ABCC7 p.Pro574His
| ClinVar: |
c.1721C>A
,
p.Pro574His
D
, Pathogenic
c.1720C>T , p.Pro574Ser ? , not provided |
| CF databases: |
c.1720C>T
,
p.Pro574Ser
(CFTR1)
D
, The P574S mutation was simultaneously detected in two families with no apparent relation but living in the center part of France (Auvergne). The P574S mutation was detected in CFTR gene by DGGE and identified by sequencing. In one family this mutation was associated with N1303K, in the other family it was associated with the F508del.
c.1721C>A , p.Pro574His (CFTR1) ? , Although the amino acid pro at this position is not highly conserved across different ATP-binding folds, his seems to be a drastic substitution. This change is not detected in 52 other CF chromosomes nor 15 normal chromosomes, 4 of which have the same group IV haplotype. |
| Predicted by SNAP2: | A: D (91%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (53%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]
Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
307 [138] A455E, P574H cAMP-stimulated apical membrane Cl-currents but current magnitudes were reduced compared to wild-type Electrophysiology of epithelial cells [139] C491S, C1344S, C1355S C491S channels opened almost exclusively to a 3-pS subconductance.
X
ABCC7 p.Pro574His 16442101:307:13
status: NEW[hide] Novel pharmacologic therapies for cystic fibrosis. J Clin Invest. 1999 Feb;103(4):447-52. Zeitlin PL
Novel pharmacologic therapies for cystic fibrosis.
J Clin Invest. 1999 Feb;103(4):447-52., [PMID:10021451]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
31 As might be expected, mutations in this class, such as R117H or P574H, are thought to confer a milder phenotype. Class V mutations reduce the level of normal CFTR protein by alterations in the promoter or by altering splicing.
X
ABCC7 p.Pro574His 10021451:31:64
status: NEW131 R347P affects the rate of chloride flow, whereas R117H and P574H reduce the channel open time.
X
ABCC7 p.Pro574His 10021451:131:59
status: NEW133 Class IV mutations such as R117H, R334W, R347P, A455E, and P574H are associated with a pancreatic sufficient phenotype or late onset pancreatic insufficiency.
X
ABCC7 p.Pro574His 10021451:133:59
status: NEW[hide] Processing of CFTR bearing the P574H mutation diff... J Cell Sci. 1999 Jul;112 ( Pt 13):2091-8. Ostedgaard LS, Zeiher B, Welsh MJ
Processing of CFTR bearing the P574H mutation differs from wild-type and deltaF508-CFTR.
J Cell Sci. 1999 Jul;112 ( Pt 13):2091-8., [PMID:10362539]
Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) containing the deltaF508 mutation is retained in the endoplasmic reticulum (ER). This defect can be partially overcome by a reduction in temperature which allows some of the deltaF508 protein to exit the ER and move to the cell surface. Earlier studies showed that the CF-associated mutants, P574H and A455E, were also misprocessed. In this study, we found that processing of P574H and A455E was also temperature-sensitive; at 26 degrees C, some of the protein matured. In contrast to other CFTR mutants, P574H accumulated in punctate cytoplasmic bodies that colocalized with endoplasmic reticulum (ER) markers. At 26 degrees C, these bodies were no longer present. P574H showed a prolonged association with Hsp70 and also colocalized with Hsp70. We used brefeldin A (BFA) to determine which processing step(s) was altered by reduced temperature. Unlike wild-type CFTR, which was converted into an intermediate that was stable in the presence of BFA at 37 degrees C, deltaF508 and P574H produced the intermediate only when the temperature was reduced to 26 degrees C. Furthermore the wild-type intermediate was not associated with Hsp70. These data suggest that formation of the stable intermediate is a key temperature-sensitive step and appears to be coincident with release of the wild-type protein from Hsp70.
Comments [show]
None has been submitted yet.
No. Sentence Comment
18 Earlier studies showed that the CF-associated mutants, P574H and A455E, were also misprocessed.
X
ABCC7 p.Pro574His 10362539:18:55
status: NEW19 In this study, we found that processing of P574H and A455E was also temperature-sensitive; at 26°C, some of the protein matured.
