ABCC7 p.Gln493*
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 10367278
[PubMed]
Maldonado-Rodriguez R et al: "Hybridization of glass-tethered oligonucleotide probes to target strands preannealed with labeled auxiliary oligonucleotides."
No.
Sentence
Comment
39
This fragment contains four of the most frequent sites of mutations causing CF, Q493X, AI507, AF508, and V520F 07).
X
ABCC7 p.Gln493* 10367278:39:80
status: NEW57 The sequences of the eight 9-mer probes were as follows (the 5'-amino group is denoted by the character, "@": for mutation Q493X, probes CF10W 5'-@actgagaac and CF10M 5'-@taagaacag; for mutationAI507,probes CF11W 5-@aagatgata and CFllM 5-@ccaaagata; for mutation AF508, probes CF 12W 5- @ccaaagatg and CF12M 5'-@caccgatga; and for mutation V520F, probes CF13W 5-@atgacgctt and CF 13M 5-@gatgeagct.
X
ABCC7 p.Gln493* 10367278:57:123
status: NEW40 This fragment contains four of the most frequent sites of mutations causing CF, Q493X, AI507, AF508, and V520F 07).
X
ABCC7 p.Gln493* 10367278:40:80
status: NEW58 The sequences of the eight 9-mer probes were as follows (the 5'-amino group is denoted by the character, "@": for mutation Q493X, probes CF10W 5'-@actgagaac and CF10M 5'-@taagaacag; for mutationAI507,probes CF11W 5-@aagatgata and CFllM 5-@ccaaagata; for mutation AF508, probes CF 12W 5- @ccaaagatg and CF12M 5'-@caccgatga; and for mutation V520F, probes CF13W 5-@atgacgctt and CF 13M 5-@gatgeagct.
X
ABCC7 p.Gln493* 10367278:58:123
status: NEW
PMID: 10376575
[PubMed]
Mak V et al: "Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia."
No.
Sentence
Comment
28
Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining.
X
ABCC7 p.Gln493* 10376575:28:280
status: NEW
PMID: 10444722
[PubMed]
Gasparini P et al: "Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis."
No.
Sentence
Comment
46
Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia.
X
ABCC7 p.Gln493* 10444722:46:275
status: NEW
PMID: 10973878
[PubMed]
Costes B et al: "Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19)."
No.
Sentence
Comment
51
The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E.
X
ABCC7 p.Gln493* 10973878:51:89
status: NEW
PMID: 11056144
[PubMed]
Lewis-Jones DI et al: "Cystic fibrosis in infertility: screening before assisted reproduction: opinion."
No.
Sentence
Comment
78
Q493X D1152H Gregg, R.G., Wilfond, B.S., Farell, P.M. et al. (1993) Application of DNA 1717-1G→A 4326∆TC analysis in a population-screening program for neonatal diagnosis of cystic R56OT 4279insA fibrosis (CF): comparison of screening protocols.
X
ABCC7 p.Gln493* 11056144:78:0
status: NEW
PMID: 11117575
[PubMed]
Kimura S et al: "Polymorphism of cystic fibrosis gene in Japanese patients with chronic pancreatitis."
No.
Sentence
Comment
127
Other mutations included R117H in two patients and Q493X, R553X, R560T, and 621 ϩ 1(G-to-T) in one patient each.
X
ABCC7 p.Gln493* 11117575:127:51
status: NEW
PMID: 11158459
[PubMed]
Wine JJ et al: "Comprehensive mutation screening in a cystic fibrosis center."
No.
Sentence
Comment
86
Mutations in the Stanford CF Mutation Database After Screening With the Genzyme70 Assay Mutation n % n % ⌬F508 353 67.11% 353 67.11% Splice mutations 16 3.04% 621ϩ1 G3T 5 0.95% 1717-1 G3A 5 0.95% 2789ϩ5 G3A 1 0.19% 1898ϩ1 G3A 1 0.19% 3849ϩ10 kb C3T 4 0.76% Stop mutations 31 5.89% Q493X 1 0.19% G542X 13 2.47% R553X 4 0.76% R1162X 1 0.19% W1282X 10 1.90% S1455X 2 0.38% Insertions/deletions 9 1.71% 681 del C 1 0.19% 2184 del A 2 0.38% 3859 del C 5 0.95% 3905 ins T 1 0.19% Missense mutations 33 6.27% G85E 4 0.76% R117H 3 0.57% R334W 6 1.14% G551D 14 2.66% R560T 3 0.57% N1303K 3 0.57% Unknown mutations 84 15.97% 84 15.97% Total 526 100.00% 526 100.00% ARTICLES tients with positive sweat tests were selected for SSCP/HA analysis based on clinical status, ethnicity, and previous screening with the Genzyme70 assay.
X
ABCC7 p.Gln493* 11158459:86:312
status: NEW
No.
Sentence
Comment
37
Five mutations, 394delTT, Q493X, 3272-26AG, 3120+1GA and 2789+5GA were detected.
X
ABCC7 p.Gln493* 11168023:37:26
status: NEW40 White and coloured patients with unidentified CF mutations were tested for 15 mutations including 394delTT, Q493X, 3272-26A G, 3120+1GA as well as 11 other mutations, R117H, R334W, G542X, G551D, R553X, 621+ 1GT, W1282X, N1303K, 1717-1GA, R1162X, 3849+10kbCT.
X
ABCC7 p.Gln493* 11168023:40:108
status: NEW52 The Q493X mutation was detected using ARMS PCR as described by Kerem et al. (10).
X
ABCC7 p.Gln493* 11168023:52:4
status: NEW58 Frequency of CFTR mutations in white CF chromosomes Mutation Number of chromosomes Frequency (%) DF508 291 76 3272-26AG 16 4 394delTT 14 3.6 G542X 5 1.3 R553X 4 1 1W1282X 4 14N1303K G551D 3 0.8 3120+1GA 2 0.5 R117H 1 0.3 Q493X 1 0.3 S549N 1 0.3 621+1GT 1 0.3 1717-1GA 1 0.3 2789+5GA 1 0.3 91Total 349/384 Table 2.
X
ABCC7 p.Gln493* 11168023:58:233
status: NEW
PMID: 11388756
[PubMed]
Heim RA et al: "Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel."
No.
Sentence
Comment
128
By comparison, eight "African" mutations accounted for a similar percentage of the chromosomes analyzed (23%) in the study by Macek et al.6 In contrast, 11 of the 20 mutations detected in this study are considered to be "Caucasian" mutations and account for 10.5% of the chromosomes analyzed (R117H, 621 ϩ 1GϾT, R334W, Q493X, G551D, 1812-1GϾA, 1898 ϩ 1GϾA, R1066C, R1158X, R1162X, and 3905insT).
X
ABCC7 p.Gln493* 11388756:128:331
status: NEW
PMID: 11569691
[PubMed]
Truninger K et al: "Mutations of the cystic fibrosis gene in patients with chronic pancreatitis."
No.
Sentence
Comment
56
Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A.
X
ABCC7 p.Gln493* 11569691:56:124
status: NEW
PMID: 11589722
[PubMed]
Walkowiak J et al: "Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency."
No.
Sentence
Comment
86
Kristidis et al. [10] reported that pancreatic insufficiency strongly correlates also with two alleles of DI507, Q493X, G542X, R553X, W1282X, 621 1 1G-T, 1717±1G-A, 556delA, 3659delC, I148T, G480C, V520F and R560T while one or two mutations such as R117H, R334W, A455E, and P574H were correlated with a pancreatic sufficient phenotype.
X
ABCC7 p.Gln493* 11589722:86:113
status: NEW
PMID: 11883825
[PubMed]
Padoan R et al: "Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis."
No.
Sentence
Comment
34
It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14).
X
ABCC7 p.Gln493* 11883825:34:408
status: NEW
No.
Sentence
Comment
42
The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X.
