high and low elastase-1 concentrations were found. Low E1 values were found in a patient with DeltaF508/R347P genotype. CONCLUSION: Patients who carry two 'severe' mutations develop pancreatic insufficiency, whereas those who carry at least one 'mild' usually remain pancreatic sufficient. However, the presence of one mild mutation does not exclude pancreatic insufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 Kristidis et al. [10] reported that pancreatic insufficiency strongly correlates also with two alleles of DI507, Q493X, G542X, R553X, W1282X, 621 1 1G-T, 1717±1G-A, 556delA, 3659delC, I148T, G480C, V520F and R560T while one or two mutations such as R117H, R334W, A455E, and P574H were correlated with a pancreatic sufficient phenotype. Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14). Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment
100 Optimization of Temperature (OTm) for Undetected Mutations Nucleotide RTm OTm Exon Mutation change (°C) (°C) 3 W57G 301 T>G 55 57 R74W 352 C>T 55 57 7 R334W 1132 C>T 58 60 R347C 1171 C>T 58 60 10 Q493X 609 C>T 55 56 20 3905 insT 3905 insT 55 56 D1270N 3940 G>A 57 58 RTm, recommended temperature by the MELT program; OTm, optimized temperature. Login to comment

[hide] Determination of the relative contribution of thre... Eur J Hum Genet. 2002 Feb;10(2):100-6. Audrezet MP, Chen JM, Le Marechal C, Ruszniewski P, Robaszkiewicz M, Raguenes O, Quere I, Scotet V, Ferec C
Determination of the relative contribution of three genes-the cystic fibrosis transmembrane conductance regulator gene, the cationic trypsinogen gene, and the pancreatic secretory trypsin inhibitor gene-to the etiology of idiopathic chronic pancreatitis.
Eur J Hum Genet. 2002 Feb;10(2):100-6., [PMID:11938439]

Abstract [show]
In the last 5 years, mutations in three genes, the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the pancreatic secretory trypsin inhibitor (PSTI) gene, have been found to be associated with chronic pancreatitis (CP). In this study, using established mutation screening methods, we systematically analysed the entire coding sequences and all exon/intron junctions of the three genes in 39 patients with idiopathic CP (ICP), with a view to evaluating the relative contribution of each gene to the aetiology of the disease. Our results demonstrate that, firstly, 'gain-of-function' mutations in the PRSS1 gene may occasionally be found in an obvious ICP subject. Secondly, presumably 'loss-of-function' mutations in the PSTI gene appear to be frequent, with a detection rate of at least 10% in ICP and, finally, abnormal CFTR alleles are common: at least 20% of patients carried one of the most common CFTR mutations, and about 10% of patients were compound heterozygotes, having at least one 'mild' allele. Thus, in total, about 30% of ICP patients carried at least one abnormal allele in one of the three genes, and this is the most conservative estimate. Moreover, a trans-heterozygous state with sequence variations in the PSTI/CFTR genes was found in three patients. However, an association between the 5T allele in intron 8 of the CFTR gene and ICP remains unproven.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 In this regard, a F508del/5T genotype was identified three times3,4 and Q493X/5T3 and R553X/5T3 once each in patients with ICP. Login to comment

[hide] Predicting the risk of cystic fibrosis with abnorm... Am J Med Genet. 2002 Jun 15;110(2):109-15. Muller F, Simon-Bouy B, Girodon E, Monnier N, Malinge MC, Serre JL
Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases.
Am J Med Genet. 2002 Jun 15;110(2):109-15., 2002-06-15 [PMID:12116247]

Abstract [show]
Hyperechogenic fetal bowel is prenatally detected by ultrasound during the second trimester of pregnancy in 0.1-1.8% of fetuses. It has been described as a normal variant but has often been associated with severe diseases, notably cystic fibrosis (CF). The aim of our study was to determine the risk of CF in a prospective study of 641 fetuses with ultrasonographically abnormal fetal bowel and the residual risk when only one mutation is detected in the fetus. Fetal cells and/or parental blood cells were screened for CFTR mutations. Two screening steps were used, the first covering the mutations most frequently observed in French CF patients (mutation detection rate of 70-90%) and, when a CF mutation was detected, a DGGE-sequencing strategy. We observed a 3.1% risk of CF when a digestive tract anomaly was prenatally observed at routine ultrasound examination. The risk was higher when hyperechogenicity was associated with bowel dilatation (5/29; 17%) or with the absence of gall bladder (2/8; 25%). The residual risk of CF was 11% when only one CF mutation was detected by the first screening step, thereby justifying in-depth screening. Mutations associated with severe CF (DeltaF508 mutation) were more frequently observed in these ultrasonographically and prenatally detected CF cases. However, the frequency of heterozygous cases was that observed in the normal population, which demonstrates that heterozygous carriers of CF mutations are not at increased risk for hyperechogenic bowel. In conclusion, fetal bowel anomalies indicate a risk of severe cystic fibrosis and justify careful CFTR molecular analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 A, N1303K, W1282X), oligonucleotide ligation assay with the CF-OLA kit (PE-Biosystems, Foster City, CA) (31 mutations detected: DF508, DI507, Q493X, V520F, 1717-1G ! Login to comment

[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]

Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
83 Matrix-assisted laser desorption ionization-time of flight mass spectra for multiplex primer oligonucleotide base extension reactions of mutations ∆F508, Q493X and R1066C. Login to comment

[hide] Demographics of the UK cystic fibrosis population:... Eur J Hum Genet. 2002 Oct;10(10):583-90. McCormick J, Green MW, Mehta G, Culross F, Mehta A
Demographics of the UK cystic fibrosis population: implications for neonatal screening.
Eur J Hum Genet. 2002 Oct;10(10):583-90., [PMID:12357328]

Abstract [show]
The objective was to determine the composition of the Cystic Fibrosis (CF) Population attending specialist UK CF centres in terms of age, gender, age at diagnosis, genotype and ethnicity. With the planned introduction of the national CF screening programme in the UK, cystic fibrosis transmembrane regulator (CFTR) mutations were compared between different ethnic groups enabling a UK-specific frequency of mutations to be defined. Data were analysed from the patient biographies held in the UK CF Database (see www.cystic-fibrosis.org.uk). The currently registered population of 5,274 CF patients is 96.3% Caucasian with a male preponderance that significantly increases with age. The majority of the 196 non-Caucasian CF patients are from the Indian Subcontinent (ISC), of which one in 84 UK CF patients are of Pakistani origin. The commonest CFTR mutation, deltaF508, is found in 74.1% of all CF chromosomes. In the Caucasian CF population, 57.5% are deltaF508 homozygotes but the UK ISC CF population with only 24.7%, has significantly fewer deltaF508 homozygotes patients (95% confidence interval (CI) 0.2-0.4). The distribution of Caucasian patients with deltaF508/deltaF508, deltaF508/Other and Other/Other does not fit the expected distribution with a Hardy-Weinberg model unless those patients without a detected mutation are excluded (P<0.001). The UK CF Database has shown the UK CF population to have distinct characteristics separate from the North American and European CF Registries. The ISC group contains many mutations not recognised by current genetic analysis, and one in four ISC patients have no CFTR mutations identified. The CFTR analysis proposed for the screening programme would detect 96% of patients registered in the database, but is unlikely to achieve the desired >80% detection rates in the ethnic minority groups. Screen-positive, non-Caucasian infants without an identifiable CFTR mutation should be referred for a sweat test and genetic counselling when serum trypsinogen concentrations remain elevated after birth.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 It is envisaged that the proposed screening programme will be based on a three-stage protocol.6 In Table 3 Genotypes of the UK CF Caucasian and ISC populations Percentage of Percentage of genotyped UK CF genotyped UK CF Caucasian population ISC population Genotype n=4753 (%) n=78 (%) DF508/DF508 57.5 24.7 DF508/Unknown 11.5 3.5 DF508/G551D 5.1 0.0 DF508/G542X 2.8 0.0 Unknown/Unknown 2.7 27.1 DF508/621+1G?T 2.0 1.2 DF508/R117H 2.0 0.0 DF508/1898+1G?A 1.0 0.0 DF508/1717-G?A 0.9 0.0 DF508/N1303K 0.8 0.0 DF508 DI507 0.8 0.0 DF508/R553X 0.6 0.0 DF508/R560T 0.6 0.0 DF508/Q493X 0.5 0.0 G551D/Unknown 0.4 0.0 Other/Other 2.8 15.3* DF508/Other 6.7 0.0 Y569D/Y569D 0.0 8.2 L218X/L218X 0.0 3.5 1161delC/1161delC 0.0 3.5 R709X/V456A 0.0 2.4 G542X/G542X 0.4 2.4 Other/Unknown 1.0 3.5 The shaded areas represent the commonest genotypes in the ISC population. Login to comment
85 Table 4 The commonest CFTR mutations in the UK Genotypes UK CF population Genotyped UK Caucasian CF Genotyped UK CF ISC (n=9866 chromosomes) population (n=9506 chromosomes) population (n=156 chromosomes) CFTR mutation gene frequency per 1000 genes gene frequency per 1000 genes gene frequency per 1000 genes DF508 741.0 752.0 294.9 G551D 33.7 34.3 12.8 G542X 18.5 18.4 25.6 R117H 12.5 12.7 0.0 621+1G?T 12.7 12.7 6.4 1717-1G?A 5.8 5.8 0.0 1898+1G?A 5.7 5.9 0.0 N1303K 5.6 5.4 0.0 DI507 4.8 5.0 0.0 R560T 4.2 4.3 0.0 R553X 3.3 3.4 0.0 1154insTC 3.2 3.3 0.0 Q493X 2.8 2.9 0.0 3659delC 2.8 2.9 0.0 E60X 2.4 2.4 0.0 W1282X 2.7 2.7 0.0 P67L 2.1 2.1 0.0 G85E 2.1 2.0 0.0 V520F 1.6 1.7 0.0 1078delT 1.3 1.4 0.0 Y569D 1.5 0.0 96.2 L218X 0.6 0.0 38.5 1161delC 0.7 0.1 38.5 R1162X 0.9 0.6 19.2 R709X 0.4 0.2 12.8 3849+10kbC?T 1.2 0.8 19.2 S549R* 0.6 0.0 0.0 *S549R mutations appear in the non-Caucasian but not the ISC subgroup. Login to comment

[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]

Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development. Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]

Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation. Login to comment

[hide] Genetic disorders of the pancreas. Gastroenterol Clin North Am. 2003 Sep;32(3):763-87. Morinville V, Perrault J
Genetic disorders of the pancreas.
Gastroenterol Clin North Am. 2003 Sep;32(3):763-87., [PMID:14562574]

Abstract [show]
The venues opened to all by the remarkable studies of the genome are just starting to become manifest; they can now distinguish different variants of a disease; they are given the tools to better understand the pathophysiology of illness; they hope to be able to provide better treatment alternatives to our patients. The examples described in this review demonstrate the applicability of these concepts to pancreatic disorders. Researchers may be just scratching the surface at this time, but the potential is enormous. Many philosophic and ethical questions need to be answered as physicians move along: Should all family members of an index case be screened? Who should pay for testing? Who should get results? But, without the participation of so many patients, their family members, and numerous volunteers, researchers would not have witnessed the bridging of so many gaps as they have so far. All of us may now look forward to the application of this incredible knowledge to the therapeutic solutions so eagerly awaited.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 The close monitoring of the families affected with this condition played an important role in the identification of their genetic anomaly; the S family, described by McElroy and Christiansen in 1972 [34], was to play a pivotal role in helping Whitcomb et al 25 years later to uncover the Table 1 Recent genetic information on pancreatitis in children Gene Chromosome Mutations References Cationic trypsinogen (protease, serine1; PRSSI) 7q35 R122H; N29I A16V; others [4,11-19] Pancreatic trypsin inhibitor (PSTI) (SPINK1-serine protease inhibitor, Kazal Type 1) 5 N34S [20-22] CFTR-cystic fibrosis transmembrane regulator 7 DF508; R117H; Q493X R560T; R553X; 5Tallele; 621 + 1(G!T) and others [23-27] Parathyroid cell receptor (CaR) 3 (3q21-24) N178D; R220Q; P221S; R648X; others [28-30] Lipoprotein lipase (LPL) 8 (8p22) N291S, S447X; G715A [31,32] Apolipoprotein C-II (apoC-II) 19 (19q13.2) Val 18, Gln 2 and others [31] chromosomal [11], then the genetic abnormality [1], while in France Le Bodic et al [12] identified a very similar anomaly in a family described in 1963 by Cornet et al [35]. Login to comment
77 Mutations, including delta F508, R117H, Q493X, 621 + 1 (G!T), R560T, R553X, were found at 2.5 times the frequency expected in the general population studied (600 controls included). Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29. Danziger KL, Black LD, Keiles SB, Kammesheidt A, Turek PJ
Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis.
Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29., [PMID:14998948]

