ABCMdb

ABCC7 p.Asp924Arg

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 10026154 [PubMed] Cotten JF et al: "Cystic fibrosis-associated mutations at arginine 347 alter the pore architecture of CFTR. Evidence for disruption of a salt bridge."

No. Sentence Comment

6 Interestingly, the D924R mutation complemented R347D, yielding a channel that behaved like wild-type CFTR. Login to comment
119 Single-channel I-V relationships for R347E (OL and OB states), R347H (OL and OB states), R347K, R347D/D924R, and wild-type CFTR at pHc 6.0. n ϭ 2-4 at each data point. Login to comment
148 The Phenotype of R347D Is Suppressed by the D924R Mutation-The data suggest that Arg-347 and Lys-347 may stabilize the structure of the pore; in their absence, the channel "flickers" between two conductance states. Login to comment
154 We studied the conductance properties of the following double mutants: R347D/D924R, R347D/D993R, and R347E/E1104R. Login to comment
161 In contrast to the other double mutants, the R347D/D924R mutant did not display the pHc-dependent flicker found in the R347D single mutant (Fig. 5, A and B), and there was no effect of pH on open-channel variance (Fig. 5B). Login to comment
163 These data suggest that the D924R mutation compensates for or rescues the phenotype of the R347D mutation. Login to comment
164 This result predicts that the D924R mutation alone (with Arg at position 347) would generate an unstable channel with at least two open conductance states. Login to comment
165 Fig. 6 shows that the D924R single mutant displayed multiple (ϳ3) conductance states that appeared to be pHc-independent. Login to comment
179 A, single-channel current tracings from excised, inside-out membrane patches containing R347E/E1104R, R347D/D924R, and R347D/D993R. Login to comment
181 B, current variance of R347E/E1104R, R347D/D924R, and R347D/D993R at the indicated pHc was collected as in Fig. 3. Login to comment
199 Second, and more importantly, we found that a second-site complementary mutation at position 924 (D924R) largely eliminated the pHc-dependent flickering phenotype of the R347D mutation and restored current amplitude to near wild-type values. Login to comment
202 As predicted, we found that the D924R mutant displayed erratic flickery, pHc-independent behavior. Login to comment
204 The pHc independence of D924R is also consistent with the hypothesis that Asp-924 is the site of protonation in the residue 347 mutants. Login to comment
207 The studies of R347D/D924R are consistent with a salt bridge between Arg-347 and Asp-924 and thus an interaction between M6 and M8. Login to comment

PMID: 18366345 [PubMed] Caci E et al: "Evidence for direct CFTR inhibition by CFTR(inh)-172 based on Arg347 mutagenesis."