X
ABCC7 p.Gln493* 11933191:42:313
status: NEW100 Optimization of Temperature (OTm) for Undetected Mutations Nucleotide RTm OTm Exon Mutation change (°C) (°C) 3 W57G 301 T>G 55 57 R74W 352 C>T 55 57 7 R334W 1132 C>T 58 60 R347C 1171 C>T 58 60 10 Q493X 609 C>T 55 56 20 3905 insT 3905 insT 55 56 D1270N 3940 G>A 57 58 RTm, recommended temperature by the MELT program; OTm, optimized temperature.
X
ABCC7 p.Gln493* 11933191:100:206
status: NEW
PMID: 11938439
[PubMed]
Audrezet MP et al: "Determination of the relative contribution of three genes-the cystic fibrosis transmembrane conductance regulator gene, the cationic trypsinogen gene, and the pancreatic secretory trypsin inhibitor gene-to the etiology of idiopathic chronic pancreatitis."
No.
Sentence
Comment
103
In this regard, a F508del/5T genotype was identified three times3,4 and Q493X/5T3 and R553X/5T3 once each in patients with ICP.
X
ABCC7 p.Gln493* 11938439:103:72
status: NEW
PMID: 12116247
[PubMed]
Muller F et al: "Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases."
No.
Sentence
Comment
47
A, N1303K, W1282X), oligonucleotide ligation assay with the CF-OLA kit (PE-Biosystems, Foster City, CA) (31 mutations detected: DF508, DI507, Q493X, V520F, 1717-1G !
X
ABCC7 p.Gln493* 12116247:47:142
status: NEW
PMID: 12133923
[PubMed]
Corbetta C et al: "Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population."
No.
Sentence
Comment
266
Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K.
X
ABCC7 p.Gln493* 12133923:266:202
status: NEW
PMID: 12151438
[PubMed]
Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
20
Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997).
X
ABCC7 p.Gln493* 12151438:20:859
status: NEW83 Matrix-assisted laser desorption ionization-time of flight mass spectra for multiplex primer oligonucleotide base extension reactions of mutations ∆F508, Q493X and R1066C.
X
ABCC7 p.Gln493* 12151438:83:161
status: NEW
PMID: 12357328
[PubMed]
McCormick J et al: "Demographics of the UK cystic fibrosis population: implications for neonatal screening."
No.
Sentence
Comment
79
It is envisaged that the proposed screening programme will be based on a three-stage protocol.6 In Table 3 Genotypes of the UK CF Caucasian and ISC populations Percentage of Percentage of genotyped UK CF genotyped UK CF Caucasian population ISC population Genotype n=4753 (%) n=78 (%) DF508/DF508 57.5 24.7 DF508/Unknown 11.5 3.5 DF508/G551D 5.1 0.0 DF508/G542X 2.8 0.0 Unknown/Unknown 2.7 27.1 DF508/621+1G?T 2.0 1.2 DF508/R117H 2.0 0.0 DF508/1898+1G?A 1.0 0.0 DF508/1717-G?A 0.9 0.0 DF508/N1303K 0.8 0.0 DF508 DI507 0.8 0.0 DF508/R553X 0.6 0.0 DF508/R560T 0.6 0.0 DF508/Q493X 0.5 0.0 G551D/Unknown 0.4 0.0 Other/Other 2.8 15.3* DF508/Other 6.7 0.0 Y569D/Y569D 0.0 8.2 L218X/L218X 0.0 3.5 1161delC/1161delC 0.0 3.5 R709X/V456A 0.0 2.4 G542X/G542X 0.4 2.4 Other/Unknown 1.0 3.5 The shaded areas represent the commonest genotypes in the ISC population.
X
ABCC7 p.Gln493* 12357328:79:572
status: NEW85 Table 4 The commonest CFTR mutations in the UK Genotypes UK CF population Genotyped UK Caucasian CF Genotyped UK CF ISC (n=9866 chromosomes) population (n=9506 chromosomes) population (n=156 chromosomes) CFTR mutation gene frequency per 1000 genes gene frequency per 1000 genes gene frequency per 1000 genes DF508 741.0 752.0 294.9 G551D 33.7 34.3 12.8 G542X 18.5 18.4 25.6 R117H 12.5 12.7 0.0 621+1G?T 12.7 12.7 6.4 1717-1G?A 5.8 5.8 0.0 1898+1G?A 5.7 5.9 0.0 N1303K 5.6 5.4 0.0 DI507 4.8 5.0 0.0 R560T 4.2 4.3 0.0 R553X 3.3 3.4 0.0 1154insTC 3.2 3.3 0.0 Q493X 2.8 2.9 0.0 3659delC 2.8 2.9 0.0 E60X 2.4 2.4 0.0 W1282X 2.7 2.7 0.0 P67L 2.1 2.1 0.0 G85E 2.1 2.0 0.0 V520F 1.6 1.7 0.0 1078delT 1.3 1.4 0.0 Y569D 1.5 0.0 96.2 L218X 0.6 0.0 38.5 1161delC 0.7 0.1 38.5 R1162X 0.9 0.6 19.2 R709X 0.4 0.2 12.8 3849+10kbC?T 1.2 0.8 19.2 S549R* 0.6 0.0 0.0 *S549R mutations appear in the non-Caucasian but not the ISC subgroup.
X
ABCC7 p.Gln493* 12357328:85:556
status: NEW
PMID: 12794695
[PubMed]
Timmreck LS et al: "Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina."
No.
Sentence
Comment
82
CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development.
X
ABCC7 p.Gln493* 12794695:82:257
status: NEW
PMID: 12815607
[PubMed]
Scotet V et al: "Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland."
No.
Sentence
Comment
64
Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering.
X
ABCC7 p.Gln493* 12815607:64:888
status: NEW
PMID: 12865275
[PubMed]
Ahmed N et al: "Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas."
No.
Sentence
Comment
309
Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency.
X
ABCC7 p.Gln493* 12865275:309:948
status: NEW
PMID: 12939655
[PubMed]
Perri F et al: "Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis."
No.
Sentence
Comment
33
Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation.
X
ABCC7 p.Gln493* 12939655:33:222
status: NEW
No.
Sentence
Comment
30
The close monitoring of the families affected with this condition played an important role in the identification of their genetic anomaly; the S family, described by McElroy and Christiansen in 1972 [34], was to play a pivotal role in helping Whitcomb et al 25 years later to uncover the Table 1 Recent genetic information on pancreatitis in children Gene Chromosome Mutations References Cationic trypsinogen (protease, serine1; PRSSI) 7q35 R122H; N29I A16V; others [4,11-19] Pancreatic trypsin inhibitor (PSTI) (SPINK1-serine protease inhibitor, Kazal Type 1) 5 N34S [20-22] CFTR-cystic fibrosis transmembrane regulator 7 DF508; R117H; Q493X R560T; R553X; 5Tallele; 621 + 1(G!T) and others [23-27] Parathyroid cell receptor (CaR) 3 (3q21-24) N178D; R220Q; P221S; R648X; others [28-30] Lipoprotein lipase (LPL) 8 (8p22) N291S, S447X; G715A [31,32] Apolipoprotein C-II (apoC-II) 19 (19q13.2) Val 18, Gln 2 and others [31] chromosomal [11], then the genetic abnormality [1], while in France Le Bodic et al [12] identified a very similar anomaly in a family described in 1963 by Cornet et al [35].
X
ABCC7 p.Gln493* 14562574:30:637
status: NEW77 Mutations, including delta F508, R117H, Q493X, 621 + 1 (G!T), R560T, R553X, were found at 2.5 times the frequency expected in the general population studied (600 controls included).
X
ABCC7 p.Gln493* 14562574:77:40
status: NEW
PMID: 14641997
[PubMed]
Raskin S et al: "High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing."
No.
Sentence
Comment
63
FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes.