Abstract [show]
BACKGROUND: Accurate determination of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is critical for genetic counselling and treatment of obstructive azoospermia. Of concern is that detection rates with routine CFTR mutation panels vary widely depending on patient ancestry; and such panels have limited value for azoospermic patients, who are more likely to carry rare mutations. An alternative approach offers comprehensive, CFTR mutation analysis by a DNA sequence method. We investigated whether this method could improve CFTR detection rates in men with obstructive azoospermia in a prospective study of men with obstructive azoospermia and their partners who were referred for genetic counselling and testing at one of two institutions. METHODS: Sixteen patients with congenital absence of the vas deferens (CAVD, n = 14) or idiopathic obstructive azoospermia (n = 2) were studied. DNA from all patients was analysed for mutations by the DNA sequence method. In addition to this method, six men underwent CFTR analysis by a common 25 or 31 mutation panel coupled with poly T analysis. In 10 subjects, common mutation panel findings were inferred from DNA sequence method results. RESULTS: Overall, 12/16 (75%) azoospermic patients had one or more CFTR mutations and/or 5T alleles, including 12 mutations in 10 patients (two compound heterozygotes) and seven 5T alleles in six patients (one homozygote). The sequence method detected all mutations and three variants of unknown significance. By comparison, the common mutation panels detected only 3/12 mutations (25%) and 0/3 variants. CONCLUSION: The DNA sequence method detects more CFTR mutations than common mutation panels. Given the serious, clinical consequences of transmitting such mutations, this study underscores the importance of accurate, CFTR mutation detection in men with obstructive azoospermia and their partners.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad). Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] Multiple mutation analysis of the cystic fibrosis ... Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20. Sanchez-Garcia JF, Benet J, Gutierrez-Mateo C, Luis Seculi J, Monros E, Navarro J
Multiple mutation analysis of the cystic fibrosis gene in single cells.
Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20., [PMID:15908456]

Abstract [show]
PGD is becoming an alternative to prenatal diagnosis. The combination of IVF techniques with the PCR technology allows for the detection of genetic abnormalities in first polar bodies from oocytes and blastomeres from cleavage-stage embryos. Dealing with a genetic disease with a heterogeneous spectrum of mutations like cystic fibrosis, one of the objectives of centres offering PGD is the application of simple and efficient protocols that allow for the detection of a wide range of mutations with a single procedure. In the present work, 29 normal loci and the 31 most frequent cystic fibrosis transmembrane conductance regulator (CFTR) mutations in Southern Europe could be detected at the same time in single cells applying a modified and improved primer extension preamplification-PCR. Two different Taq polymerases were tested in isolated buccal cells heterozygous for several mutations. The protocol that gave statistically significant better results was also successful in oocytes and their first polar bodies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 The mutations assayed are: DF508, DI507, Q493X, V520F, 1717-1G.A, G542X, G551D, R560T, S459R, S459N and R553X labelled with FAM (blue), 3849þ10kbC.T, 3849 þ 4A . Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

[hide] Association of common haplotypes of surfactant pro... Pediatr Pulmonol. 2006 Mar;41(3):255-62. Choi EH, Ehrmantraut M, Foster CB, Moss J, Chanock SJ
Association of common haplotypes of surfactant protein A1 and A2 (SFTPA1 and SFTPA2) genes with severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2006 Mar;41(3):255-62., [PMID:16429424]

Abstract [show]
Most individual cystic fibrosis transmembrane conductance regulator (CFTR) mutations appear not to correlate directly with severity of lung damage in cystic fibrosis (CF). Components of innate immunity, namely, mannose-binding lectin (MBL2), and surfactant protein A1 and A2 genes (SFTPA1 and SFTPA2), were shown to be critical in pulmonary host defenses. A pilot association study was conducted to identify genetic modifiers of lung disease in adult patients with CF. The structural and promoter (-221x/y) variants of MBL2, variants at codons 19, 50, 62, and 219 of SFTPA1, and at codons 9, 91, and 223 for SFTPA2, were studied in 135 adults with CF and compared to their forced expired volume in 1 sec (FEV1), diffusion of CO (DLCO), and other pulmonary scores. Predicted FEV1 was significantly lower in adults with the SFTPA1 6A3 allele and SFTPA2 1A1) allele (P = 0.01 and 0.009, respectively). The extended haplotype 6A3/1A1, which includes SFTPA1 and SFTPA2, was associated with lower pulmonary function, using FEV1 (P = 0.005) and poor pulmonary scores which were determined by American Medical Association, American Thoracic Society, and modified Shwachman-Kulczycki scores. Lower FEV1 and DLCO values were associated with MBL2 coding variants in those who had the DeltaF508 CFTR mutation (P = 0.03 and 0.004, respectively). These results support the current hypothesis that variants in pulmonary host defense molecules are potentially genetic modifiers of pulmonary disease in CF. Further work in larger populations is required to provide important new insights into the pathogenesis of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Eleven subjects had rare mutations such as G551D/G551D, G551D/3659delC, G551D/I507, G551D/ Neg (2), E60X/Q493X, R1162X/G542X, W1282X/ W1282X (3), and 1717 À G > A/Neg. Login to comment

[hide] Detection of F508del mutation in cystic fibrosis t... Singapore Med J. 2006 Feb;47(2):129-33. Zilfalil BA, Sarina S, Liza-Sharmini AT, Oldfield NJ, Stenhouse SA
Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays.
Singapore Med J. 2006 Feb;47(2):129-33., [PMID:16435054]

Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is one of the common genetic disorders in the western world. It has been reported to be very rare in Asian populations. According to the Cystic Fibrosis Genetic Analysis Consortium, more than 1,000 mutations of the CF gene have been identified. The CF gene, named the cystic fibrosis transmembrane conductance regulator (CFTR), is located on chromosome 7 and composed of 27 exons. This study aims to detect possible CFTR gene mutations in Malays. METHODS: We analysed 50 blood samples from healthy Malays with no symptoms of CF. DNA was extracted from blood using commercially available extraction kits (Eppendorf, Germany). Identification of CFTR gene mutation was performed using the CF OLA (Oligonucleotide Ligation Assay) kit (Applied Biosystems, USA). The PCR-ligation products were electrophoresed on eight percent sequagel using an ABI PRISM 377 genetic analyser (Applied Biosystems, USA). Electrophoresis data was analysed using the Genotyper software and a report of the CF genotype for all loci tested was created using the CF Genotyper Template software. Out of 50, one sample (two percent) was detected to have the F508del mutation (3bp deletion at exon 10), which is one of the most common CFTR gene mutations in Caucasians. RESULTS: The F508del mutation allele was detected in one subject. This indicates that she was a CF carrier. CONCLUSION: We report the finding of a carrier of the F508del mutation of the CFTR gene in the Malay population. Our finding revealed that CF could also affect the Malay population. Larger studies are necessary to determine the exact gene frequency of this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes. Login to comment

[hide] Validation of cystic fibrosis mutation analysis us... Diagn Mol Pathol. 2007 Mar;16(1):57-9. Huang CK, Pan Q
Validation of cystic fibrosis mutation analysis using ABI 3130XL genetic analyzer.
Diagn Mol Pathol. 2007 Mar;16(1):57-9., [PMID:17471160]

Abstract [show]
Cystic fibrosis (CF) is one of the most common autosomal recessive diseases in the white population, with a prevalence estimate of 1 in 2500 to 3300 live births. CF is characterized by viscous mucus in the lungs with involvement of digestive and reproductive systems as well as sweat glands (excess salt loss). Treatment for CF patients is palliative. Over 1300 mutations have been identified in the CFTR gene. However, most of the mutations are at frequencies of <0.1% or represent private mutations. Although other methodologies are available for CF testing, the oligonucleotide ligation assay is a unique approach to mutation detection of point mutations, small deletions, and small insertions, and consists of 2 phases. Applied Biosystems 3130 Series Genetic Analyzers are the next-generation platform for low to medium throughput laboratories and deliver improved performance. One disadvantage of the Genetic Analyzers is that there is no template of instrument settings for POP-6 polymer using 36-cm array. The Abbott CF oligonucleotide ligation assay ASRs can be run only using POP-6 polymer. We are the first to have optimized the instrument settings for POP-6 polymer based on the template of Rapidseq36-POP6 for Abbott Diagnostics CF V3 ASRs. Several conditions were tried, and the conditions of sample injection voltage at 10,000 v and sample injection time at 5 seconds gave better results, which were with clearer peaks and lower background signals. Twenty cell line DNA samples from Coriell were analyzed, and the results were matched. In addition, Synthetic Controls from AcroMetrix were analyzed, and the results were same as expected. Also, about 1500 clinical samples were analyzed, and high-quality reportable results were obtained. In conclusion, our modified protocol is robust and reliable on this ABI 3130XL instrument.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Mutation controls: to specifically assess the detection of CF mutations, 20 cell line DNA samples with mutations of R553X, 3659delC/delF508, delF508/Q493X, 711+ 1G>T/621+1G>T, 621+1G>T/delF508, G85E/ 621+1G>T, R560T/delF508, A455E/621+1G>T, N1303K, W1282X, G551D/R553X, 2789+5G>A/ 2789+5G>A, 3849+10C>T/3849+10C>T, 1717-1G>A, delF508/delF508, R347P/G551D, R334W, V520F, R117H/delF508/5T/9T, or G542X/G542X, respectively, from the Coriell Cell Repositories were analyzed. Login to comment
60 Different Instrument Conditions of ABI 3130XL Genetic Analyzer Condition A Condition B Condition C Condition D Oven_Temperature (1C) 55 55 55 55 Poly_Fill_Vol (Steps) (Polymer Filling Volume) 6500 6500 6500 6500 Current_Stability (mA) (Running Current Stability) 5 5 5 5 PreRun_Voltage (kV) (Voltage for Pre-Run) 15 15 15 15 Pre_Run_Time (s) (Time for Pre-Run) 180 180 180 180 Injection_Voltage (kV) (Sample Injection Voltage) 10 5 5 10 Injection_Time (s) (Sample Injection Time) 5 5 10 10 Voltage_Number_Of_Steps (nK) (Voltage Increase Speed) 10 10 10 10 Voltage_Step_Interval (s) (Voltage Increase Interval) 60 60 60 60 Data_Delay_Time (s) 1 1 1 1 Run_Voltage (kV) (Running Voltage) 15 15 15 15 Run_Time (s) (Running Time) 1200 1200 1200 1200 Huang and Pan Diagn Mol Pathol Volume 16, Number 1, March 2007 r 2007 Lippincott Williams & Wilkins database results except Q493X, which is not covered by this assay (Fig. Login to comment

[hide] Serum zinc concentrations in cystic fibrosis patie... Biol Trace Elem Res. 2007 Oct;119(1):19-26. Van Biervliet S, Van Biervliet JP, Vande Velde S, Robberecht E
Serum zinc concentrations in cystic fibrosis patients aged above 4 years: a cross-sectional evaluation.
Biol Trace Elem Res. 2007 Oct;119(1):19-26., [PMID:17914215]