X
ABCC7 p.Pro574His 10362539:19:43
status: NEW20 In contrast to other CFTR mutants, P574H accumulated in punctate cytoplasmic bodies that colocalized with endoplasmic reticulum (ER) markers.
X
ABCC7 p.Pro574His 10362539:20:35
status: NEW22 P574H showed a prolonged association with Hsp70 and also colocalized with Hsp70.
X
ABCC7 p.Pro574His 10362539:22:0
status: NEW24 Unlike wild-type CFTR, which was converted into an intermediate that was stable in the presence of BFA at 37°C, ∆F508 and P574H produced the intermediate only when the temperature was reduced to 26°C. Furthermore the wild-type intermediate was not associated with Hsp70.
X
ABCC7 p.Pro574His 10362539:24:134
status: NEW26 Key words: Cystic fibrosis, Hsp70, Protein biosynthesis SUMMARY Processing of CFTR bearing the P574H mutation differs from wild-type and ∆F508-CFTR Lynda S. Ostedgaard, Bernhardt Zeiher and Michael J. Welsh* Howard Hughes Medical Institute, Departments of Internal Medicine and Physiology and Biophysics, University of Iowa College of Medicine, Iowa City, Iowa 52242, USA *Author for correspondence Accepted 22 April; published on WWW 10 June 1999 in NBD1 and throughout the protein (Tsui, 1995).
X
ABCC7 p.Pro574His 10362539:26:95
status: NEW27 We earlier studied two other CF-associated mutations located in NBD1, A455E and P574H (Sheppard et al., 1995).
X
ABCC7 p.Pro574His 10362539:27:80
status: NEW29 However, A455E and P574H generate reduced net epithelial current because the proteins are misprocessed and few functional channels reach the plasma membrane (Sheppard et al., 1995; Champigny et al., 1995).
X
ABCC7 p.Pro574His 10362539:29:19
status: NEW30 Nevertheless, the processing defect of A455E and P574H is less pronounced than that of ∆F508 and the resulting clinical phenotype is less severe (Kristidis et al., 1992; Kerem et al., 1990a; Veeze et al., 1994; Gan et al., 1995).
X
ABCC7 p.Pro574His 10362539:30:49
status: NEW32 In this study, we compared the processing of P574H and A455E mutants to that of ∆F508.
X
ABCC7 p.Pro574His 10362539:32:45
status: NEW33 By studying mutants with different degrees of misprocessing, we hope to gain further insight into the biosynthesis of both normal and mutant CFTR which may help design interventions to improve the processing of ∆F508, P574H, and possibly other CF-associated mutants.
X
ABCC7 p.Pro574His 10362539:33:225
status: NEW37 Using the pcDNA3-6His-CFTR as a backbone, we made the constructs A455E, P574H and ∆F508 (Kunkel, 1985) and confirmed the mutations by DNA sequencing in both directions.
X
ABCC7 p.Pro574His 10362539:37:72
status: NEW65 RESULTS Because earlier studies suggested that lowering the temperature allowed ∆F508 to fold correctly and exit the ER (Denning et al., 1992a; Lukacs et al., 1993; Sato et al., 1996), we first examined the temperature-sensitivity of A455E and P574H processing.
X
ABCC7 p.Pro574His 10362539:65:251
status: NEW70 For the NBD1 mutants, ∆F508 (B), A455E (C) and P574H (D), band B was the primary form detected at 37°C.
X
ABCC7 p.Pro574His 10362539:70:54
status: NEW74 For ∆F508 (B) and A455E (C), the relative amount of band C was minimal at each time at 37°C. Although the relative amount of band C in P574H (D) was also low, it increased slowly with time at 37°C.
X
ABCC7 p.Pro574His 10362539:74:147
status: NEW75 When the temperature was reduced to 26°C, the relative amount of band C for ∆F508 and A455E increased modestly, while the amount of P574H band C relative to total P574H increased.
X
ABCC7 p.Pro574His 10362539:75:144
status: NEWX
ABCC7 p.Pro574His 10362539:75:175
status: NEW76 Although lowering the temperature caused an increase in the relative amount of P574H band C, the total amount of P574H band C was not as high as that in wild-type CFTR.
X
ABCC7 p.Pro574His 10362539:76:79
status: NEWX
ABCC7 p.Pro574His 10362539:76:113
status: NEW77 These results indicate that, like ∆F508, both A455E and P574H are temperature-sensitive processing mutants.