X
ABCC7 p.Gln493* 14641997:63:1412
status: NEWX
ABCC7 p.Gln493* 14641997:63:1508
status: NEWX
ABCC7 p.Gln493* 14641997:63:1604
status: NEW
PMID: 14998948
[PubMed]
Danziger KL et al: "Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis."
No.
Sentence
Comment
59
Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad).
X
ABCC7 p.Gln493* 14998948:59:615
status: NEW
PMID: 15371903
[PubMed]
Sugarman EA et al: "CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations."
No.
Sentence
Comment
35
87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Gln493* 15371903:35:267
status: NEW
PMID: 15371908
[PubMed]
Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."
No.
Sentence
Comment
77
This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively.
X
ABCC7 p.Gln493* 15371908:77:668
status: NEW
PMID: 15908456
[PubMed]
Sanchez-Garcia JF et al: "Multiple mutation analysis of the cystic fibrosis gene in single cells."
No.
Sentence
Comment
61
The mutations assayed are: DF508, DI507, Q493X, V520F, 1717-1G.A, G542X, G551D, R560T, S459R, S459N and R553X labelled with FAM (blue), 3849þ10kbC.T, 3849 þ 4A .
X
ABCC7 p.Gln493* 15908456:61:41
status: NEW
No.
Sentence
Comment
67
SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel.
X
ABCC7 p.Gln493* 16088579:67:1136
status: NEW
PMID: 16429424
[PubMed]
Choi EH et al: "Association of common haplotypes of surfactant protein A1 and A2 (SFTPA1 and SFTPA2) genes with severity of lung disease in cystic fibrosis."
No.
Sentence
Comment
35
Eleven subjects had rare mutations such as G551D/G551D, G551D/3659delC, G551D/I507, G551D/ Neg (2), E60X/Q493X, R1162X/G542X, W1282X/ W1282X (3), and 1717 À G > A/Neg.
X
ABCC7 p.Gln493* 16429424:35:105
status: NEW
PMID: 16435054
[PubMed]
Zilfalil BA et al: "Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays."
No.
Sentence
Comment
55
MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes.
X
ABCC7 p.Gln493* 16435054:55:222
status: NEW
PMID: 17471160
[PubMed]
Huang CK et al: "Validation of cystic fibrosis mutation analysis using ABI 3130XL genetic analyzer."
No.
Sentence
Comment
58
Mutation controls: to specifically assess the detection of CF mutations, 20 cell line DNA samples with mutations of R553X, 3659delC/delF508, delF508/Q493X, 711+ 1G>T/621+1G>T, 621+1G>T/delF508, G85E/ 621+1G>T, R560T/delF508, A455E/621+1G>T, N1303K, W1282X, G551D/R553X, 2789+5G>A/ 2789+5G>A, 3849+10C>T/3849+10C>T, 1717-1G>A, delF508/delF508, R347P/G551D, R334W, V520F, R117H/delF508/5T/9T, or G542X/G542X, respectively, from the Coriell Cell Repositories were analyzed.
X
ABCC7 p.Gln493* 17471160:58:149
status: NEW60 Different Instrument Conditions of ABI 3130XL Genetic Analyzer Condition A Condition B Condition C Condition D Oven_Temperature (1C) 55 55 55 55 Poly_Fill_Vol (Steps) (Polymer Filling Volume) 6500 6500 6500 6500 Current_Stability (mA) (Running Current Stability) 5 5 5 5 PreRun_Voltage (kV) (Voltage for Pre-Run) 15 15 15 15 Pre_Run_Time (s) (Time for Pre-Run) 180 180 180 180 Injection_Voltage (kV) (Sample Injection Voltage) 10 5 5 10 Injection_Time (s) (Sample Injection Time) 5 5 10 10 Voltage_Number_Of_Steps (nK) (Voltage Increase Speed) 10 10 10 10 Voltage_Step_Interval (s) (Voltage Increase Interval) 60 60 60 60 Data_Delay_Time (s) 1 1 1 1 Run_Voltage (kV) (Running Voltage) 15 15 15 15 Run_Time (s) (Running Time) 1200 1200 1200 1200 Huang and Pan Diagn Mol Pathol Volume 16, Number 1, March 2007 r 2007 Lippincott Williams & Wilkins database results except Q493X, which is not covered by this assay (Fig.
X
ABCC7 p.Gln493* 17471160:60:873
status: NEW
PMID: 17914215
[PubMed]
Van Biervliet S et al: "Serum zinc concentrations in cystic fibrosis patients aged above 4 years: a cross-sectional evaluation."
No.
Sentence
Comment
73
Table 1 Genotype of the 101 CF Patients: Details of the CF Mutations and Classification into Two Groups Genotype Groups Genotype No of Patients A ΔF508/ΔF508 47 ΔF508/E60X 1 ΔF508/G542X 7 ΔF508/N1303K 3 ΔF508/Q493X 1 ΔF508/1717-1G→A 1 ΔF508/Y1092X 1 ΔF508/394delTT 1 ΔF508/R785X 1 ΔF508/R553X 1 ΔF508/ΔI507 1 394delTT/394delTT 1 N1303K/N1303K 2 B ΔF508/3849+10kbC-T 1 ΔF508/306ΔTAGA 1 ΔF508/S1251N 8 ΔF508/L927P 1 G458V/1717-1G→A 1 ΔF508/I336K 2 G542X/622-2 A→C 1 ΔF508/G970R 3 ΔF508/3272-26A→G 2 ΔF508/R117H 2 ΔF508/2789+5G→A 2 1717-1G->A/S1251N 1 G542X/G970R 1 394delTT/Y913C 1 N1303K/deletion exon 19 1 Unidentified/unidentified 2 3600+2insTA/2005 del T 1 ΔF508/1898+1G→A 1 Deletion exon 2/del exon 2 1 There was no difference according to gender or age.
X
ABCC7 p.Gln493* 17914215:73:245
status: NEW
PMID: 18676584
[PubMed]
Zhou L et al: "Snapback primer genotyping with saturating DNA dye and melting analysis."
No.
Sentence
Comment
194
The longer snapback 2 covered the Q493X variant and melted between 66 and 72 °C.
X
ABCC7 p.Gln493* 18676584:194:34
status: NEW196 Samples included wild type (circles), compound F508del/Q493X heterozygote (connected small diamonds), I506V heterozygote (small diamonds), F508C heterozygote (small squares), I507del heterozygote (large squares), F508del heterozygote (connected large diamonds), and F508del homozygote (connected squares).
X
ABCC7 p.Gln493* 18676584:196:55
status: NEW
No.
Sentence
Comment
99
They also found an association with ~F508 and R117H in addition to Q493X, R560T, R553X, and 621 þ 1(G!T).34 Noone et al found an association between chronic pancreatitis and the 5T allele associated with complex alleles or in CFTR compound heterozygotes, but no significantly increased frequency has been found with the 5T allele alone.36,39 Finally, there appears to be an additive effect with being a CFTR compound heterozygote and the presence of N34S mutations of the pancreatic secretory trypsin inhibitor (PSTI).36,39 These studies demonstrate the increased risk of chronic pancreatitis due to an abnormally functioning CFTR protein (but may be due to just one mutant CFTR allele37 ).
X
ABCC7 p.Gln493* 19760540:99:67
status: NEW
PMID: 19952026
[PubMed]
Cleveland RH et al: "Cystic fibrosis genotype and assessing rates of decline in pulmonary status."
No.