Abstract [show]
AIM: Assess the risk of zinc (Zn) deficiency in the older cystic fibrosis (CF) population. METHOD: Cross-sectional investigation of all CF patients above the age of 4 followed at the Ghent University center between 2002 and 2003. Data on age, weight, height z-score, pancreatic and pulmonary functions, chronic Pseudomonas infection, and CF transmembrane conductance regulator (CFTR) mutations were collected. Serum Zn, vitamins (vit) A and E, retinol-binding protein (RBP), albumin, sedimentation rate, total IgG, and cholesterol were determined. Serum Zn was compared with a local healthy control group (Van Biervliet et al., Biol Trace Elem Res 94:33-40, 2003) and with literature data (Hotz C, et al. Am J Clin Nutr 78:756-764, 2003). RESULTS: 101 patients (median age 16 years) were included. There was no difference in serum Zn concentration between CF patients and controls. In CF patients no difference in serum Zn concentration between pancreatic-sufficient or pancreatic-insufficient patients was seen. Serum Zn was not associated to nutritional status or height z-score. A significant association serum Zn to serum albumin (p < 0.0005) and to vit A (p < 0.01) was seen. No associations of serum Zn to serum vit E, RBP, cholesterol, or CFTR were present, but there is a significant association serum Zn to forced vital capacity (p < 0.01). Serum Zn was not associated to inflammatory parameters or chronic Pseudomonas infection. CONCLUSION: Comparison of CF patients with local controls revealed no significant differences. However, because persisting steatorrhea increases Zn loss (Easley et al., J Pediatr Gastroenterol Nutr 26:136-139, 1998) and 12.6% of our population has a serum Zn below the p value of 2.5 of the NHANES II study (Hotz C, et al. Am J Clin Nutr 78:756-764, 2003), there could remain an increased risk of Zn deficiency in some CF patients. Furthermore, the association with pulmonary function needs more investigation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Table 1 Genotype of the 101 CF Patients: Details of the CF Mutations and Classification into Two Groups Genotype Groups Genotype No of Patients A ΔF508/ΔF508 47 ΔF508/E60X 1 ΔF508/G542X 7 ΔF508/N1303K 3 ΔF508/Q493X 1 ΔF508/1717-1G→A 1 ΔF508/Y1092X 1 ΔF508/394delTT 1 ΔF508/R785X 1 ΔF508/R553X 1 ΔF508/ΔI507 1 394delTT/394delTT 1 N1303K/N1303K 2 B ΔF508/3849+10kbC-T 1 ΔF508/306ΔTAGA 1 ΔF508/S1251N 8 ΔF508/L927P 1 G458V/1717-1G→A 1 ΔF508/I336K 2 G542X/622-2 A→C 1 ΔF508/G970R 3 ΔF508/3272-26A→G 2 ΔF508/R117H 2 ΔF508/2789+5G→A 2 1717-1G->A/S1251N 1 G542X/G970R 1 394delTT/Y913C 1 N1303K/deletion exon 19 1 Unidentified/unidentified 2 3600+2insTA/2005 del T 1 ΔF508/1898+1G→A 1 Deletion exon 2/del exon 2 1 There was no difference according to gender or age. Login to comment

[hide] Snapback primer genotyping with saturating DNA dye... Clin Chem. 2008 Oct;54(10):1648-56. Epub 2008 Aug 1. Zhou L, Errigo RJ, Lu H, Poritz MA, Seipp MT, Wittwer CT
Snapback primer genotyping with saturating DNA dye and melting analysis.
Clin Chem. 2008 Oct;54(10):1648-56. Epub 2008 Aug 1., [PMID:18676584]

Abstract [show]
BACKGROUND: DNA hairpins have been used in molecular analysis of PCR products as self-probing amplicons. Either physical separation or fluorescent oligonucleotides with covalent modifications were previously necessary. METHODS: We performed asymmetric PCR for 40-45 cycles in the presence of the saturating DNA dye, LCGreen Plus, with 1 primer including a 5' tail complementary to its extension product, but without any special covalent modifications. Samples were amplified either on a carousel LightCycler for speed or on a 96/384 block cycler for throughput. In addition to full-length amplicon duplexes, single-stranded hairpins were formed by the primer tail "snapping back" and hybridizing to its extension product. High-resolution melting was performed on a HR-1 (for capillaries) or a LightScanner (for plates). RESULTS: PCR products amplified with a snapback primer showed both hairpin melting at lower temperature and full-length amplicon melting at higher temperature. The hairpin melting temperature was linearly related to the stem length (6-28 bp) and inversely related to the log of the loop size (17-135 bases). We easily genotyped heterozygous and homozygous variants within the stem, and 100 blinded clinical samples previously typed for F5 1691G>A (Leiden) were completely concordant by snapback genotyping. We distinguished 7 genotypes in 2 regions of CFTR exon 10 with symmetric PCR using 2 snapback primers followed by product dilution to favor intramolecular hybridization. CONCLUSIONS: Snapback primer genotyping with saturating dyes provides the specificity of a probe with only 2 primers that are free of special covalent labels in a closed-tube system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
194 The longer snapback 2 covered the Q493X variant and melted between 66 and 72 °C. Login to comment
196 Samples included wild type (circles), compound F508del/Q493X heterozygote (connected small diamonds), I506V heterozygote (small diamonds), F508C heterozygote (small squares), I507del heterozygote (large squares), F508del heterozygote (connected large diamonds), and F508del homozygote (connected squares). Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2009 Oct;30(5):531-8. Epub 2009 Sep 16. Lommatzsch ST, Aris R
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2009 Oct;30(5):531-8. Epub 2009 Sep 16., [PMID:19760540]

Abstract [show]
Cystic fibrosis (CF) is a complicated disease involving many organ systems. Identification of the cystic fibrosis transmembrane regulator (CFTR) genetic code has not only enhanced our understanding of the mechanism of CF pathology but has also provided explanations for phenotypic variation. Additionally, genetic testing has refined our ability to identify patients with CF and CF-related illnesses. Genetic mutations may be grouped by class (I-VI) and are directly related to the quantity of CFTR protein produced. This has direct implications regarding the severity of disease and has suggested organ-specific sensitivity to the presence of normally functioning CFTR. Further, it has improved understanding of the mechanism behind seemingly organ-specific manifestations of CF, such as congenital bilateral absence of the vas deferens (CBVAD).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 They also found an association with ~F508 and R117H in addition to Q493X, R560T, R553X, and 621 þ 1(G!T).34 Noone et al found an association between chronic pancreatitis and the 5T allele associated with complex alleles or in CFTR compound heterozygotes, but no significantly increased frequency has been found with the 5T allele alone.36,39 Finally, there appears to be an additive effect with being a CFTR compound heterozygote and the presence of N34S mutations of the pancreatic secretory trypsin inhibitor (PSTI).36,39 These studies demonstrate the increased risk of chronic pancreatitis due to an abnormally functioning CFTR protein (but may be due to just one mutant CFTR allele37 ). Login to comment

[hide] Cystic fibrosis genotype and assessing rates of de... Radiology. 2009 Dec;253(3):813-21. Cleveland RH, Zurakowski D, Slattery D, Colin AA
Cystic fibrosis genotype and assessing rates of decline in pulmonary status.
Radiology. 2009 Dec;253(3):813-21., [PMID:19952026]

Abstract [show]
PURPOSE: To evaluate the hierarchical phenotypic expression of cystic fibrosis transmembrane conductance regulator (CFTR) genotypes in the respiratory system as has been documented in the pancreas. MATERIALS AND METHODS: This study was institutional review board approved; informed consent was not required. HIPAA guidelines were followed. Genotype effects were assessed by using chest radiographic and pulmonary function test (PFT) results in 93 patients. Serial chest radiographic and PFT (percentage of predicted forced expiratory volume in 1 second [FEV(1)], percentage of predicted forced vital capacity [FVC]) results were compared by using analysis of variance with repeated measures. By using CFTR class of mutations, two groups were created: group S (severe disease) and group M (mild disease). Within group S, three subgroups were created: A consisted of patients with two class I alleles; B, class I allele and class II or III allele; C, class II allele and class II or III allele. Group M consisted of patients with at least one allele from class IV-VI. RESULTS: Within group S, subgroup A had a faster deterioration than B or C according to radiographic data (A vs B, P = .014; A vs C, P = .009), with only a borderline difference in FEV(1) for subgroups A versus C (P = .031). Otherwise, PFTs were not sensitive for distinguishing subgroups. Only radiographic results identified that subgroup B had faster progression than C (P = .003); all parameters had trends of decline in the same direction. Group S had a faster decline than group M (radiography, P = .005; FVC, P = .011; FEV(1), P = .529). CONCLUSION: Disease progressed more rapidly with gene class hierarchical correlations seen in pancreatic disease. Radiography was more sensitive for identifying differences.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Measurement Tools All chest radiographic, FEV1, and FVC studies were performed at the study institution during the observed life spans Table 2 Patients according to CF Genotype Group Parameter Genotype Class Pancreatic Exocrine Status* No. of Patients Group S (severe pancreatic and pulmonary phenotypes) Subgroup A (class I and class I) 5 G542X/W1282X I/I PI 2 W1282X/W1282X I/I PI 1 621ϩ1G-T/Y1092X I/I PI 1 3120ϩ1G-A/3120ϩ1G-A I/I PI 1 Subgroup B (class I and class II or III) 16 G542X/⌬F508 I/II PI 6 W1282X/⌬F508 I/II PI 3 Q493X/⌬F508 I/II PI 2 R553X/⌬F508 I/II PI 2 1717-1G/⌬F508 I/II PI 1 621ϩ1G-T/⌬F508 I/II PI 1 2184delA/G551D I/III PI 1 Subgroup C (class II and class II or III) 68 D1507/⌬F508 II/II PI 3 N1303K/⌬F508 II/II PI 2 ⌬F508/⌬F508 II/II PI 57 G551D/⌬F508 II/III PI 6 Group M (mild pancreatic and pulmonary phenotypes) Miscellaneous severe and miscellaneous mild 4 ⌬F508/G85E II/IV PS 2 ⌬F508/R117H II/IV PS 1 D1507/R352Q II/IV PS 1 Miscellaneous mild and miscellaneous mild . Login to comment

[hide] Ataluren (PTC124) induces cystic fibrosis transmem... Am J Respir Crit Care Med. 2010 Nov 15;182(10):1262-72. Epub 2010 Jul 9. Sermet-Gaudelus I, Boeck KD, Casimir GJ, Vermeulen F, Leal T, Mogenet A, Roussel D, Fritsch J, Hanssens L, Hirawat S, Miller NL, Constantine S, Reha A, Ajayi T, Elfring GL, Miller LL
Ataluren (PTC124) induces cystic fibrosis transmembrane conductance regulator protein expression and activity in children with nonsense mutation cystic fibrosis.
Am J Respir Crit Care Med. 2010 Nov 15;182(10):1262-72. Epub 2010 Jul 9., 2010-11-15 [PMID:20622033]