X
ABCC7 p.Pro574His 10362539:77:63
status: NEW78 Moreover, P574H makes relatively more band C at both 37°C and 26°C than either ∆F508 or A455E.
X
ABCC7 p.Pro574His 10362539:78:10
status: NEW82 P574H and A455E are temperature-sensitive mutants.
X
ABCC7 p.Pro574His 10362539:82:0
status: NEW83 COS-7 cells were electroporated with pcDNA3 vectors encoding wild-type CFTR (A), ∆F508 (B), A455E (C), and P574H (D).
X
ABCC7 p.Pro574His 10362539:83:114
status: NEW92 0.0 0.2 0.4 0.6 0.8 1.0 1.2 0 5 10 15 20 25 30 Chase (hrs) P574H - BFA P574H + BFA ∆F508 - BFA ∆F508 + BFA Wild-type - BFA Wild-type + BFA 0.0 0.2 0.4 0.6 0.8 1.0 1.2 0 5 10 15 20 25 30 Chase (hrs) P574H - BFA P574H + BFA ∆F508 - BFA ∆F508 + BFA A: 37 ˚C B: 26 ˚C RelatoveamountofBandBRelatoveamountofBandB Fig. 2.
X
ABCC7 p.Pro574His 10362539:92:59
status: NEWX
ABCC7 p.Pro574His 10362539:92:71
status: NEWX
ABCC7 p.Pro574His 10362539:92:212
status: NEWX
ABCC7 p.Pro574His 10362539:92:224
status: NEW93 Effect of brefeldin A on the relative amount of band B protein at 37°C or 26°C. HeLa cells infected with recombinant vaccinia virus encoding P574H-CFTR, ∆F508-CFTR, and wild-type CFTR were pulsed (P574H-CFTR and ∆F508-CFTR for 30 minutes; wild-type-CFTR for 15 minutes) with [35S]methionine at 5 hours post-infection and chased for the indicated times with 10 mM cold methionine in the presence or absence of (5 µg/ml) brefeldin A (BFA).
X
ABCC7 p.Pro574His 10362539:93:151
status: NEWX
ABCC7 p.Pro574His 10362539:93:214
status: NEW95 Chase was continued for 30 hours for P574H and ∆F508 to detect the stable B form.
X
ABCC7 p.Pro574His 10362539:95:37
status: NEW99 Repeated measures analysis with multiple means comparison using Supernova software (Abacus Concepts, Berkeley, CA) indicates that P574H + BFA is different from ∆F508 + BFA from 7.5 hours through 30 hours (P=0.013).
X
ABCC7 p.Pro574His 10362539:99:130
status: NEW100 Wild-type immunoprecipitated with anti-CFTR antibodies (-BFA, ᭺; +BFA, ᭹); ∆F508 (-BFA, ᭝; +BFA, ᭡); P574H (-BFA, ᭛; + BFA, ᭜).
X
ABCC7 p.Pro574His 10362539:100:136
status: NEW107 Unlike wild-type CFTR, neither ∆F508 nor P574H formed detectable intermediate B after BFA treatment at 37°C (Fig. 2A).
X
ABCC7 p.Pro574His 10362539:107:48
status: NEW108 However, when the temperature was lowered to 26°C, the intermediate B form of P574H was detectable after 7.5 hours of BFA treatment (Fig. 2B), a time that correlates with the production of P574H band C in the absence of BFA (Fig. 1D).
X
ABCC7 p.Pro574His 10362539:108:83
status: NEWX
ABCC7 p.Pro574His 10362539:108:194
status: NEW109 Likewise, a small amount of intermediate B accumulated after incubation of ∆F508-expresssing cells at 26°C, but this accumulation of ∆F508 was slower than the accumulation of P574H intermediate B at 26°C (Fig. 2).
X
ABCC7 p.Pro574His 10362539:109:194
status: NEW110 These data suggest that the temperature-sensitive maturation defect of ∆F508 and P574H occurs at or prior to generation of intermediate band B protein and that P574H responds more readily to lowered temperature than ∆F508.