Sentence
Comment
56
Measurement Tools All chest radiographic, FEV1, and FVC studies were performed at the study institution during the observed life spans Table 2 Patients according to CF Genotype Group Parameter Genotype Class Pancreatic Exocrine Status* No. of Patients Group S (severe pancreatic and pulmonary phenotypes) Subgroup A (class I and class I) 5 G542X/W1282X I/I PI 2 W1282X/W1282X I/I PI 1 621ϩ1G-T/Y1092X I/I PI 1 3120ϩ1G-A/3120ϩ1G-A I/I PI 1 Subgroup B (class I and class II or III) 16 G542X/⌬F508 I/II PI 6 W1282X/⌬F508 I/II PI 3 Q493X/⌬F508 I/II PI 2 R553X/⌬F508 I/II PI 2 1717-1G/⌬F508 I/II PI 1 621ϩ1G-T/⌬F508 I/II PI 1 2184delA/G551D I/III PI 1 Subgroup C (class II and class II or III) 68 D1507/⌬F508 II/II PI 3 N1303K/⌬F508 II/II PI 2 ⌬F508/⌬F508 II/II PI 57 G551D/⌬F508 II/III PI 6 Group M (mild pancreatic and pulmonary phenotypes) Miscellaneous severe and miscellaneous mild 4 ⌬F508/G85E II/IV PS 2 ⌬F508/R117H II/IV PS 1 D1507/R352Q II/IV PS 1 Miscellaneous mild and miscellaneous mild .
X
ABCC7 p.Gln493* 19952026:56:560
status: NEW
PMID: 20622033
[PubMed]
Sermet-Gaudelus I et al: "Ataluren (PTC124) induces cystic fibrosis transmembrane conductance regulator protein expression and activity in children with nonsense mutation cystic fibrosis."
No.
Sentence
Comment
154
BASELINE PATIENT CHARACTERISTICS Characteristic N 5 30 Age, median, yr (range) 12 (6 to 18) Sex, n Male 16 Female 14 BMI, median % predicted*(range) 35 (,1 to 97) Sweat test chloride concentration, median, mEq/L† (range) 104 (84 to 140) TEPD Total chloride transport, median, mV‡ (range) 20.3 (24.6 to 114.6) Pulmonary function, mean % predictedx FEV1 (range) 90 (40 to 133) FVC (range) 99 (52 to 131) Pathologic bacterial/fungal colonization, n 30 Staphylococcus aureus 26 Pseudomonas aeruginosa 9 Hemophilus influenzae 3 Alcaligenes xylosoxidans 1 Stenotrophomonas maltophilia 1 Pancreatic insufficiency, n 30 Exocrine 30 Endocrine 2 Liver enzyme abnormalities, n 15 Alkaline phosphatase 7 Lactate dehydrogenase 6 g-Glutamyltransferase 4 Alanine aminotransferase 4 Aspartate aminotransferase 2 Bilirubin 1 Nonsense mutation genotype (premature stop codon type), n G542Xk (UGA) 14 W1282X (UGA) 4 Q493X (UAG) 3 R553X (UGA) 2 E1104X (UGA) 2 R1162Xk (UGA) 2 W846X (UGA) 1 W882X (UAG) 1 Q1313X (UAA) 1 Definition of Abbreviations: BMI 5 body mass index; TEPD 5 transepithelial potential difference.
X
ABCC7 p.Gln493* 20622033:154:911
status: NEW189 TOTAL CHLORIDE TRANSPORT RESPONSE AND HYPERPOLARIZATION BY NONSENSE MUTATION TYPE Nonsense Mutation Type Responses* n/N† % Response Rate Hyperpolarizations‡ n/N† % Hyperpolarization Rate Q493X (UAG) 1/3 33 1/3 33 G542X (UGA) 8/14 57 7/14 50 R553X (UGA) 1/2 50 1/2 50 W846X (UGA) 0/1 0 0/1 0 W882X (UAG) 1/1 100 1/1 100 E1104X (UGA) 1/2 50 0/2 0 R1162X (UGA) 1/2 50 2/2 100 W1282X (UGA) 2/4 50 2/4 50 Q1313X (UAA) 0/1 0 0/1 0 * At least a 25 mV total chloride transport improvement in either cycle.
X
ABCC7 p.Gln493* 20622033:189:208
status: NEW235 Our findings indicate that multiple genotypes (Q493X, G542X, R553X, W882X, E1104X, R1162X, and W1282X) can be responsive to ataluren therapy.
X
ABCC7 p.Gln493* 20622033:235:47
status: NEW
PMID: 20932301
[PubMed]
Green DM et al: "Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients."
No.
Sentence
Comment
74
For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function.
X
ABCC7 p.Gln493* 20932301:74:482
status: NEW
PMID: 21184098
[PubMed]
de Becdelievre A et al: "Comprehensive description of CFTR genotypes and ultrasound patterns in 694 cases of fetal bowel anomalies: a revised strategy."
No.
Sentence
Comment
119
[Q493X] c.[1521_1523delCTT]?
X
ABCC7 p.Gln493* 21184098:119:1
status: NEW
PMID: 9725921
[PubMed]
Sharer N et al: "Mutations of the cystic fibrosis gene in patients with chronic pancreatitis."
No.
Sentence
Comment
32
DNA Studies We extracted DNA from buccal cells obtained by having the patients rinse their mouths with 10 ml of 4 percent sucrose.19 The CFTR locus was examined for the 22 mutations that together account for 95 percent of all such mutations in patients with cystic fibrosis in the northwest of England.20 The amplification- refractory mutation system Elucigene CF(4)m kit (Zeneca Diagnostics, Macclesfield, United Kingdom) was used to detect the four most common mutations: ∆F508, G551D, G542X, and 621+1(G→T)21; the polymerase chain reaction, restriction-enzyme analysis, and allele-specific oligonucleotide hybridization facilitated the detection of R560T, R117H, 1898+1(G→A), R553X, S549N, 1717¡1(G→A), N1303K, W1282X, E60X, 1154insTC, R347P, 3659delC, Q493X, V520F, R334W, ∆I507, 3849+10Kb(C→T), and 1078delT.
X
ABCC7 p.Gln493* 9725921:32:789
status: NEW66 * PATIENT NO.† SEX MUTANT ALLELE POLYT GENOTYPE AGE AT ONSET OF PANCREATITIS AGE AT STUDY ENTRY EXOCRINE STATUS AND CALCULI‡ ALCOHOLISM »10 CIGARETTES/ DAY SWEAT TESTING BASE-LINE NASAL POTENTIAL DIFFERENCE SODIUM CHLORIDE yr mmol/liter mV 1 M DF508 9T/7T 8 27 PS0 No No 43.5 32.0 12.5 2 F DF508 9T/5T 15 34 PS1 No No 55.0 47.5 ND 3 M R117H 7T/7T 18 21 PS0 No Yes 44.0 33.0 ¡9.7 4 M DF508 9T/7T 18 26 PI3 No No ND ND ND 5 M DF508 9T/7T 18 30 PI3 No Yes ND ND ND 6 F Q493X 7T/5T 19 21 PS3 No Yes 51.5 41.0 ND 7 F DF508 9T/7T 20 31 PS3 No No 35.0 23.0 ¡10.8 8 M 621+1(G→T) 9T/7T 21 37 PS3 Yes Yes 72.0 48.5 5.0 9 M R560T 7T/7T 21 39 PI0 Yes Yes 103.0 76.0 ¡4.4 10 M DF508 9T/5T 22 36 PI3 Yes No 53.0 34.0 ¡17.6 11 M DF508 9T/7T 31 45 PS3 No Yes 55.0 34.0 ¡11.5 12 M R117H 7T/7T 35 38 PI2 Yes No ND ND ND 13 F DF508 9T/7T 36 39 PS3 No Yes 60.0 39.0 ¡10.2 14 F R553X 7T/5T 37 56 PI3 No Yes ND ND ND 15 F DF508 9T/7T 45 47 PI3 Yes Yes 104.0 80.0 ¡8.3 16 M DF508 9T/7T 49 52 PS1 Yes Yes ND ND ND 17 F DF508 9T/7T 64 76 PI3 No No 69.0 50.0 ¡10.3 18 F DF508 9T/9T 75 79 PS3 No No 34.5 19.0 ¡14.7 or radiologic abnormalities in 133 patients.