Abstract [show]
RATIONALE: Nonsense (premature stop codon) mutations in mRNA for the cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis (CF) in approximately 10% of patients. Ataluren (PTC124) is an oral drug that permits ribosomes to readthrough premature stop codons in mRNA to produce functional protein. OBJECTIVES: To evaluate ataluren activity, safety, and pharmacokinetics in children with nonsense mutation CF. METHODS: Patients were assessed in two 28-day cycles, comprising 14 days on and 14 days off ataluren. Patients took ataluren three times per day (morning, midday, and evening) with randomization to the order of receiving a lower dose (4, 4, and 8 mg/kg) and a higher dose (10, 10, and 20 mg/kg) in the two cycles. MEASUREMENTS AND MAIN RESULTS: The study enrolled 30 patients (16 male and 14 female, ages 6 through 18 yr) with a nonsense mutation in at least one allele of the CFTR gene, a classical CF phenotype, and abnormal baseline nasal epithelial chloride transport. Ataluren induced a nasal chloride transport response (at least a -5-mV improvement) or hyperpolarization (value more electrically negative than -5 mV) in 50% and 47% of patients, respectively, with more hyperpolarizations at the higher dose. Improvements were seen in seven of nine nonsense mutation genotypes represented. Ataluren significantly increased the proportion of nasal epithelial cells expressing apical full-length CFTR protein. Adverse events and laboratory abnormalities were infrequent and usually mild. Ataluren pharmacokinetics were similar to those in adults. CONCLUSIONS: In children with nonsense mutation CF, ataluren can induce functional CFTR production and is well tolerated.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
154 BASELINE PATIENT CHARACTERISTICS Characteristic N 5 30 Age, median, yr (range) 12 (6 to 18) Sex, n Male 16 Female 14 BMI, median % predicted*(range) 35 (,1 to 97) Sweat test chloride concentration, median, mEq/L† (range) 104 (84 to 140) TEPD Total chloride transport, median, mV‡ (range) 20.3 (24.6 to 114.6) Pulmonary function, mean % predictedx FEV1 (range) 90 (40 to 133) FVC (range) 99 (52 to 131) Pathologic bacterial/fungal colonization, n 30 Staphylococcus aureus 26 Pseudomonas aeruginosa 9 Hemophilus influenzae 3 Alcaligenes xylosoxidans 1 Stenotrophomonas maltophilia 1 Pancreatic insufficiency, n 30 Exocrine 30 Endocrine 2 Liver enzyme abnormalities, n 15 Alkaline phosphatase 7 Lactate dehydrogenase 6 g-Glutamyltransferase 4 Alanine aminotransferase 4 Aspartate aminotransferase 2 Bilirubin 1 Nonsense mutation genotype (premature stop codon type), n G542Xk (UGA) 14 W1282X (UGA) 4 Q493X (UAG) 3 R553X (UGA) 2 E1104X (UGA) 2 R1162Xk (UGA) 2 W846X (UGA) 1 W882X (UAG) 1 Q1313X (UAA) 1 Definition of Abbreviations: BMI 5 body mass index; TEPD 5 transepithelial potential difference. Login to comment
189 TOTAL CHLORIDE TRANSPORT RESPONSE AND HYPERPOLARIZATION BY NONSENSE MUTATION TYPE Nonsense Mutation Type Responses* n/N† % Response Rate Hyperpolarizations‡ n/N† % Hyperpolarization Rate Q493X (UAG) 1/3 33 1/3 33 G542X (UGA) 8/14 57 7/14 50 R553X (UGA) 1/2 50 1/2 50 W846X (UGA) 0/1 0 0/1 0 W882X (UAG) 1/1 100 1/1 100 E1104X (UGA) 1/2 50 0/2 0 R1162X (UGA) 1/2 50 2/2 100 W1282X (UGA) 2/4 50 2/4 50 Q1313X (UAA) 0/1 0 0/1 0 * At least a 25 mV total chloride transport improvement in either cycle. Login to comment
235 Our findings indicate that multiple genotypes (Q493X, G542X, R553X, W882X, E1104X, R1162X, and W1282X) can be responsive to ataluren therapy. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Comprehensive description of CFTR genotypes and ul... Hum Genet. 2011 Apr;129(4):387-96. Epub 2010 Dec 24. de Becdelievre A, Costa C, Jouannic JM, LeFloch A, Giurgea I, Martin J, Medina R, Boissier B, Gameiro C, Muller F, Goossens M, Alberti C, Girodon E
Comprehensive description of CFTR genotypes and ultrasound patterns in 694 cases of fetal bowel anomalies: a revised strategy.
Hum Genet. 2011 Apr;129(4):387-96. Epub 2010 Dec 24., [PMID:21184098]

Abstract [show]
Fetal bowel anomalies may reveal cystic fibrosis (CF) and the search for CF transmembrane conductance regulator (CFTR) gene mutations is part of the diagnostic investigations in such pregnancies, according to European recommendations. We report on our 18-year experience to document comprehensive CFTR genotypes and correlations with ultrasound patterns in a series of 694 cases of fetal bowel anomalies. CFTR gene analysis was performed in a multistep process, including search for frequent mutations in the parents and subsequent in-depth search for rare mutations, depending on the context. Ultrasound patterns were correlated with the genotypes. Cases were distinguished according to whether they had been referred directly to our laboratory or after an initial testing in another laboratory. A total of 30 CF fetuses and 8 cases compatible with CFTR-related disorders were identified. CFTR rearrangements were found in 5/30 CF fetuses. 21.2% of fetuses carrying a frequent mutation had a second rare mutation, indicative of CF. The frequency of CF among fetuses with no frequent mutation was 0.43%. Correlation with ultrasound patterns revealed a significant frequency of multiple bowel anomalies in CF fetuses. The results emphasize the need to search for rearrangements in the diagnosis strategy of fetal bowel anomalies. The diagnostic value of ultrasound patterns combining hyperechogenic bowel, loop dilatation and/or non-visualized gallbladder reveals a need to revise current strategies and to offer extensive CFTR gene testing when the triad is diagnosed, even when no frequent mutation is found in the first-step analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 [Q493X] c.[1521_1523delCTT]? Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... N Engl J Med. 1998 Sep 3;339(10):645-52. Sharer N, Schwarz M, Malone G, Howarth A, Painter J, Super M, Braganza J
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
N Engl J Med. 1998 Sep 3;339(10):645-52., 1998-09-03 [PMID:9725921]

Abstract [show]
BACKGROUND: The pancreatic lesions of cystic fibrosis develop in utero and closely resemble those of chronic pancreatitis. Therefore, we hypothesized that mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene may be more common than expected among patients with chronic pancreatitis. METHODS: We studied 134 consecutive patients with chronic pancreatitis (alcohol-related disease in 71, hyperparathyroidism in 2, hypertriglyceridemia in 1, and idiopathic disease in 60). We examined DNA for 22 mutations of the CFTR gene that together account for 95 percent of all mutations in patients with cystic fibrosis in the northwest of England. We also determined the length of the noncoding sequence of thymidines in intron 8, since the shorter the sequence, the lower the proportion of normal CFTR messenger RNA. RESULTS: The 94 male and 40 female patients ranged in age from 16 to 86 years. None had a mutation on both copies of the CFTR gene. Eighteen patients (13.4 percent), including 12 without alcoholism, had a CFTR mutation on one chromosome, as compared with a frequency of 5.3 percent among 600 local unrelated partners of persons with a family history of cystic fibrosis (P<0.001). A total of 10.4 percent of the patients had the 5T allele in intron 8 (14 of 134), which is twice the expected frequency (P=0.008). Four patients were heterozygous for both a CFTR mutation and the 5T allele. Patients with a CFTR mutation were younger than those with no mutations (P=0.03). None had the combination of sinopulmonary disease, high sweat electrolyte concentrations, and low nasal potential-difference values that are diagnostic of cystic fibrosis. CONCLUSIONS: Mutations of the CFTR gene and the 5T genotype are associated with chronic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 DNA Studies We extracted DNA from buccal cells obtained by having the patients rinse their mouths with 10 ml of 4 percent sucrose.19 The CFTR locus was examined for the 22 mutations that together account for 95 percent of all such mutations in patients with cystic fibrosis in the northwest of England.20 The amplification- refractory mutation system Elucigene CF(4)m kit (Zeneca Diagnostics, Macclesfield, United Kingdom) was used to detect the four most common mutations: ∆F508, G551D, G542X, and 621+1(G→T)21; the polymerase chain reaction, restriction-enzyme analysis, and allele-specific oligonucleotide hybridization facilitated the detection of R560T, R117H, 1898+1(G→A), R553X, S549N, 1717¡1(G→A), N1303K, W1282X, E60X, 1154insTC, R347P, 3659delC, Q493X, V520F, R334W, ∆I507, 3849+10Kb(C→T), and 1078delT. Login to comment
66 * PATIENT NO.† SEX MUTANT ALLELE POLYT GENOTYPE AGE AT ONSET OF PANCREATITIS AGE AT STUDY ENTRY EXOCRINE STATUS AND CALCULI‡ ALCOHOLISM »10 CIGARETTES/ DAY SWEAT TESTING BASE-LINE NASAL POTENTIAL DIFFERENCE SODIUM CHLORIDE yr mmol/liter mV 1 M DF508 9T/7T 8 27 PS0 No No 43.5 32.0 12.5 2 F DF508 9T/5T 15 34 PS1 No No 55.0 47.5 ND 3 M R117H 7T/7T 18 21 PS0 No Yes 44.0 33.0 ¡9.7 4 M DF508 9T/7T 18 26 PI3 No No ND ND ND 5 M DF508 9T/7T 18 30 PI3 No Yes ND ND ND 6 F Q493X 7T/5T 19 21 PS3 No Yes 51.5 41.0 ND 7 F DF508 9T/7T 20 31 PS3 No No 35.0 23.0 ¡10.8 8 M 621+1(G→T) 9T/7T 21 37 PS3 Yes Yes 72.0 48.5 5.0 9 M R560T 7T/7T 21 39 PI0 Yes Yes 103.0 76.0 ¡4.4 10 M DF508 9T/5T 22 36 PI3 Yes No 53.0 34.0 ¡17.6 11 M DF508 9T/7T 31 45 PS3 No Yes 55.0 34.0 ¡11.5 12 M R117H 7T/7T 35 38 PI2 Yes No ND ND ND 13 F DF508 9T/7T 36 39 PS3 No Yes 60.0 39.0 ¡10.2 14 F R553X 7T/5T 37 56 PI3 No Yes ND ND ND 15 F DF508 9T/7T 45 47 PI3 Yes Yes 104.0 80.0 ¡8.3 16 M DF508 9T/7T 49 52 PS1 Yes Yes ND ND ND 17 F DF508 9T/7T 64 76 PI3 No No 69.0 50.0 ¡10.3 18 F DF508 9T/9T 75 79 PS3 No No 34.5 19.0 ¡14.7 or radiologic abnormalities in 133 patients. Login to comment

[hide] Clinical outcome of preimplantation genetic diagno... Eur J Hum Genet. 2007 Jul;15(7):752-8. Epub 2007 Apr 18. Keymolen K, Goossens V, De Rycke M, Sermon K, Boelaert K, Bonduelle M, Van Steirteghem A, Liebaers I
Clinical outcome of preimplantation genetic diagnosis for cystic fibrosis: the Brussels' experience.
Eur J Hum Genet. 2007 Jul;15(7):752-8. Epub 2007 Apr 18., [PMID:17440499]

Abstract [show]
Preimplantation genetic diagnosis is an alternative for prenatal diagnosis that makes it possible to perform the diagnosis of a chromosomal or monogenic disorder at the preimplantation embryo level. Cystic fibrosis is one of the monogenic diseases for which PGD can be performed. In this study, we looked at the requests and PGD cycles for this particular disorder over an 11-year period. Sixty-eight percent of the requests eventually led to at least one complete PGD cycle. In 80% of the cycles, an embryo transfer was performed and an ongoing pregnancy was obtained in 22.2% of the cycles with oocyte retrieval. After embryo transfer, a couple had 27.8% chance of giving birth to a liveborn child. No misdiagnosis was recorded. The rate of perinatal deaths/stillborn children was relatively high, but no excess of major congenital anomalies was observed in the surviving children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 2 p.F508del/- p.N1303K/- 1 p.Q493X/- p.F508del/- 1 p.F508del/- p.R1162X/- 1 p.4218insT/- p.N1303K/- 1 p.G673X/- p.F508del/- 1 p.W1282X/- p.G542X/- 1 p.F508del/- p.W1282X/- 1 p.W1282X/- p.F508del/- 2 p.F508del/- p.G551D/- 1 p.D1168G/- p.L206W/- 1 If we express these results per cycle with oocyte retrieval, this means that in each cycle there was an average of 12.5 COCs, giving 5.1 embryos to be biopsied with an 80% chance of having an embryo transfer and a 22.2% chance of having an ongoing pregnancy with the delivery of a child. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] A microRNA network regulates expression and biosyn... Proc Natl Acad Sci U S A. 2012 Aug 14;109(33):13362-7. doi: 10.1073/pnas.1210906109. Epub 2012 Aug 1. Ramachandran S, Karp PH, Jiang P, Ostedgaard LS, Walz AE, Fisher JT, Keshavjee S, Lennox KA, Jacobi AM, Rose SD, Behlke MA, Welsh MJ, Xing Y, McCray PB Jr
A microRNA network regulates expression and biosynthesis of wild-type and DeltaF508 mutant cystic fibrosis transmembrane conductance regulator.
Proc Natl Acad Sci U S A. 2012 Aug 14;109(33):13362-7. doi: 10.1073/pnas.1210906109. Epub 2012 Aug 1., [PMID:22853952]

Abstract [show]
Production of functional proteins requires multiple steps, including gene transcription and posttranslational processing. MicroRNAs (miRNAs) can regulate individual stages of these processes. Despite the importance of the cystic fibrosis transmembrane conductance regulator (CFTR) channel for epithelial anion transport, how its expression is regulated remains uncertain. We discovered that miRNA-138 regulates CFTR expression through its interactions with the transcriptional regulatory protein SIN3A. Treating airway epithelia with an miR-138 mimic increased CFTR mRNA and also enhanced CFTR abundance and transepithelial Cl(-) permeability independent of elevated mRNA levels. An miR-138 anti-miR had the opposite effects. Importantly, miR-138 altered the expression of many genes encoding proteins that associate with CFTR and may influence its biosynthesis. The most common CFTR mutation, DeltaF508, causes protein misfolding, protein degradation, and cystic fibrosis. Remarkably, manipulating the miR-138 regulatory network also improved biosynthesis of CFTR-DeltaF508 and restored Cl(-) transport to cystic fibrosis airway epithelia. This miRNA-regulated network directs gene expression from the chromosome to the cell membrane, indicating that an individual miRNA can control a cellular process more broadly than recognized previously. This discovery also provides therapeutic avenues for restoring CFTR function to cells affected by the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 We also expressed a recombinant CMV promoter-driven CFTR-ΔF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41). Login to comment
161 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments. Login to comment
110 We also expressed a recombinant CMV promoter-driven CFTR-ƊF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41). Login to comment
159 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments. Login to comment