No. Sentence Comment

127 CFTR form CFTRinh-172 Ki (μM) Hill coefficient I- influx (mM/s) n Wild-type 1.32 + - 0.25 1.03 + - 0.07 0.1336 + - 0.0107 10 S341A 0.57 + - 0.17 1.21 + - 0.37 0.0297 + - 0.0064 4 T338A 3.20 + - 0.86 1.13 + - 0.20 0.1260 + - 0.0225 4 R347A 44.98 + - 4.71** 0.91 + - 0.04 0.1288 + - 0.0154 7 R334A 2.39 + - 0.74 0.93 + - 017 0.0313 + - 0.062 4 A349S 1.23 + - 0.41 1.11 + - 0.25 0.1500 + - 0.011 4 R347D >50 Not determined 0.1160 + - 0.0136 7 R347D/D924R >50 Not determined 0.1008 + - 0.0504 4 R347C >50 Not determined 0.1437 + - 0.0123 4 Mock 0.003 + - 0.001 10 introduced a mutation at position 349 (an alanine residue replaced by a serine residue). Login to comment
134 Because Arg347 is believed to be involved in the formation of a salt bridge with Asp924 [25], we also tested the CFTR mutants D924A and D924R. Login to comment
136 To further investigate the importance of the salt bridge, we generated a double mutant, R347D/D924R, in which the positions of the charged amino acids are inverted. Login to comment
137 Interestingly, in contrast with D924R, the double mutant was able to transport anions but showed a low sensitivity to CFTRinh-172, with an estimated Ki greater than 50 μM (Figures 2A and 2B), similar to that of the single R347D mutant. Login to comment
138 We evaluated the maturation of the D924R mutant by immunoprecipitation followed by Western blot analysis or in vitro phosphorylation (Figure 2C). Login to comment
141 In contrast with R347D, the D924R mutation produced a partial defect in maturation, with increased band B intensity compared with band C. Interestingly, this defect seemed to be corrected in the double mutant R347D/D924R (Figure 2C). Login to comment
145 In contrast with all other constructs, D924A and D924R did not show a significant I- transport compared with mock-transfected cells. Login to comment
146 (B) CFTRinh-172 dose-response relationships for wild-type, R347D and R347D/D924R CFTR. Login to comment
200 Indeed, D924R causes a reduced amount of fully glycosylated protein (band C) that may indicate that the mutant protein is less stable. Login to comment
202 Interestingly, when we generated the double mutant R347D/D924R, in which the positions of positive and negative charges are inverted but the salt bridge is maintained [25], we Figure 6 Patch-clamp analysis of CFTR inhibition by CFTRinh-172 (A and C) Superimposed membrane currents recorded from cells expressing wild-type and the R347A mutant at membrane potentials between -100 and +100 mV. Login to comment
208 On the other hand, we found that the double mutant R347D/D924R did not behave as the wild-type CFTR in terms of CFTRinh-172 sensitivity but was more similar to single Arg347 mutants. Login to comment

PMID: 18421494 [PubMed] Cui G et al: "Mutations at arginine 352 alter the pore architecture of CFTR."

No. Sentence Comment

24 The D924R mutation in TM8 complemented the R347D mutation, reverting the channel to WT behavior, allowingtheauthorstoconcludethatR347functionsatleastin part by forming a salt bridge with D924 (Cotten and Welsh 1999). Login to comment
265 Also, near the predicted cytoplasmic end of the CFTR pore, substitutions of the arginine at position 347 by any residue other than lysine destabilized the pore structure, while the double mutation R347D/ D924R recovered open state stability, suggesting that R347 formed a salt bridge with D924 in the wild-type channel (Cotten and Welsh 1999). Login to comment

PMID: 18597042 [PubMed] Mornon JP et al: "Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces."

No. Sentence Comment

187 Subsequent mutagenesis work involving acidic residues located in different TM helices has shown that the D924R mutation could complement the R347D mutation, suggesting that these two residues may form a salt bridge. Login to comment

PMID: 19019984 [PubMed] Pitonzo D et al: "Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon."

No. Sentence Comment

46 Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A). Login to comment
223 This was not simply due to the presence of a charged residue, because arginine substitution (D924R) reduced photocross-linking in tethered nascent chains and also eliminated Sec61␣ pho- tocross-linking after peptidyl-tRNA cleavage (Figure 9B). Login to comment

PMID: 20590134 [PubMed] Loo TW et al: "The V510D suppressor mutation stabilizes DeltaF508-CFTR at the cell surface."

No. Sentence Comment

160 It was found that mutation of Arg347 to neutral amino acids or Asp destabilized channel function but the D924R mutation complemented R347D to yield a channel that behaved like wild-type CFTR. Login to comment

PMID: 23709221 [PubMed] Cui G et al: "Two salt bridges differentially contribute to the maintenance of cystic fibrosis transmembrane conductance regulator (CFTR) channel function."