X
ABCC7 p.Gln493* 9725921:66:490
status: NEW
PMID: 17440499
[PubMed]
Keymolen K et al: "Clinical outcome of preimplantation genetic diagnosis for cystic fibrosis: the Brussels' experience."
No.
Sentence
Comment
69
2 p.F508del/- p.N1303K/- 1 p.Q493X/- p.F508del/- 1 p.F508del/- p.R1162X/- 1 p.4218insT/- p.N1303K/- 1 p.G673X/- p.F508del/- 1 p.W1282X/- p.G542X/- 1 p.F508del/- p.W1282X/- 1 p.W1282X/- p.F508del/- 2 p.F508del/- p.G551D/- 1 p.D1168G/- p.L206W/- 1 If we express these results per cycle with oocyte retrieval, this means that in each cycle there was an average of 12.5 COCs, giving 5.1 embryos to be biopsied with an 80% chance of having an embryo transfer and a 22.2% chance of having an ongoing pregnancy with the delivery of a child.
X
ABCC7 p.Gln493* 17440499:69:29
status: NEW
PMID: 22658665
[PubMed]
Ooi CY et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis."
No.
Sentence
Comment
855
CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray.
X
ABCC7 p.Gln493* 22658665:855:249
status: NEW
PMID: 22853952
[PubMed]
Ramachandran S et al: "A microRNA network regulates expression and biosynthesis of wild-type and DeltaF508 mutant cystic fibrosis transmembrane conductance regulator."
No.
Sentence
Comment
111
We also expressed a recombinant CMV promoter-driven CFTR-ΔF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41).
X
ABCC7 p.Gln493* 22853952:111:124
status: NEW161 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments.
X
ABCC7 p.Gln493* 22853952:161:63
status: NEW110 We also expressed a recombinant CMV promoter-driven CFTR-ƊF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41).
X
ABCC7 p.Gln493* 22853952:110:123
status: NEW159 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments.
X
ABCC7 p.Gln493* 22853952:159:63
status: NEW
PMID: 22035343
[PubMed]
Sebro R et al: "Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency."
No.
Sentence
Comment
64
CFTR mutation classification for compound heterozygotesa Mutations n (%) Biological classification Grantham score SIFT Q493X 3 (3) Ib - - G542X 21 (20) Ib,c,e - - R553X 4 (4) Ib,e - - Y1092X 2 (2) Ib - - R1158X 1 (1) NA - - W1282X 9 (9) Ib,e - - G85E 4 (4) IIIb 98 0.01 R117H 4 (4) IVb,c 29 0.60 R334W 1 (1) IVb 101 0.02 R347P 1 (1) IVb 103 0.05 R352Q 1 (1) NA 43 0.35 G551D 20 (19) IIIb,c 94 0.00 R560T 3 (3) IIIb 71 0.00 D1270N 1 (1) NA 23 0.01 N1303K 6 (6) IIg 94 0.00 I507del 3 (3) IId - - 394delTT 1 (1) NAc - - 621+1G>T 7 (7) Ib,f - - 711+1G>T 2 (2) Ib - - 1717-1G>A 5 (5) Ib,c,e,f - - 1898+1G>A 2 (2) NA - - 2789+5G>A 3 (3) Vb - - 3659delC 1 (1) Ib - - 3849+10kbC>T 2 (2) Vb,c,f - - 3905insT 1 (1) Ib - - NA, not applicable; SIFT, Sorting Intolerant from Tolerant. a The following mutations biological classification scores could not be verified: 1898+G-A, 394delTT, D1270N, R352Q, and R1158X.
X
ABCC7 p.Gln493* 22035343:64:119
status: NEW
PMID: 16049310
[PubMed]
Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."
No.
Sentence
Comment
51
Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Gln493* 16049310:51:2481
status: NEW
PMID: 15507674
[PubMed]
Hadd AG et al: "Microsphere bead arrays and sequence validation of 5/7/9T genotypes for multiplex screening of cystic fibrosis polymorphisms."
No.
Sentence
Comment
197
Intron 8 Genotype by Coriell Number, Characterized CF Mutation and Allele Fraction for 5/7/9T Intron 8 genotype Coriell sample Characterized mutation Allele fraction by probe 5T 7T 9T 7T/7T NA09947 Normal 0.04 0.93 0.03 NA11277 ⌬I507/normal 0.06 0.90 0.04 NA11761 G551D/R553X 0.06 0.92 0.02 NA11859 2789ϩ5GϾA/2789ϩ5GϾA 0.02 0.96 0.02 NA11860 3849ϩ10kbCϾT/3849ϩ10kbCϾT 0.03 0.94 0.03 NA12444 1717-1GϾT/normal 0.06 0.87 0.07 NA12585 R1162X/normal 0.07 0.86 0.08 NA12785 R347P/G551D 0.04 0.92 0.05 NA12960 R334W/normal 0.06 0.92 0.02 NA12961 V520F/normal 0.06 0.89 0.05 NA13033 F508C/normal 0.03 0.93 0.04 9T/9T NA01531 ⌬F508/⌬F508 0.14 0.04 0.82 NA11281 621ϩ1GϾT/⌬F508 0.14 0.04 0.82 NA11283 A455E/⌬F508 0.13 0.05 0.82 NA11290 A455E/621ϩ1GϾT 0.12 0.01 0.87 NA11496 G542X/G542X 0.14 0.05 0.81 5T/7T NA11723 W1282X/normal 0.53 0.44 0.03 NA13032 I506V/normal 0.58 0.39 0.03 5T/9T NA11279 129GϾC/⌬F508 0.51 0.00 0.49 NA13591 R117H/⌬F508 0.52 0.00 0.48 7T/9T NA07441 3120ϩ1GϾA/621ϩ1GϾA 0.08 0.41 0.51 NA07552 R553X/⌬F508 0.09 0.36 0.55 NA07830 556dA/⌬F508 0.11 0.37 0.52 NA11275 3659dC/⌬F508 0.10 0.37 0.53 NA11278 Q493X/⌬F508 0.09 0.38 0.53 NA11280 711ϩ1GϾT/621ϩ1GϾA 0.09 0.37 0.54 NA11282 G85E/621ϩ1GϾA 0.07 0.39 0.53 NA11284 R560T/⌬F508 0.08 0.39 0.52 NA11472 N1303K/G1349D 0.08 0.39 0.54 Figure 3.
X
ABCC7 p.Gln493* 15507674:197:1286
status: NEW
No.
Sentence
Comment
62
is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic ®brosis of the pancreas'.
X
ABCC7 p.Gln493* 12079272:62:237
status: NEW64 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuQciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 W 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic &#ae;brosis of the pancreas'.
X
ABCC7 p.Gln493* 12079272:64:236
status: NEW
PMID: 10923036
[PubMed]
Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."
No.
Sentence
Comment
103
b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA.
X
ABCC7 p.Gln493* 10923036:103:119
status: NEW
PMID: 10862085
[PubMed]
Ellis LA et al: "A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning."
No.
Sentence
Comment
97
Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE.
X
ABCC7 p.Gln493* 10862085:97:1058
status: NEW
PMID: 9674722
[PubMed]
Schwiebert EM et al: "Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein."
No.
Sentence
Comment
223
They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X).
X
ABCC7 p.Gln493* 9674722:223:210
status: NEW
PMID: 9311495
[PubMed]
Ho LP et al: "Correlation between nasal potential difference measurements, genotype and clinical condition in patients with cystic fibrosis."
No.
Sentence
Comment
60
Data analysis Patients were divided into two groups, according to genotype: 1) mutations that fail to generate significant apical membrane protein (∆F508/∆F508, ∆F508/ W1282X, ∆F508/Q493X) and 2) mutations where gene product is present in the apical membrane (∆F508/G551D, ∆F508/ A455E, ∆F508/R117H, G551D/G551D) [12].