[hide] Cystic fibrosis mutations for p.F508del compound h... Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29. Sebro R, Levy H, Schneck K, Dimmock D, Raby B, Cannon C, Broeckel U, Risch N
Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency.
Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29., [PMID:22035343]

Abstract [show]
Sebro R, Levy H, Schneck K, Dimmock D, Raby BA, Cannon CL, Broeckel U, Risch NJ. Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency. Cystic fibrosis (CF) is a monogenetic disease with a complex phenotype. Over 1500 mutations in the CFTR gene have been identified; however, the p.F508del mutation is most common. There has been limited correlation between the CFTR mutation genotype and the disease phenotypes. We evaluated the non-p.F508del mutation of 108 p.F508del compound heterozygotes using the biological classification method, Grantham and Sorting Intolerant from Tolerant (SIFT) scores to assess whether these scoring systems correlated with sweat chloride levels, pancreatic sufficiency, predicted FEV(1) , and risk of infection with Pseudomonas aeruginosa in the last year. Mutations predicted to be 'mild' by the biological classification method are associated with more normal sweat chloride levels (p < 0.001), pancreatic sufficiency (p < 0.001) and decreased risk of infection with Pseudomonas in the last year (p = 0.014). Lower Grantham scores are associated with more normal sweat chloride levels (p < 0.001), and pancreatic sufficiency (p = 0.014). Higher SIFT scores are associated with more normal sweat chloride levels (p < 0.001) and pancreatic sufficiency (p = 0.011). There was no association between pulmonary function measured by predicted FEV(1) and the biological classification (p = 0.98), Grantham (p = 0.28) or SIFT scores (p = 0.62), which suggests the pulmonary disease related to CF may involve other modifier genes and environmental factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 CFTR mutation classification for compound heterozygotesa Mutations n (%) Biological classification Grantham score SIFT Q493X 3 (3) Ib - - G542X 21 (20) Ib,c,e - - R553X 4 (4) Ib,e - - Y1092X 2 (2) Ib - - R1158X 1 (1) NA - - W1282X 9 (9) Ib,e - - G85E 4 (4) IIIb 98 0.01 R117H 4 (4) IVb,c 29 0.60 R334W 1 (1) IVb 101 0.02 R347P 1 (1) IVb 103 0.05 R352Q 1 (1) NA 43 0.35 G551D 20 (19) IIIb,c 94 0.00 R560T 3 (3) IIIb 71 0.00 D1270N 1 (1) NA 23 0.01 N1303K 6 (6) IIg 94 0.00 I507del 3 (3) IId - - 394delTT 1 (1) NAc - - 621+1G>T 7 (7) Ib,f - - 711+1G>T 2 (2) Ib - - 1717-1G>A 5 (5) Ib,c,e,f - - 1898+1G>A 2 (2) NA - - 2789+5G>A 3 (3) Vb - - 3659delC 1 (1) Ib - - 3849+10kbC>T 2 (2) Vb,c,f - - 3905insT 1 (1) Ib - - NA, not applicable; SIFT, Sorting Intolerant from Tolerant. a The following mutations biological classification scores could not be verified: 1898+G-A, 394delTT, D1270N, R352Q, and R1158X. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Microsphere bead arrays and sequence validation of... J Mol Diagn. 2004 Nov;6(4):348-55. Hadd AG, Laosinchai-Wolf W, Novak CR, Badgett MR, Isgur LA, Goldrick M, Walkerpeach CR
Microsphere bead arrays and sequence validation of 5/7/9T genotypes for multiplex screening of cystic fibrosis polymorphisms.
J Mol Diagn. 2004 Nov;6(4):348-55., [PMID:15507674]

Abstract [show]
The development of simple and rapid methods for the detection of the common genetic mutations associated with cystic fibrosis (CF) requires access to positive-control samples including the 5/7/9T variants of intron 8. We used PCR and a simple multiplex bead-array assay to identify 5/7/9T control samples from 29 commercially available DNA samples. Unpurified PCR products were directly hybridized to color-coded beads containing allele-specific capture probes for 5/7/9T detection. The performance of the assay was investigated using reverse-complement oligonucleotides, individual PCR products, and multiplex PCR products for 5/7/9T detection within a complex CFTR screening assay. Samples were genotyped by grouping the relative signal intensities from each capture probe. Of 29 commercially available DNA samples analyzed, 2 5T/7T, 2 5T/9T, 9 7T/9T, 11 7T/7T, and 5 9T/9T genotypes were identified. The genotype within each sample group was confirmed by DNA sequencing. The assay was compatible with the analysis of 10 to 1000 ng of genomic DNA isolated from whole blood and allowed for the separate identification of primary CFTR mutations from reflex variants. The correct identification of positive controls demonstrated the utility of a simple bead-array assay and provided accessible samples for assay optimization and for routine quality control in the clinical laboratory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
197 Intron 8 Genotype by Coriell Number, Characterized CF Mutation and Allele Fraction for 5/7/9T Intron 8 genotype Coriell sample Characterized mutation Allele fraction by probe 5T 7T 9T 7T/7T NA09947 Normal 0.04 0.93 0.03 NA11277 ⌬I507/normal 0.06 0.90 0.04 NA11761 G551D/R553X 0.06 0.92 0.02 NA11859 2789ϩ5GϾA/2789ϩ5GϾA 0.02 0.96 0.02 NA11860 3849ϩ10kbCϾT/3849ϩ10kbCϾT 0.03 0.94 0.03 NA12444 1717-1GϾT/normal 0.06 0.87 0.07 NA12585 R1162X/normal 0.07 0.86 0.08 NA12785 R347P/G551D 0.04 0.92 0.05 NA12960 R334W/normal 0.06 0.92 0.02 NA12961 V520F/normal 0.06 0.89 0.05 NA13033 F508C/normal 0.03 0.93 0.04 9T/9T NA01531 ⌬F508/⌬F508 0.14 0.04 0.82 NA11281 621ϩ1GϾT/⌬F508 0.14 0.04 0.82 NA11283 A455E/⌬F508 0.13 0.05 0.82 NA11290 A455E/621ϩ1GϾT 0.12 0.01 0.87 NA11496 G542X/G542X 0.14 0.05 0.81 5T/7T NA11723 W1282X/normal 0.53 0.44 0.03 NA13032 I506V/normal 0.58 0.39 0.03 5T/9T NA11279 129GϾC/⌬F508 0.51 0.00 0.49 NA13591 R117H/⌬F508 0.52 0.00 0.48 7T/9T NA07441 3120ϩ1GϾA/621ϩ1GϾA 0.08 0.41 0.51 NA07552 R553X/⌬F508 0.09 0.36 0.55 NA07830 556dA/⌬F508 0.11 0.37 0.52 NA11275 3659dC/⌬F508 0.10 0.37 0.53 NA11278 Q493X/⌬F508 0.09 0.38 0.53 NA11280 711ϩ1GϾT/621ϩ1GϾA 0.09 0.37 0.54 NA11282 G85E/621ϩ1GϾA 0.07 0.39 0.53 NA11284 R560T/⌬F508 0.08 0.39 0.52 NA11472 N1303K/G1349D 0.08 0.39 0.54 Figure 3. Login to comment

[hide] Cystic fibrosis and related diseases of the pancre... Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26. Naruse S, Kitagawa M, Ishiguro H, Fujiki K, Hayakawa T
Cystic fibrosis and related diseases of the pancreas.
Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26., [PMID:12079272]

Abstract [show]
The discovery of the gene for cystic fibrosis (CF), the cystic fibrosis transmembrane conductance regulator (CFTR), brought about a new era in the study of this disease. Identification of the molecular target has yielded a flood of data that add to our understanding of the pathogenesis, diagnosis and treatment of CF. The CFTR protein is a cAMP-regulated Cl(-) channel with multiple functions in epithelial cells. In the exocrine pancreas the CFTR plays a key role in the apical Cl(-), HCO(3)(-), and water transport in duct cells. The severe loss of functions, caused by mutations of the CFTR gene, leads to pathological lesions of the pancreas. Over 1200 CFTR mutations and polymorphisms have been identified and their diversity may explain the high level of heterogeneity in the CF phenotype. Mutation analyses of the CFTR gene have revealed a spectrum of CFTR-related diseases that do not fit the classical CF picture but are associated with dysfunction of CFTR, such as chronic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic ®brosis of the pancreas'. Login to comment
64 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuQciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 W 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic &#ae;brosis of the pancreas'. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment

[hide] Cystic fibrosis: a multiple exocrinopathy caused b... Am J Med. 1998 Jun;104(6):576-90. Schwiebert EM, Benos DJ, Fuller CM
Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein.
Am J Med. 1998 Jun;104(6):576-90., [PMID:9674722]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
223 They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X). Login to comment

[hide] Correlation between nasal potential difference mea... Eur Respir J. 1997 Sep;10(9):2018-22. Ho LP, Samways JM, Porteous DJ, Dorin JR, Carothers A, Greening AP, Innes JA
Correlation between nasal potential difference measurements, genotype and clinical condition in patients with cystic fibrosis.
Eur Respir J. 1997 Sep;10(9):2018-22., [PMID:9311495]

Abstract [show]
In cystic fibrosis (CF), the clinical condition of patients correlates poorly with genotype. One possible explanation is that clinical status is influenced by net preserved chloride secretion rather than the CF mutation. We tested the relationships between residual chloride secretion, as measured by nasal potential difference (PD) and the type of mutation (genotypes expressing apical cystic fibrosis transmembrane conductance regulator (CFTR) protein versus those that do not) and clinical status. Twenty two CF patients (mean age 25.7 yrs, 11 females and 11 males, mean forced expiratory volume in one second (FEV1) 53.1% of predicted) with defined genotypes were recruited. Nasal PD was measured using a standard protocol involving the perfusion of the nasal epithelium with a sodium channel blocker (amiloride), followed by a solution of low chloride and finally with isoprenaline. Patients with apical CFTR protein showed higher residual chloride secretion than those without (amiloride to isoprenaline value of 4.59 and 0.56 mV, respectively, p = 0.01). There was no correlation between mutation type and clinical condition. When these patients were recategorized as "high" (> 10 mV amiloride to isoprenaline response) or "low" (10 mV or less) chloride secretors, we found that the former group had a significantly higher FEV1 (67.7 versus 48.3% pred) and a better pulmonary radiological score (4.14 versus 7.07, by Northern scoring system). These results suggest that some cystic fibrosis patients, regardless of genotype, have an ability to secrete chloride when stimulated with chloride secretatagogues, and this is correlated with a better lung function. These results also have implications for the use of potential difference measurements in novel cystic fibrosis transmembrane conductance regulator replacement trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Data analysis Patients were divided into two groups, according to genotype: 1) mutations that fail to generate significant apical membrane protein (∆F508/∆F508, ∆F508/ W1282X, ∆F508/Q493X) and 2) mutations where gene product is present in the apical membrane (∆F508/G551D, ∆F508/ A455E, ∆F508/R117H, G551D/G551D) [12]. Login to comment

[hide] Evidence for safety and efficacy of DOTAP cationic... Gene Ther. 1997 Mar;4(3):210-8. Porteous DJ, Dorin JR, McLachlan G, Davidson-Smith H, Davidson H, Stevenson BJ, Carothers AD, Wallace WA, Moralee S, Hoenes C, Kallmeyer G, Michaelis U, Naujoks K, Ho LP, Samways JM, Imrie M, Greening AP, Innes JA
Evidence for safety and efficacy of DOTAP cationic liposome mediated CFTR gene transfer to the nasal epithelium of patients with cystic fibrosis.
Gene Ther. 1997 Mar;4(3):210-8., [PMID:9135734]