No. Sentence Comment

21 However, subconductance states are dominant events with short burst durations in CFTR channels bearing known salt bridge mutations, such as R352A, R347H, D993R, and D924R (13, 14). Login to comment
82 RESULTS Arg347 Forms a Salt Bridge with Asp924 but Does Not Stabilize the Full Open State-Although Cotten and Welsh first reported that arginine 347 of TM6 forms a salt bridge with aspartic acid 924 of TM8, their results suggested that the double mutation R347D/D924R rescued the channel to a stable open state that exhibits a smaller single channel amplitude, which is reminiscent of the s2 open state of WT-CFTR (14). Login to comment
89 A, representative current samples of WT-, R347A-, R347D-, D924R-, R347K-, and R347D/D924R-CFTR were recorded from excised inside-out patch from Xenopus oocytes with 150 mM Clafa; symmetrical solution in the presence of 1 mM Mg-ATP and 50 nM PKA at VM afd; afa;100 mV (n afd; 4-6 for each mutant). Login to comment
96 D924R-CFTR exhibits all three open states in contrast to R347A- and R347D-CFTR, although the stability of the open state is compromised; indeed, the fractional occupancies of both s1 and s2 states are greatly increased in this mutant (Fig. 2B). Login to comment
97 The charge-swapping double mutant R347D/D924R-CFTR exhibited a long stable s2 state with occasional brief openings to s1 and f. Login to comment
109 We therefore hypothesized that Arg347 might also interact with Asp993 to rescue the CFTR channel pore to a stable f state and tested this hypothesis in three double mutants; TABLE 1 Summary of the effects of mutations studied Mutant Main features of open bursts Impact on f state R347A Emphasizes s1 state, brief transitions to s2 and f Can reach f but not stable R347D Emphasizes s1 state, no transitions to s2 and f Cannot reach f D924R Brief transitions to all conductance levels Can reach f but not stable R347K Wild type-like Wild type-like R347D/D924R Emphasizes s2 state, rare and brief transitions to f Can reach f but not stable R352E Opens to all 3 levels; s1 much more stable than in WT, s2 unstable, f unstable Can reach f but not stable D993R Opens to all 3 levels, but none are stable Can reach f but not stable R352E/D993R Wild type-like, with increased transitions to s1 and s2; slightly reduced single-channel conductance Wild type-like R352E/D924R Opens to all 3 levels, but none are stable Can reach f but not stable R347D/D993R Very stable s2; rare and brief transitions to both s1 and f Can reach f but not stable R347A/R352A Opens to all 3 levels; s1 much more stable than in WT, s2 unstable, f unstable Can reach f but not stable R347D/D924R/D993R Opens to all 3 levels; s1 much more stable than in WT, s2 relatively stabilized, f unstable Can reach f but not stable R347D/D924R/R352E/D993R Primarily flickers between s2 and f; s1 much more stable than in WT, slightly reduced single channel conductance Can reach f but not stable FIGURE 3. Login to comment
111 A, representative current samples of R352E/D993R-, R352E/D924R-, and R347D/D993R-CFTR recorded from excised inside-out patches with the same conditions as Fig. 2 (n afd; 3-6 for each mutant). Login to comment
115 Whereas the single channel behavior of R352E/D924R was similar to that of R352E alone, with multiple unstable open states, suggesting that Arg352 and Asp924 do not interact, R347D/D993R was much more like R347D/D924R, with the s2 state dominant (compare Figs. 3 and 2). Login to comment
116 R347D/ D993R-CFTR is able to transition to the f state but sojourns there are even more brief than those seen for the R347D/ D924R. Login to comment
121 In the R347D/ D924R mutant, the positive charge at Arg347 is no longer available to interact with Asp993 . Login to comment
124 This was tested in the triple mutant R347D/D924R/D993R (Fig. 4, A and B). Login to comment
125 Unlike the two double mutants described above (R347D/D924R and R347D/ D993R), the triple mutant exhibited roughly equal occupancy of s1,s2,andfstates;theoccupancyofthes2statewasnotasstableas in either double mutant. Login to comment
141 However, the quadruple mutant R347D/D924R/D993R/R352E did not completely rescue WT behavior (Fig. 4, A and B). Login to comment
146 Representative current samples of R347A/R352A-, R347D/D924R/D993R-, and R347D/D924R/D993R/R352E-CFTR were recorded under the same conditions as in Fig. 3 (n afd; 5-6 for each mutant) (A). Login to comment