X
ABCC7 p.Gln493* 9311495:60:206
status: NEW
PMID: 9135734
[PubMed]
Porteous DJ et al: "Evidence for safety and efficacy of DOTAP cationic liposome mediated CFTR gene transfer to the nasal epithelium of patients with cystic fibrosis."
No.
Sentence
Comment
32
Table 1 Anthropometric data Group Patient Gender Age Genotype FEV1 No (% predicted) Placebo 03 Female 33 ⌬F508/R117H 57 06 Male 27 ⌬F508/⌬F508 55 08 Female 29 ⌬F508/A455E 97 11 Female 42 ⌬F508/Q493X 24 15 Male 30 ⌬F508/R560T 20 16 Female 20 ⌬F508/⌬F508 70 18 Female 27 ⌬F508/⌬F508 21 21 Female 20 ⌬F508/⌬F508 20 Mean (s.d.) 6F, 2M 28.5 (7.1) 51.9 (28.1) Treated 01 Male 31 ⌬F508/G551D 45 05 Female 30 ⌬F508/⌬F508 91 09 Male 32 G551D/G551D 37 10 Female 29 ⌬F508/⌬F508 63 13 Male 16 ⌬F508/⌬F508 55 14 Female 37 ⌬F508/G551D 66 19 Male 23 ⌬F508/W1282X 37 23 Female 21 ⌬F508/G551D 53 Mean (s.d.) 4F, 4M 27.4 (6.8) 55.9 (17.8) and illustrative results shown in Figure 3.
X
ABCC7 p.Gln493* 9135734:32:228
status: NEW
PMID: 9135733
[PubMed]
Gill DR et al: "A placebo-controlled study of liposome-mediated gene transfer to the nasal epithelium of patients with cystic fibrosis."
No.
Sentence
Comment
20
treatment, this condition still leads to an untimely death, Alternative, nonviral, gene delivery systems are receiving often in early adult life.3 increased attention, specifically cationic liposomes such as DC-Chol/DOPE (3beta[N-(N',N'-dimethylamino- ethane)-carbomoyl] cholesterol/dioleoylphosphatidylethanolamine).12 In clinical trials, DC-Chol/DOPE lipo-Correspondence: DR Gill, Nuffield Department of Clinical Biochemistry, somes have been shown to mediate gene transfer inJohn Radcliffe Hospital, University of Oxford, Oxford OX3 9DU, UK Received 5 November 1996; accepted 4 December 1996 patients with no evidence of inflammation, tissue damage or systemic immune response.13,14 Table 1 Patient details Treatment Patient Age Sex Genotype FEV1 (litres) FVC (litres) Clinical score Low CFTR 3 19 M ⌬F508/⌬F508 4.80 6.30 90 Low CFTR 5 17 M ⌬F508/⌬F508 4.40 5.70 95 Low CFTR 6 21 M ⌬F508/⌬F508 3.10 4.60 75 Low CFTR 10 27 F ⌬F508/⌬F508 1.40 1.90 70 High CFTR 2 21 M ⌬F508/⌬F508 1.65 3.25 60 High CFTR 7 21 M ⌬F508/⌬F508 3.00 4.30 75 High CFTR 9 20 F ⌬F508/G551D 1.45 3.0 50 High CFTR 12 27 F R553X/Q493X 2.30 3.15 45 Placebo-Vector 1 20 M ⌬F508/G551D 1.90 3.10 40 Placebo-Vector 8 19 M ⌬F508/R1162X 0.85 1.55 40 Placebo-Krebs 4 33 M ⌬F508/⌬F508 3.00 4.00 70 Placebo-Krebs 11 21 F ⌬F508/⌬F508 2.25 3.15 85 All patients were pancreatic insufficient.
X
ABCC7 p.Gln493* 9135733:20:1195
status: NEW
No.
Sentence
Comment
22
List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories.
X
ABCC7 p.Gln493* 9222762:22:1043
status: NEW57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1.
X
ABCC7 p.Gln493* 9222762:57:693
status: NEW
PMID: 8617131
[PubMed]
McGill JM et al: "Survey of cystic fibrosis transmembrane conductance regulator genotypes in primary sclerosing cholangitis."
No.
Sentence
Comment
33
In total, 32 mutations were evaluated, which represent 90% of the most common mutations (t4): AF508 G542X G551D W1282X 3905insT NI303K 3849+ 10kbC--~T R553X 621+ IG--*T 1717- IG--,A lt)78delT 2789+5G---~A 3849+4A--~G 711+ IG---oT R1162X 1898+IG----~A R117H 3659delC G85E 2184delA A1507 R347P Y1092X R560T A455E R334W Y122X S549R(T---~G) Q493X V520F $549N R347H Patient Selection.
X
ABCC7 p.Gln493* 8617131:33:337
status: NEW
PMID: 8956039
[PubMed]
Hughes DJ et al: "Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes."
No.
Sentence
Comment
75
AF508, AF508lAF508, M470V (p),Q493X, Q493WAF508,V520F.
X
ABCC7 p.Gln493* 8956039:75:30
status: NEW
PMID: 8829658
[PubMed]
Cronin MT et al: "Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays."
No.
Sentence
Comment
238
Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design.
X
ABCC7 p.Gln493* 8829658:238:179
status: NEW
PMID: 7472820
[PubMed]
Wilschanski M et al: "Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations."
No.
Sentence
Comment
43
Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles.
X
ABCC7 p.Gln493* 7472820:43:401
status: NEW
PMID: 7521710
[PubMed]
Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."
No.
Sentence
Comment
121
1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.).
X
ABCC7 p.Gln493* 7521710:121:238
status: NEW
PMID: 7513292
[PubMed]
Verlingue C et al: "Retrospective study of the cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Guthrie cards from a large cohort of neonatal screening for cystic fibrosis."
No.
Sentence
Comment
69
1 Kerem et al. 1990 1 394 del TT 3 0.05 Claustres et al. 1993 1 E60X 3 0.05 unpublished data 1 621 + 1 G---~T intron 5 0.05 Zielenski et a1.1991 1 876 - 14 del 12 NT 6a 0.05 Audr6zet et a1.1993 1 Q493X 10 0.05 Kerem et al. 1990 1 1507 10 0.05 Kerem et al. 1990, Schwartz et al. 1991 1 1717 - 1 G---~A intron 10 0.05 Kerem et al. 1990, Guillermit et al. 1990 1 K710X 13 0.05 Fanen et al. 1992 1 L610S 13 0.05 This study 1 E83 IX 14a 0.05 This study 1 W846X 14a 0.05 Vidaud et al. 1990 1 $945L 15 0.05 Claustres et al. 1993 1 Y1092X 17b 0.05 unpublisheddata 1 3359 del CT 17b 0.05 Mercier et al. 1993 1 RI066C 17b 0.05 Fanen et al. 1992 1 W1204X 19 0.05 Costes et al. 1993 1 R1162X 19 0.05 Gasparini et al. 1991 1 W1282X 20 0.05 Vidaud et al. 1990 175 Identified 96.1 6 Unidentified 3.9 15 No blood left to perform the complete analysis 196 Total The affected child has a pancreatic insufficiency.
X
ABCC7 p.Gln493* 7513292:69:196
status: NEW
PMID: 7509564
[PubMed]
Grebe TA et al: "Genetic analysis of Hispanic individuals with cystic fibrosis."
No.
Sentence
Comment
45
The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC- T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G- T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted).
X
ABCC7 p.Gln493* 7509564:45:381
status: NEW54 COther = A1507, 621+1G- T, R117H, N1303K, 711+1G-*.T, 1717-1G-.A, R560T, Y122X, 1148T, G314E, 1078AT, R347P, Q493X, V520F, and 3659AC.