Abstract [show]
In cystic fibrosis (CF), mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene results in defective transepithelial ion transport, leading to life shortening inflammatory lung disease. Before lung studies, we tested the safety and efficacy of gene delivery to the nasal epithelium of CF patients using pCMV-CFTR-DOTAP cationic liposome complex. A single dose of 400 micrograms pCMV-CFTR:2.4 mg DOTAP was administered in a randomised, double-blinded fashion to the nasal epithelium of eight CF patients, with a further eight receiving buffer only. Patients were monitored for signs and symptoms for 2 weeks before treatment and 4 weeks after treatment. Inflammatory cells were quantified in a nasal biopsy taken 3 days after treatment. There was no evidence for excess nasal inflammation, circulating inflammatory markers or other adverse events ascribable to active treatment. Gene transfer and expression were assayed by the polymerase chain reaction. Transgene DNA was detected in seven of the eight treated patients up to 28 days after treatment and vector derived CFTR mRNA in two of the seven patients at +3 and +7 days. Transepithelial ion transport was assayed before and after treatment by nasal potential difference during drug perfusion and by SPQ fluorescence halide ion conductance. Partial, sustained correction of CFTR-related functional changes toward normal values were detected in two treated patients. The level of gene transfer and functional correction were comparable to those reported previously using adenoviral vectors or another DNA-liposome complex, but here were sustained and uncompromised by false positives. These results justify further studies with pCMV-CFTR-DOTAP aimed at treating CF lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Table 1 Anthropometric data Group Patient Gender Age Genotype FEV1 No (% predicted) Placebo 03 Female 33 ⌬F508/R117H 57 06 Male 27 ⌬F508/⌬F508 55 08 Female 29 ⌬F508/A455E 97 11 Female 42 ⌬F508/Q493X 24 15 Male 30 ⌬F508/R560T 20 16 Female 20 ⌬F508/⌬F508 70 18 Female 27 ⌬F508/⌬F508 21 21 Female 20 ⌬F508/⌬F508 20 Mean (s.d.) 6F, 2M 28.5 (7.1) 51.9 (28.1) Treated 01 Male 31 ⌬F508/G551D 45 05 Female 30 ⌬F508/⌬F508 91 09 Male 32 G551D/G551D 37 10 Female 29 ⌬F508/⌬F508 63 13 Male 16 ⌬F508/⌬F508 55 14 Female 37 ⌬F508/G551D 66 19 Male 23 ⌬F508/W1282X 37 23 Female 21 ⌬F508/G551D 53 Mean (s.d.) 4F, 4M 27.4 (6.8) 55.9 (17.8) and illustrative results shown in Figure 3. Login to comment

[hide] A placebo-controlled study of liposome-mediated ge... Gene Ther. 1997 Mar;4(3):199-209. Gill DR, Southern KW, Mofford KA, Seddon T, Huang L, Sorgi F, Thomson A, MacVinish LJ, Ratcliff R, Bilton D, Lane DJ, Littlewood JM, Webb AK, Middleton PG, Colledge WH, Cuthbert AW, Evans MJ, Higgins CF, Hyde SC
A placebo-controlled study of liposome-mediated gene transfer to the nasal epithelium of patients with cystic fibrosis.
Gene Ther. 1997 Mar;4(3):199-209., [PMID:9135733]

Abstract [show]
Cystic fibrosis (CF) is a common, serious, inherited disease. The major cause of mortality in CF is lung disease, due to the failure of airway epithelial cells to express a functional product of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. A potential treatment for CF lung disease is the expression of CFTR in the airways following gene transfer. We have undertaken a double-blinded, placebo-controlled, clinical study of the transfer of the CFTR cDNA to the nasal epithelium of 12 CF patients. Cationic liposomes complexed with plasmid containing the human CFTR cDNA were administered to eight patients, whilst four patients received placebo. Biopsies of the nasal epithelium taken 7 days after dosing were normal. No significant changes in clinical parameters were observed. Functional expression of CFTR assessed by in vivo nasal potential difference measurements showed transient correction of the CF chloride transport abnormality in two patients (15 days after dosing in one patient). Fluorescence microscopy demonstrated CFTR function ex vivo. In cells from nasal brushings. In total, evidence of functional CFTR gene transfer was obtained in six out of the eight treated patients. These results provide proof of concept for liposome-mediated CF gene transfer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 treatment, this condition still leads to an untimely death, Alternative, nonviral, gene delivery systems are receiving often in early adult life.3 increased attention, specifically cationic liposomes such as DC-Chol/DOPE (3beta[N-(N',N'-dimethylamino- ethane)-carbomoyl] cholesterol/dioleoylphosphatidylethanolamine).12 In clinical trials, DC-Chol/DOPE lipo-Correspondence: DR Gill, Nuffield Department of Clinical Biochemistry, somes have been shown to mediate gene transfer inJohn Radcliffe Hospital, University of Oxford, Oxford OX3 9DU, UK Received 5 November 1996; accepted 4 December 1996 patients with no evidence of inflammation, tissue damage or systemic immune response.13,14 Table 1 Patient details Treatment Patient Age Sex Genotype FEV1 (litres) FVC (litres) Clinical score Low CFTR 3 19 M ⌬F508/⌬F508 4.80 6.30 90 Low CFTR 5 17 M ⌬F508/⌬F508 4.40 5.70 95 Low CFTR 6 21 M ⌬F508/⌬F508 3.10 4.60 75 Low CFTR 10 27 F ⌬F508/⌬F508 1.40 1.90 70 High CFTR 2 21 M ⌬F508/⌬F508 1.65 3.25 60 High CFTR 7 21 M ⌬F508/⌬F508 3.00 4.30 75 High CFTR 9 20 F ⌬F508/G551D 1.45 3.0 50 High CFTR 12 27 F R553X/Q493X 2.30 3.15 45 Placebo-Vector 1 20 M ⌬F508/G551D 1.90 3.10 40 Placebo-Vector 8 19 M ⌬F508/R1162X 0.85 1.55 40 Placebo-Krebs 4 33 M ⌬F508/⌬F508 3.00 4.00 70 Placebo-Krebs 11 21 F ⌬F508/⌬F508 2.25 3.15 85 All patients were pancreatic insufficient. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

[hide] Survey of cystic fibrosis transmembrane conductanc... Dig Dis Sci. 1996 Mar;41(3):540-2. McGill JM, Williams DM, Hunt CM
Survey of cystic fibrosis transmembrane conductance regulator genotypes in primary sclerosing cholangitis.
Dig Dis Sci. 1996 Mar;41(3):540-2., [PMID:8617131]

Abstract [show]
A variety of cholestatic liver diseases appear to primarily affect the biliary epithelium, including cystic fibrosis (CF). CF results from a defect in the chloride channel protein, cystic fibrosis transmembrane conductance regulator (CFTR). Although the majority of CF patients have a genomic deletion in deltaF508, other mutations of CFTR may result in less severe clinical presentations and outcomes. Recently, CFTR has been shown to be involved in secretin-stimulated choleresis in intrahepatic bile duct epithelial cells. Cholestasis in cystic fibrosis appears to result from defective chloride transport across the biliary epithelium and is the only cholestatic disease of bile ducts for which a cellular defect has been identified. Primary sclerosing cholangitis (PSC) is a cholestatic disease with histological and cholangiographic features similar to CF. The purpose of this pilot study was to explore whether there is an increased prevalence of CFTR mutations. Two patients exhibited mutations in one allele, yielding a carrier rate of 10.6%, not statistically different from the general U.S. population carrier rate of 4%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 In total, 32 mutations were evaluated, which represent 90% of the most common mutations (t4): AF508 G542X G551D W1282X 3905insT NI303K 3849+ 10kbC--~T R553X 621+ IG--*T 1717- IG--,A lt)78delT 2789+5G---~A 3849+4A--~G 711+ IG---oT R1162X 1898+IG----~A R117H 3659delC G85E 2184delA A1507 R347P Y1092X R560T A455E R334W Y122X S549R(T---~G) Q493X V520F $549N R347H Patient Selection. Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 AF508, AF508lAF508, M470V (p),Q493X, Q493WAF508,V520F. Login to comment

[hide] Cystic fibrosis mutation detection by hybridizatio... Hum Mutat. 1996;7(3):244-55. Cronin MT, Fucini RV, Kim SM, Masino RS, Wespi RM, Miyada CG
Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays.
Hum Mutat. 1996;7(3):244-55., [PMID:8829658]

Abstract [show]
We have combined photochemistry and photolithography with solid-phase DNA synthesis chemistry to form a new technology that makes high density oligonucleotide probe array synthesis possible. Hybridization to these two-dimensional arrays containing hundreds or thousands of oligonucleotide probes provides a powerful DNA sequence analysis tool. Two types of light-generated DNA probe arrays have been used to test for a variety of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. One array, made up of 428 probes, was designed to scan through the length of CFTR exon 11 and identify differences from the wild type reference sequence. The second type of array contained 1480 probes chosen to detect known deletions, insertions, or base substitution mutations. The validity of the probe arrays was established by hybridizing them with fluorescently labeled control oligonucleotide targets. Characterized mutant CFTR genomic DNA samples were then used to further test probe array hybridization specificity. Finally, ten unknown patient samples were genotyped using the CFTR probe array assay. The genotype assignments were identical to those obtained by PCR product restriction fragment analysis. Our results show that light-generated DNA probe arrays are highly effective in analyzing complex mutation and polymorphism patterns in a relatively large gene such as CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
238 Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design. Login to comment

[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]

Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] Retrospective study of the cystic fibrosis transme... Hum Genet. 1994 Apr;93(4):429-34. Verlingue C, Mercier B, Lecoq I, Audrezet MP, Laroche D, Travert G, Ferec C
Retrospective study of the cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Guthrie cards from a large cohort of neonatal screening for cystic fibrosis.
Hum Genet. 1994 Apr;93(4):429-34., [PMID:7513292]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene encodes a cAMP-activated chloride channel, and in individuals with both alleles of the gene mutated, symptoms of CF disease are manifest. With more than 300 mutations so far described in the gene the profile of mutant alleles in a population is specific to its ethnic origin. For an analysis with an unbiased recruitment of the CF alleles in neonates of similar origin (Normandy, France), we have retrospectively analyzed the Guthrie cards of affected newborns, diagnosed by the immunoreactive trypsinogen (IRT) assay. Analysis of the 27 exons of the CFTR gene using a GC clamp denaturing gradient gel electrophoresis (DGGE) assay has enabled us to identify over 96% of the mutated alleles. Two of these were novel mutations. We would like to propose this strategy as an efficient method of retrospective molecular genetic diagnosis that can be performed wherever Guthrie cards can be obtained. Knowledge of rare alleles could be a prerequisite for CF therapy in the future.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 1 Kerem et al. 1990 1 394 del TT 3 0.05 Claustres et al. 1993 1 E60X 3 0.05 unpublished data 1 621 + 1 G---~T intron 5 0.05 Zielenski et a1.1991 1 876 - 14 del 12 NT 6a 0.05 Audr6zet et a1.1993 1 Q493X 10 0.05 Kerem et al. 1990 1 1507 10 0.05 Kerem et al. 1990, Schwartz et al. 1991 1 1717 - 1 G---~A intron 10 0.05 Kerem et al. 1990, Guillermit et al. 1990 1 K710X 13 0.05 Fanen et al. 1992 1 L610S 13 0.05 This study 1 E83 IX 14a 0.05 This study 1 W846X 14a 0.05 Vidaud et al. 1990 1 $945L 15 0.05 Claustres et al. 1993 1 Y1092X 17b 0.05 unpublisheddata 1 3359 del CT 17b 0.05 Mercier et al. 1993 1 RI066C 17b 0.05 Fanen et al. 1992 1 W1204X 19 0.05 Costes et al. 1993 1 R1162X 19 0.05 Gasparini et al. 1991 1 W1282X 20 0.05 Vidaud et al. 1990 175 Identified 96.1 6 Unidentified 3.9 15 No blood left to perform the complete analysis 196 Total The affected child has a pancreatic insufficiency. Login to comment

[hide] Genetic analysis of Hispanic individuals with cyst... Am J Hum Genet. 1994 Mar;54(3):443-6. Grebe TA, Seltzer WK, DeMarchi J, Silva DK, Doane WW, Gozal D, Richter SF, Bowman CM, Norman RA, Rhodes SN, et al.
Genetic analysis of Hispanic individuals with cystic fibrosis.
Am J Hum Genet. 1994 Mar;54(3):443-6., [PMID:7509564]