X
ABCC7 p.Gln493* 7509564:54:109
status: NEW56 The G542X mutation was found in 5.4% of Hispanic CF chromosomes, similar to the 3% frequency in the general population.
X
ABCC7 p.Gln493* 7509564:56:108
status: NEW47 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC-T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G-T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted).
X
ABCC7 p.Gln493* 7509564:47:379
status: NEW
No.
Sentence
Comment
64
Frequent cystic fibrosis mutations Name Relative freqeenc~ Mutation Con~,~'~luence Ref. Z~508 67.2 G542X 3.4 G551D 2.4 W1282X 2.1 3905insT 2.1 N1303K 1.8 3849+10kbC-+T 1.4 1717-1G-+A 1078delT 2789+5G--+A Deletion of 3 bp between nt 1652 and t655 in exon 10 G-+T at nt 1756 in exon 11 G-+A at nt 1784 in exon 1I G-+A at nt 3978 in exon 20 Insertion of T after nt 3905 in exon 20 C-+G at nt 4041 in exon 21 C-->T in a 6.2 kb EcoRI fragment 10 kb from 5' junction of intron 19 3849+4A-+G 1.0 7tt÷IG--+T 0.9 Rl162X 0.9 1898+lG-+A 0.9 Rll7H 0.8 3659delc 0.8 G85E 0.7 2184delA 0.7 AI5W 0.5 R347P 0.5 R~ 0.4 1,3 C-+T at nt 1"789in exon 11 1.3 G-+T at nt 1 from 5' junction of intron 4 1.1 G--+A at nt 1 from 3' junction of intron 10 1.1 Deletion of T at nt 1078 in exon 7 1.1 G-cA at 5 nt from 5' end of intron 14b A-->G at 4 nt from 5' end of intron 19 G-+T at nt 1 from 5' junction of intron 5 C-+T at nt 3616 in exon 19 G-+A at nt 1 from 5' junction of intron 12 G--)A at nt 482 in exon Deletion of C at nt 3659 in exon 19 G-+A at nt 386 in exon 3 A-->G at nt 2183 and deletion of A at nt 2184 in exon 13 Deletion of 3 bp between nt 1648 and 1653 in exon 10 G-+C at nt 1172 in exon 7 G-~C at nt 1811 in exon 11 A455E 0.4 R334W 0.4 Y122X 0.3 S549R(T-+G) 0.3 Q493X 0.3 V520F 0.2 S549N 0.2 C-+A at nt 1496 in exon 9 C-+T at nt 1132 in exon 7 T-cA at nt ~i98 in exon 4 T--+G at nt 1779 in exon 11 C-+T at nt 1609 in exon 10 G-+T at nt 1690 in exon 10 G-->A at nt I778 in exon !1 Deletion of Phe at codon 508 Gly-+Stop at codon 542 12 Gly-~Asp at codon 551 10 l"rp-->Stop at codon t282 35 Frameshift -~ Asn-+Lys at codon 1303 36 Aberrant splicing -~ Arg~Stop ~ codon 553 Splice mutation 10 37 Splice mutation 12 Frameshift 38 Splice mutation _c Splice mutation?
X
ABCC7 p.Gln493* 1279852:64:1258
status: NEW
No.
Sentence
Comment
164
Mutations encountered elsewhere in UK but not yet m N-W 1154insTC R347P A455E G458V Q493X C524X S549N R1283M Q1291H 199 (in the north-west group) 199 199 0 0 0 199 199 0 icant alteration in function appears to be worse than no CFTR being formed at all.
X
ABCC7 p.Gln493* 1281032:164:84
status: NEW
PMID: 1357180
[PubMed]
Cheadle J et al: "Mutation analysis of 184 cystic fibrosis families in Wales."
No.
Sentence
Comment
61
Welsh Mixed Undefined Total Mutation No % No % No % No % AF508 107/149 71-8 92/126 73 0 69/94 73 4 268/369 72-6 621 + 1G>T 10/42* 6-7 5/34* 4-0 4/25* 4-3 19/101* 51 G551D 2/42* 1-3 6/34* 4-8 3/25* 3-2 11/101* 3 0 G542X 4/42* 2-7 4/34* 3-2 1/25* 1.1 9/101* 2-4 G85E 0/41* 0-0 2/34* 1 6 3/24* 3*4 5/99* 1-4 R553X 2/42* 1-3 2/34* 16 0/25* 00 4/101* 1-1 R1283M 3/42* 2.0 0/34* 0.0 0/25* 0.0 3/101* 0-8 N1303K 1/42* 0 7 1/34* 0-8 0/24* 0.0 2/100* 0-6 AI507 2/149 1-3 0/126 0.0 0/94 0.0 2/369 0-5 R117H 1/42* 0 7 1/34* 0-8 0/25* 0.0 2/101* 0-5 1717- 1G>A 2/42* 1-3 0/34* 0 0 0/25* 0 0 2/101* 0-5 R560T 0/42* 00 0/34* 00 1/25* 1 1 1/101* 03 1154InsTC 0/40* 0 0 1/33* 0 9 0/24* 0.0 1/97* 0-3 V520F 0/42* 0 0 0/34* 0 0 0/25* 0.0 0/101* 0 0 W1282X 0/42* 0 0 0/34* 0.0 0/25* 0.0 0/101* 0 0 R347P 0/42* 0 0 0/34* 0 0 0/24* 0.0 0/100* 0 0 Q493X 0/42* 0 0 0/34* 0 0 0/24* 0 0 0/100* 00 Total (%) 89-8 90 7 86-5 891 * Non-AF508 chromosomes.
X
ABCC7 p.Gln493* 1357180:61:826
status: NEW
PMID: 1376016
[PubMed]
Kristidis P et al: "Genetic determination of exocrine pancreatic function in cystic fibrosis."
No.
Sentence
Comment
10
This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as AF508, A1507, Q493X, G542X, R553X, W1282X, 621 + 1G-PT, 1717-1G--'A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.
X
ABCC7 p.Gln493* 1376016:10:338
status: NEW57 Intron 4: 621 + 1G-T Exon 7: R334W ......... R347P ........... Exon 9: A455E .......... G458V .......... G480C .......... Exon 10: Q493X .......... A1507 ........... AF508 .......... VS2OF ..........
X
ABCC7 p.Gln493* 1376016:57:131
status: NEW81 Table 4 Classification of CF Gene Mutations as Severe or Mild with Respect to Pancreatic Function Type of Mutation Severe (location) Mild (location) Missense (point mutation) ...... 1148T (exon 4) R117H (exon 4) G480C (exon 9) R334W (exon 7) VS2OF (exon 10) GSS1D (exon 11) R347P (exon 7) RS60T (exon 11) A455E (exon 9) N1303K (exon 21) P574H (exon 12) Single amino acid deletion ........ AFS08 (exon 10) A1507 (exon 10) Stop codon (nonsense) ..... Q493X (exon 10) G542X (exon 11) R553X (exon 11) W1282X (exon 20) Splice junction ... 621 + 1G-T (intron 4) 1717-1G-T (intron 10) Frameshift ........ 556delA (exon 4) 3659delC (exon 19) with any of the mild mutations was associated with PS.
X
ABCC7 p.Gln493* 1376016:81:449
status: NEW85 Accordingly, the mutations R117H, R334W, R347P, A455E, and P574H may be regarded as mild, whereas AF508, AI507, Q493X, G542X, R553X, W1282X, 621 + 1G-T, 1717-1G--A, 556delA, 3659delC, 1148T, G480C, V520F, GSS1D, and R560T are severe.
X
ABCC7 p.Gln493* 1376016:85:112
status: NEW
PMID: 11755047
[PubMed]
Gomez-Llorente MA et al: "Analysis of 31 CFTR mutations in 55 families from the South of Spain."
No.