Abstract [show]
We have performed molecular genetic analyses of Hispanic individuals with cystic fibrosis (CF) in the southwestern United States. Of 129 CF chromosomes analyzed, only 46% (59/129) carry delta F508. The G542X mutation was found on 5% (7/129) of CF chromosomes. The 3849 + 10kbC-->T mutation, detected primarily in Ashkenazi Jews, was present on 2% (3/129). R1162X and R334W, mutations identified in Spain and Italy, each occurred on 1.6% (2/129) of CF chromosomes. W1282X and R553X were each detected once. G551D and N1303K were not found. Overall, screening for 22 or more mutations resulted in detection of only 58% of CF transmembrane conductance regulator gene mutations among Hispanic individuals. Analysis of KM19/XV2c haplotypes revealed an unusual distribution. Although the majority of delta F508 mutations are on chromosomes of B haplotypes, the other CF mutations are on A and C haplotypes at higher-than-expected frequencies. These genetic analyses demonstrate significant differences between Hispanic individuals with CF and those of the general North American population. Assessment of carrier/affected risk in Hispanic CF individuals cannot, therefore, be based on the mutation frequencies found through studies of the general population but must be adjusted to better reflect the genetic makeup of this ethnic group. Further studies are necessary to identify the causative mutation(s) in this population and to better delineate genotype/phenotype correlations. These will enable counselors to provide more accurate genetic counseling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC- T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G- T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment
54 COther = A1507, 621+1G- T, R117H, N1303K, 711+1G-*.T, 1717-1G-.A, R560T, Y122X, 1148T, G314E, 1078AT, R347P, Q493X, V520F, and 3659AC. Login to comment
56 The G542X mutation was found in 5.4% of Hispanic CF chromosomes, similar to the 3% frequency in the general population. Login to comment
47 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC-T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G-T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Frequent cystic fibrosis mutations Name Relative freqeenc~ Mutation Con~,~'~luence Ref. Z~508 67.2 G542X 3.4 G551D 2.4 W1282X 2.1 3905insT 2.1 N1303K 1.8 3849+10kbC-+T 1.4 1717-1G-+A 1078delT 2789+5G--+A Deletion of 3 bp between nt 1652 and t655 in exon 10 G-+T at nt 1756 in exon 11 G-+A at nt 1784 in exon 1I G-+A at nt 3978 in exon 20 Insertion of T after nt 3905 in exon 20 C-+G at nt 4041 in exon 21 C-->T in a 6.2 kb EcoRI fragment 10 kb from 5' junction of intron 19 3849+4A-+G 1.0 7tt÷IG--+T 0.9 Rl162X 0.9 1898+lG-+A 0.9 Rll7H 0.8 3659delc 0.8 G85E 0.7 2184delA 0.7 AI5W 0.5 R347P 0.5 R~ 0.4 1,3 C-+T at nt 1"789in exon 11 1.3 G-+T at nt 1 from 5' junction of intron 4 1.1 G--+A at nt 1 from 3' junction of intron 10 1.1 Deletion of T at nt 1078 in exon 7 1.1 G-cA at 5 nt from 5' end of intron 14b A-->G at 4 nt from 5' end of intron 19 G-+T at nt 1 from 5' junction of intron 5 C-+T at nt 3616 in exon 19 G-+A at nt 1 from 5' junction of intron 12 G--)A at nt 482 in exon Deletion of C at nt 3659 in exon 19 G-+A at nt 386 in exon 3 A-->G at nt 2183 and deletion of A at nt 2184 in exon 13 Deletion of 3 bp between nt 1648 and 1653 in exon 10 G-+C at nt 1172 in exon 7 G-~C at nt 1811 in exon 11 A455E 0.4 R334W 0.4 Y122X 0.3 S549R(T-+G) 0.3 Q493X 0.3 V520F 0.2 S549N 0.2 C-+A at nt 1496 in exon 9 C-+T at nt 1132 in exon 7 T-cA at nt ~i98 in exon 4 T--+G at nt 1779 in exon 11 C-+T at nt 1609 in exon 10 G-+T at nt 1690 in exon 10 G-->A at nt I778 in exon !1 Deletion of Phe at codon 508 Gly-+Stop at codon 542 12 Gly-~Asp at codon 551 10 l"rp-->Stop at codon t282 35 Frameshift -~ Asn-+Lys at codon 1303 36 Aberrant splicing -~ Arg~Stop ~ codon 553 Splice mutation 10 37 Splice mutation 12 Frameshift 38 Splice mutation _c Splice mutation? Login to comment

[hide] Milestones in cystic fibrosis. Br Med Bull. 1992 Oct;48(4):717-37. Super M
Milestones in cystic fibrosis.
Br Med Bull. 1992 Oct;48(4):717-37., [PMID:1281032]

Abstract [show]
The study of cystic fibrosis (CF) provides a fascinating insight into developments in medicine in the 20th century. Milestones include the first clear clinical descriptions in the 1930s, discovery of a sweat electrolyte abnormality, establishing the autosomal recessive mode of inheritance and improvements in treatment. Microdissection experiments on sweat glands allowed the main defect to be delineated as one of chloride transport. Location of the gene to chromosome 7 made prenatal diagnosis feasible and carrier detection in siblings. The CF gene--its product being the cystic fibrosis transmembrane conductance regulator (CFTR), and its major mutation Delta F508 was discovered in 1989. World-wide collaboration has resulted in discovery of more than 150 further mutations. Incorporation of CFTR into non-chloride transporting insect cells by conferring chloride transport, proved it a chloride channel. CFTR incorporated into adenovirus results in correction of the chloride transport defect in airway cells, bringing gene therapy closer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
164 Mutations encountered elsewhere in UK but not yet m N-W 1154insTC R347P A455E G458V Q493X C524X S549N R1283M Q1291H 199 (in the north-west group) 199 199 0 0 0 199 199 0 icant alteration in function appears to be worse than no CFTR being formed at all. Login to comment

[hide] Mutation analysis of 184 cystic fibrosis families ... J Med Genet. 1992 Sep;29(9):642-6. Cheadle J, Myring J, al-Jader L, Meredith L
Mutation analysis of 184 cystic fibrosis families in Wales.
J Med Genet. 1992 Sep;29(9):642-6., [PMID:1357180]

Abstract [show]
We describe a molecular analysis of 184 cystic fibrosis (CF) families in Wales. To determine accurate frequency data for the CF mutations in the Welsh population, families with at least three Welsh grandparents were strictly regarded as Welsh. Of these 74 families, we have identified approximately 90% of mutations causing CF, with delta F508 accounting for 71.8% and 621 + 1G greater than T 6.7%. We observed a significant difference between the Welsh and Scottish frequencies of 621 + 1G greater than T. To allow the rapid and efficient screening for the more common mutations we modified a multiplex used by Watson et al enabling the detection of delta F508, G551D, and R553X simultaneously with 621 + 1G greater than T. In parallel to this system we ran the Cellmark Diagnostics ARMS multiplex kit, which detects delta F508, 621 + 1G greater than T, G551D, and G542X. RFLP analysis of the 184 families shows that the delta F508 chromosomes are almost exclusively found on the B haplotype (XV2c 1, KM19 2); the other CF mutations have more heterogeneous backgrounds. Strong haplotype correlations exist between the markers XV2c, KM19, D9, and G2 and the other CF mutations. Haplotype data suggest that there are at least seven mutations that remain to be identified in these families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Welsh Mixed Undefined Total Mutation No % No % No % No % AF508 107/149 71-8 92/126 73 0 69/94 73 4 268/369 72-6 621 + 1G>T 10/42* 6-7 5/34* 4-0 4/25* 4-3 19/101* 51 G551D 2/42* 1-3 6/34* 4-8 3/25* 3-2 11/101* 3 0 G542X 4/42* 2-7 4/34* 3-2 1/25* 1.1 9/101* 2-4 G85E 0/41* 0-0 2/34* 1 6 3/24* 3*4 5/99* 1-4 R553X 2/42* 1-3 2/34* 16 0/25* 00 4/101* 1-1 R1283M 3/42* 2.0 0/34* 0.0 0/25* 0.0 3/101* 0-8 N1303K 1/42* 0 7 1/34* 0-8 0/24* 0.0 2/100* 0-6 AI507 2/149 1-3 0/126 0.0 0/94 0.0 2/369 0-5 R117H 1/42* 0 7 1/34* 0-8 0/25* 0.0 2/101* 0-5 1717- 1G>A 2/42* 1-3 0/34* 0 0 0/25* 0 0 2/101* 0-5 R560T 0/42* 00 0/34* 00 1/25* 1 1 1/101* 03 1154InsTC 0/40* 0 0 1/33* 0 9 0/24* 0.0 1/97* 0-3 V520F 0/42* 0 0 0/34* 0 0 0/25* 0.0 0/101* 0 0 W1282X 0/42* 0 0 0/34* 0.0 0/25* 0.0 0/101* 0 0 R347P 0/42* 0 0 0/34* 0 0 0/24* 0.0 0/100* 0 0 Q493X 0/42* 0 0 0/34* 0 0 0/24* 0 0 0/100* 00 Total (%) 89-8 90 7 86-5 891 * Non-AF508 chromosomes. Login to comment

[hide] Genetic determination of exocrine pancreatic funct... Am J Hum Genet. 1992 Jun;50(6):1178-84. Kristidis P, Bozon D, Corey M, Markiewicz D, Rommens J, Tsui LC, Durie P
Genetic determination of exocrine pancreatic function in cystic fibrosis.
Am J Hum Genet. 1992 Jun;50(6):1178-84., [PMID:1376016]

Abstract [show]
We showed elsewhere that the pancreatic function status of cystic fibrosis (CF) patients could be correlated to mutations in the CF transmembrane conductance regulator (CFTR) gene. Although the majority of CF mutations--including the most common, delta F508--strongly correlated with pancreatic insufficiency (PI), approximately 10% of the mutant alleles may confer pancreatic sufficiency (PS). To extend this observation, genomic DNA of 538 CF patients with well-documented pancreatic function status were analyzed for a series of known mutations in their CFTR genes. Only 20 of the 25 mutations tested were found in this population. They accounted for 84% of the CF chromosomes, with delta F508 being the most frequent (71%), and the other mutations accounted for less than 5% each. A total of 30 different, complete genotypes could be determined in 394 (73%) of the patients. The data showed that each genotype was associated only with PI or only with PS, but not with both. This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as delta F508, delta I507, Q493X, G542X, R553X, W1282X, 621 + 1G----T, 1717-1G----A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as AF508, A1507, Q493X, G542X, R553X, W1282X, 621 + 1G-PT, 1717-1G--'A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T. Login to comment
57 Intron 4: 621 + 1G-T Exon 7: R334W ......... R347P ........... Exon 9: A455E .......... G458V .......... G480C .......... Exon 10: Q493X .......... A1507 ........... AF508 .......... VS2OF .......... Login to comment
81 Table 4 Classification of CF Gene Mutations as Severe or Mild with Respect to Pancreatic Function Type of Mutation Severe (location) Mild (location) Missense (point mutation) ...... 1148T (exon 4) R117H (exon 4) G480C (exon 9) R334W (exon 7) VS2OF (exon 10) GSS1D (exon 11) R347P (exon 7) RS60T (exon 11) A455E (exon 9) N1303K (exon 21) P574H (exon 12) Single amino acid deletion ........ AFS08 (exon 10) A1507 (exon 10) Stop codon (nonsense) ..... Q493X (exon 10) G542X (exon 11) R553X (exon 11) W1282X (exon 20) Splice junction ... 621 + 1G-T (intron 4) 1717-1G-T (intron 10) Frameshift ........ 556delA (exon 4) 3659delC (exon 19) with any of the mild mutations was associated with PS. Login to comment
85 Accordingly, the mutations R117H, R334W, R347P, A455E, and P574H may be regarded as mild, whereas AF508, AI507, Q493X, G542X, R553X, W1282X, 621 + 1G-T, 1717-1G--A, 556delA, 3659delC, 1148T, G480C, V520F, GSS1D, and R560T are severe. Login to comment

[hide] Analysis of 31 CFTR mutations in 55 families from ... Early Hum Dev. 2001 Nov;65 Suppl:S161-4. Gomez-Llorente MA, Suarez A, Gomez-Llorente C, Munoz A, Arauzo M, Antunez A, Navarro M, Gil A, Gomez-Capilla JA
Analysis of 31 CFTR mutations in 55 families from the South of Spain.
Early Hum Dev. 2001 Nov;65 Suppl:S161-4., [PMID:11755047]

Abstract [show]
We carried out a molecular analysis of 350 chromosomes from 55 families originating from the South of Spain (Andalucia) who were diagnosed with cystic fibrosis (CF). We used polymerase chain reaction, followed by an oligonucleotide ligation assay (OLA) and sequence-coded separation using capillary electrophoresis. A frequency of 43.5% for DeltaF508 was found, making it the most common CF mutation in our sample. Seven more mutations (G542X, R334W, R1162X, 2789+5G-->A, R117H, DeltaI507 and W1282X) were detected and accounted for 24.7% of the total. The remaining mutations (31.8%) were undetectable with the methodology used in this study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 The patients and their families were referred to us from six Table 1 Listing of the CFTR mutations which are interrogated in the CF assay used in this study Mutation Location Mutation Location Exon/Intron Exon/Intron DF508 E.10 W1282X E.20 F508C E.10 3905insT E.20 DI507 E.10 N1303K E.21 Q493X E.10 G85E E.3 V520F E.10 621 + 1G ! Login to comment

[hide] Simultaneous screening for 11 mutations in the cys... Mol Cell Probes. 1992 Feb;6(1):33-9. Cuppens H, Buyse I, Baens M, Marynen P, Cassiman JJ
Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot.
Mol Cell Probes. 1992 Feb;6(1):33-9., [PMID:1372093]

Abstract [show]
An assay is described in which 11 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can be screened simultaneously. Six different exons of the CFTR gene are amplified in a single multiplex amplification. Biotinylated dUTP is incorporated into the different fragments during the amplification process. A sample of this mixture is then hybridized to 21 different poly-dT tailed oligonucleotide probes which are bound to a nylon membrane. In order to screen the different mutations in a single step hybridization, the length of the different oligonucleotides and the amount used in the assay were optimized. The detection is performed by binding avidin-alkaline phosphatase to the biotin, followed by a chemiluminescent reaction. By means of this fast and sensitive assay, about 85% of all the cystic fibrosis mutations in the Belgian population can be detected.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population . Login to comment

[hide] Diagnosis of cystic fibrosis in adults with diffus... J Cyst Fibros. 2004 Mar;3(1):15-22. Hubert D, Fajac I, Bienvenu T, Desmazes-Dufeu N, Ellaffi M, Dall'ava-Santucci J, Dusser D
Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis.
J Cyst Fibros. 2004 Mar;3(1):15-22., [PMID:15463882]

Abstract [show]
We assessed the contribution of the sweat test, genotyping and nasal potential difference (NPD) in the diagnosis of cystic fibrosis (CF) in adults with diffuse bronchiectasis (DB). Among 601 adults referred for DB from 1992 to 2001, 46 were diagnosed with CF. The sweat test was positive in 37 patients and normal or intermediate in nine patients. Two CF mutations were identified in 18 patients (39%) by screening for 31 mutations and in 36 patients (78%) after complete genetic analysis. NPD was suggestive of CF in 71% of the patients. The combination of the sweat test and genetic analysis led to the diagnosis of CF in 45 patients. In the nine patients with normal or intermediate sweat test, the diagnosis was confirmed by screening for 31 mutations in five, by complete genetic screening in three, and by NPD in the remaining patient. Searching for CF should start with sweat test. If the sweat test is normal or intermediate, screening for 31 mutations may help to diagnose CF. A complete genetic analysis is indicated when only one mutation is detected and/or when other clinical features, such as obstructive azoospermia or pancreatic insufficiency, are suggestive of CF. NPD measurement is indicated in controversial cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x. Login to comment

[hide] DNA immobilisation procedures for surface plasmon ... Biosens Bioelectron. 2007 Jan 15;22(6):803-9. Epub 2006 Apr 18. Mannelli I, Lecerf L, Guerrouache M, Goossens M, Millot MC, Canva M
DNA immobilisation procedures for surface plasmon resonance imaging (SPRI) based microarray systems.
Biosens Bioelectron. 2007 Jan 15;22(6):803-9. Epub 2006 Apr 18., [PMID:16621508]

Abstract [show]
Two different surface chemistries have been studied for the development of surface plasmon resonance imaging (SPRI) based DNA microarray affinity sensors: (1) 11-mercaptoundecanoic acid-poly(ethylenimine) (MUA-PEI) and (2) dextran procedures. The MUA-PEI method consists of assembling a multilayer on the basis of electrostatic interactions formed with: 11-mercaptoundecanoic acid (MUA), poly(ethylenimine) (PEI) and extravidin layers. The dextran procedure involves assembling a multilayer formed with 11-mercaptoundecanol, dextran and streptavidin layers, which are linked by covalent bonds. The oligonucleotide probes are immobilised onto the sensor surface as spots forming a matrix 14x14, which is spotted by a robot, while the target sequences are free in solution. The system allows the interaction (hybridisation) monitoring, in real-time and in parallel, of unlabeled oligonucleotide solution targets to oligonucleotide probes immobilised on a 196 spots matrix. Using oligonucleotides as probes and targets, both functionalised surfaces have been evaluated in view of their application to the diagnosis of gene mutations involved in human diseases. In particular, we demonstrate the ability to detect, in parallel, several mutations causing human cystic fibrosis (CF), which lie within exon 10 of the human cystic fibrosis transmembrane conductance regulator (CFTR) gene. The immobilised probes were complementary to sequences corresponding the mutant or wild type alleles. Two deletions of three bases (DeltaF508 and DeltaI507) and four single nucleotide polymorphisms (M470V, Q493X, V520F and 1716 G>A) were investigated. In both functionalised surfaces, the system showed the capacity to discriminate normal and mutant sequences differing by a single base.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Two deletions of three bases (F508 and I507) and four single nucleotide polymorphisms (M470V, Q493X, V520F and 1716 G > A) were investigated. Login to comment
56 The probe (P) sequences used are: 1, F508 wild type (P-F508-WT) = 5 biotin (T)17 ATA TCA TCT TTG GTG 3; 2, F508 mutant (P-F508-M) = 5 biotin (T)17 AAT ATC ATT GGT GTT 3; 3, I507 wild type (P-I507-WT) = 5 biotin (T)15 GAA AAT ATC ATC TTT G 3; 4, I507 mutant (P-I507-M) = 5 biotin (T)15 GAA AAT ATC TTT GGT 3; 5, M470V wild type (P-M470V-WT) = 5 biotin (T)16 TTC TAA TGA TGA TTA 3; 7, M470V mutant (P-M470V-M) = 5 biotin (T)16 TTC TAA TGG TGA TTA 3; 9, 1716 G > A wild type (P-1716 G > A-WT) = 5 biotin (T)18 AGA AGA GGT AAG A 3; 11, 1716 G > A mutant (P-1716 G > A-M) = 5 biotin (T)18 AGA AGA AGT AAG A 3; 13, Q493X wild type (P-Q493X-WT) = 5 biotin (T)18 TGT TCT CAG TTT T 3; 15, Q493X mutant (P-Q493X-M) = 5 biotin (T)18 TGT TCT TAG TTT T 3; 17, V520F wild type (P-V520F-WT) = 5 biotin (T)19 GAA GCG TCA TC 3; 19, V520F mutant (P-V520F-M) = 5 biotin (T)19 GAA GCT TCA TC 3 and 21, not relevant (P-NR) = 5 biotin (T)18 CAC TTC GTG CCT T 3. Login to comment
61 In the case of the remaining polymorphisms, the correspondence with the official nomenclature is: M470V-WT = c.1540A (normal allele), M470V-M = c.1540G (mutant allele), Q493X- WT = c.1609C (normal allele), Q493X-N = c.1609T (mutant allele), 1716 G > A-WT = c.1716G (normal allele), 1716 G > AM = c.1716A (mutant allele), V520F-WT = c.1690G (normal allele) and V520F-M = c.1690T (mutant allele). Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22]. Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT. Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Table 1 Examples of common CF-causing, indetermined, and non CF-causing variants (modified from5,8,17) HGVS nomenclature Legacy name cDNA nucleotide name Protein name CF-causing variantsa F508del c.1521_1523delCTT p.Phe508del G542X c.1624G4T p.Gly542* G551D c.1652G4A p.Gly551Asp N1303K c.3909C4G p.Asn1303Lys W1282X c.3846G4A p.Trp1282* 621+1G4T c.489+1G4T CFTRdele2,3 c.54-5940_273 +10250del21080 p.Ser18Argfs*16 E60X c.178G4T p.Glu60* G85E c.254G4A p.Gly85Glu 394delTT c.262_263delTT p.Leu88Ilefs*22 711+1G4T c.579+1G4T R347P c.1040G4C p.Arg347Pro A455E c.1364C4A p.Ala455Glu Q493X c.1477C4T p.Gln493* I507del c.1519_1521delATC p.Ile507del R553X c.1657C4T p.Arg553* R560T c.1679G4C p.Arg560Thr 1898+1G4A c.1766+1G4A 2183AA4G c.2051_2052delAAinsG p.Lys684Serfs*38 2789+5G4A c.2657+5G4A 3120+1G4A c.2988+1G4A M1101K c.3302 T4A p.Met1101Lys R1162X c.3484C4T p.Arg1162* 3659delC c.3528delC p.Lys1177Serfs*15 M1V c.1 A4G p.? Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment

[hide] Pulmonary function and clinical observations in me... Chest. 1996 Aug;110(2):440-5. Colin AA, Sawyer SM, Mickle JE, Oates RD, Milunsky A, Amos JA
Pulmonary function and clinical observations in men with congenital bilateral absence of the vas deferens.
Chest. 1996 Aug;110(2):440-5., [PMID:8697849]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) was once thought to be a distinct clinical entity, but genetic similarities in men with cystic fibrosis (CF) and CBAVD are described increasingly. We evaluated the clinical status, growth and nutritional state, and respiratory function of 18 men with CBAVD to determine whether these men with different CF transmembrane regulator (CFTR) genotypes may have clinical evidence of mild CF. Following a thorough history and examination, pulmonary function tests, sweat test, and renal ultrasound were performed. Genetic evaluation for 50 known CF mutations, screening for private mutations (single-strand conformational polymorphism and direct sequencing), and assay of the length of the polypyrimidine tract in the splice site acceptor of intron 8 was performed. A history of pulmonary disease was present in three, and an additional man had some features suggestive of malabsorption. Results of general physical examination and anthropomorphic measurements were unremarkable in all patients, with a mean (SD) body mass index of 26 (3). Pulmonary function tests of large and small airway function as well as lung volumes were normal in all except one whose results were consistent with moderate asthma. Five men were compound heterozygotes for CFTR mutations, four of whom had positive sweat tests (sweat chloride > 60 mEq/L). Twelve men were heterozygotes for CFTR mutations while no mutations were identified in one man. Although putative etiologic factors may suggest that men with CBAVD and CFTR mutations could be considered within the spectrum of clinical CF, the authors suggest that in men with CBAVD without any other clinical features of CF, the diagnosis of CF may not be made.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 His stool description Table 1.Age, Sweat Sodium and Chloride Concentration and Ratio, and Genotype Subject/Age, yr Symptoms Sweat Na+: mEq/L Sweat Cl mEq/L Na:Cl Ratio CFTR Genotype Polythymidine Splice Variant l*/32 2*/27 3f/30 4/23 5*/22 6*/31 7*/37 8/30 9/41 10/31 11/31 12/38 13/40 14/32 15/31 16/43 17/40 18/27 Asthma Malabsorption Bronchitis Asthma 100 39 53 37 36 36 26 46 42 35 83 74 44 44 44 28 21 106 80 37 51 35 34 34 24 45 43 32 79 75 46 44 40 32 22 0.94 1.05 1.03 1.06 1.05 1.05 1.08 1.00 0.98 1.09 1.05 0.99 0.96 1.00 1.10 0.90 0.95 AF508/R117H AF508/R117H AF508/- AF508/- AF508/- AF508/- AF508/- R117H/- Q493X/- AF508/- AF508/- AF508/R117H G551D/R117H G551D/D1152H AF508/- G542X/- R117H/- -/- 7/9 7/9 5/9 5/9 7/7 7/9 7/9 NT$ 7/7 NT NT 7/9 7/7 7/7 5/9 5/9 7/7 5/9 * Subject 1 and 2 are brothers. Login to comment