Sentence
Comment
27
The patients and their families were referred to us from six Table 1 Listing of the CFTR mutations which are interrogated in the CF assay used in this study Mutation Location Mutation Location Exon/Intron Exon/Intron DF508 E.10 W1282X E.20 F508C E.10 3905insT E.20 DI507 E.10 N1303K E.21 Q493X E.10 G85E E.3 V520F E.10 621 + 1G !
X
ABCC7 p.Gln493* 11755047:27:288
status: NEW
PMID: 1372093
[PubMed]
Cuppens H et al: "Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot."
No.
Sentence
Comment
19
Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population .
X
ABCC7 p.Gln493* 1372093:19:146
status: NEW
PMID: 15463882
[PubMed]
Hubert D et al: "Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis."
No.
Sentence
Comment
129
* 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x.
X
ABCC7 p.Gln493* 15463882:129:34
status: NEW
PMID: 16621508
[PubMed]
Mannelli I et al: "DNA immobilisation procedures for surface plasmon resonance imaging (SPRI) based microarray systems."
No.
Sentence
Comment
8
Two deletions of three bases (F508 and I507) and four single nucleotide polymorphisms (M470V, Q493X, V520F and 1716 G > A) were investigated.
X
ABCC7 p.Gln493* 16621508:8:96
status: NEW56 The probe (P) sequences used are: 1, F508 wild type (P-F508-WT) = 5 biotin (T)17 ATA TCA TCT TTG GTG 3; 2, F508 mutant (P-F508-M) = 5 biotin (T)17 AAT ATC ATT GGT GTT 3; 3, I507 wild type (P-I507-WT) = 5 biotin (T)15 GAA AAT ATC ATC TTT G 3; 4, I507 mutant (P-I507-M) = 5 biotin (T)15 GAA AAT ATC TTT GGT 3; 5, M470V wild type (P-M470V-WT) = 5 biotin (T)16 TTC TAA TGA TGA TTA 3; 7, M470V mutant (P-M470V-M) = 5 biotin (T)16 TTC TAA TGG TGA TTA 3; 9, 1716 G > A wild type (P-1716 G > A-WT) = 5 biotin (T)18 AGA AGA GGT AAG A 3; 11, 1716 G > A mutant (P-1716 G > A-M) = 5 biotin (T)18 AGA AGA AGT AAG A 3; 13, Q493X wild type (P-Q493X-WT) = 5 biotin (T)18 TGT TCT CAG TTT T 3; 15, Q493X mutant (P-Q493X-M) = 5 biotin (T)18 TGT TCT TAG TTT T 3; 17, V520F wild type (P-V520F-WT) = 5 biotin (T)19 GAA GCG TCA TC 3; 19, V520F mutant (P-V520F-M) = 5 biotin (T)19 GAA GCT TCA TC 3 and 21, not relevant (P-NR) = 5 biotin (T)18 CAC TTC GTG CCT T 3.
X
ABCC7 p.Gln493* 16621508:56:636
status: NEWX
ABCC7 p.Gln493* 16621508:56:655
status: NEWX
ABCC7 p.Gln493* 16621508:56:709
status: NEWX
ABCC7 p.Gln493* 16621508:56:725
status: NEW61 In the case of the remaining polymorphisms, the correspondence with the official nomenclature is: M470V-WT = c.1540A (normal allele), M470V-M = c.1540G (mutant allele), Q493X- WT = c.1609C (normal allele), Q493X-N = c.1609T (mutant allele), 1716 G > A-WT = c.1716G (normal allele), 1716 G > AM = c.1716A (mutant allele), V520F-WT = c.1690G (normal allele) and V520F-M = c.1690T (mutant allele).
X
ABCC7 p.Gln493* 16621508:61:169
status: NEWX
ABCC7 p.Gln493* 16621508:61:206
status: NEW
PMID: 16635477
[PubMed]
Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."
No.
Sentence
Comment
26
None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22].
X
ABCC7 p.Gln493* 16635477:26:340
status: NEW
PMID: 16963320
[PubMed]
Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."
No.
Sentence
Comment
78
At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT.
X
ABCC7 p.Gln493* 16963320:78:194
status: NEW
PMID: 24357848
[PubMed]
Zvereff VV et al: "Cystic fibrosis carrier screening in a North American population."
No.
Sentence
Comment
63
This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population.
X
ABCC7 p.Gln493* 24357848:63:2837
status: NEW
PMID: 24517344
[PubMed]
Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."
No.
Sentence
Comment
81
As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B).
X
ABCC7 p.Gln493* 24517344:81:655
status: NEW
PMID: 25674778
[PubMed]
Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."
No.
Sentence
Comment
15
Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve.
X
ABCC7 p.Gln493* 25674778:15:1317
status: NEW
PMID: 26014425
[PubMed]
Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."
No.
Sentence
Comment
78
Table 1 Examples of common CF-causing, indetermined, and non CF-causing variants (modified from5,8,17) HGVS nomenclature Legacy name cDNA nucleotide name Protein name CF-causing variantsa F508del c.1521_1523delCTT p.Phe508del G542X c.1624G4T p.Gly542* G551D c.1652G4A p.Gly551Asp N1303K c.3909C4G p.Asn1303Lys W1282X c.3846G4A p.Trp1282* 621+1G4T c.489+1G4T CFTRdele2,3 c.54-5940_273 +10250del21080 p.Ser18Argfs*16 E60X c.178G4T p.Glu60* G85E c.254G4A p.Gly85Glu 394delTT c.262_263delTT p.Leu88Ilefs*22 711+1G4T c.579+1G4T R347P c.1040G4C p.Arg347Pro A455E c.1364C4A p.Ala455Glu Q493X c.1477C4T p.Gln493* I507del c.1519_1521delATC p.Ile507del R553X c.1657C4T p.Arg553* R560T c.1679G4C p.Arg560Thr 1898+1G4A c.1766+1G4A 2183AA4G c.2051_2052delAAinsG p.Lys684Serfs*38 2789+5G4A c.2657+5G4A 3120+1G4A c.2988+1G4A M1101K c.3302 T4A p.Met1101Lys R1162X c.3484C4T p.Arg1162* 3659delC c.3528delC p.Lys1177Serfs*15 M1V c.1 A4G p.?
X
ABCC7 p.Gln493* 26014425:78:579
status: NEW
PMID: 26087176
[PubMed]
Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."
No.
Sentence
Comment
63
Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented.
X
ABCC7 p.Gln493* 26087176:63:1023
status: NEW
PMID: 8697849
[PubMed]
Colin AA et al: "Pulmonary function and clinical observations in men with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
38
His stool description Table 1.Age, Sweat Sodium and Chloride Concentration and Ratio, and Genotype Subject/Age, yr Symptoms Sweat Na+: mEq/L Sweat Cl mEq/L Na:Cl Ratio CFTR Genotype Polythymidine Splice Variant l*/32 2*/27 3f/30 4/23 5*/22 6*/31 7*/37 8/30 9/41 10/31 11/31 12/38 13/40 14/32 15/31 16/43 17/40 18/27 Asthma Malabsorption Bronchitis Asthma 100 39 53 37 36 36 26 46 42 35 83 74 44 44 44 28 21 106 80 37 51 35 34 34 24 45 43 32 79 75 46 44 40 32 22 0.94 1.05 1.03 1.06 1.05 1.05 1.08 1.00 0.98 1.09 1.05 0.99 0.96 1.00 1.10 0.90 0.95 AF508/R117H AF508/R117H AF508/- AF508/- AF508/- AF508/- AF508/- R117H/- Q493X/- AF508/- AF508/- AF508/R117H G551D/R117H G551D/D1152H AF508/- G542X/- R117H/- -/- 7/9 7/9 5/9 5/9 7/7 7/9 7/9 NT$ 7/7 NT NT 7/9 7/7 7/7 5/9 5/9 7/7 5/9 * Subject 1 and 2 are brothers.
X
ABCC7 p.Gln493* 8697849:38:619
status: NEW