X
ABCC7 p.Pro574His 10362539:110:88
status: NEWX
ABCC7 p.Pro574His 10362539:110:167
status: NEW111 We used immunocytochemistry to determine if the cellular distribution of ∆F508, A455E and P574H was consistent with the quantitative biochemical differences we had observed.
X
ABCC7 p.Pro574His 10362539:111:97
status: NEW117 The NBD1 mutants are temperature-sensitive and P574H displays a unique cytoplasmic pattern of immunofluorescence at 37°C.
X
ABCC7 p.Pro574His 10362539:117:47
status: NEW118 Immunofluorescence in COS-7 cells electroporated with wild-type-CFTR (A,B); ∆F508 (C,D); A455E (E,F); and P574H (G,H).
X
ABCC7 p.Pro574His 10362539:118:113
status: NEW120 The same punctate cytoplasmic bodies are present when P574H is expressed in HeLa cells at 37°C (not shown).
X
ABCC7 p.Pro574His 10362539:120:54
status: NEW121 pattern, P574H presented an unusual immunofluorescence pattern of prominent punctate bodies distributed within the cytoplasm when cells were grown at 37°C (G).
X
ABCC7 p.Pro574His 10362539:121:9
status: NEW124 We asked whether the cytoplasmic bodies produced by P574H colocalized with a known intracellular organelle.
X
ABCC7 p.Pro574His 10362539:124:52
status: NEW128 Moreover, in cells stained with both anti-CFTR and anti-Golgi antibodies, the bodies which contain P574H (Fig. 4C) did not colocalize with the Golgi markers, p58 (Bloom and Brashear, 1989) (Fig. 4D) or β-COP (Duden et al., 1991) (not shown).
X
ABCC7 p.Pro574His 10362539:128:99
status: NEW129 These data suggested the P574H cytoplasmic bodies were not part of the Golgi complex.
X
ABCC7 p.Pro574His 10362539:129:25
status: NEW130 We used cAMP agonists, which have been shown by others to influence membrane insertion and retrieval of endosomal CFTR (Bradbury et al., 1992; Lehrich et al., 1998), to determine if the P574H bodies were part of endocytic or exocytic vesicles.
X
ABCC7 p.Pro574His 10362539:130:186
status: NEW132 Although CFTR has also been reported to be contained in clathrin-coated vesicles (Bradbury et al., 1994), the punctate P574H bodies did not colocalize with the more disperse network of clathrin, a component of the trans-Golgi network and the membrane coat of endocytic vesicles and lysosomes (Brodsky, 1988) (not shown).
X
ABCC7 p.Pro574His 10362539:132:119
status: NEW133 To determine if P574H was present in the ER, we examined the staining pattern of the ER-resident protein, protein disulfide isomerase (PDI) (Kaetzel et al., 1987).
X
ABCC7 p.Pro574His 10362539:133:16
status: NEW135 Thus P574H, like ∆F508, is retained within the reticular network of the ER.
X
ABCC7 p.Pro574His 10362539:135:5
status: NEW136 In addition, the punctate P574H cytoplasmic bodies stained with both anti-CFTR and anti-PDI antibodies.
X
ABCC7 p.Pro574His 10362539:136:26
status: NEW137 These results suggest not only that P574H is localized in the ER, but that the punctate cytoplasmic bodies may represent a subdomain of the ER which is only detectable in cells expressing P574H.
X
ABCC7 p.Pro574His 10362539:137:36
status: NEWX
ABCC7 p.Pro574His 10362539:137:188
status: NEW138 Because previous work showed that ∆F508 was associated with the cytoplasmic chaperone Hsp70 (Yang et al., 1993), we examined the possibility that the P574H in the punctate bodies might associate with Hsp70.
X
ABCC7 p.Pro574His 10362539:138:157
status: NEW139 When the same cells are stained with both anti-CFTR and anti-Hsp70 antibodies, P574H (Fig. 5C) and Hsp70 (Fig. 5D) show a striking colocalization in both the reticular ER pattern and in the cytoplasmic bodies.
X
ABCC7 p.Pro574His 10362539:139:79
status: NEW140 Colocalization of P574H and Hsp70 suggested a physical association of P574H with Hsp70.
X
ABCC7 p.Pro574His 10362539:140:18
status: NEWX
ABCC7 p.Pro574His 10362539:140:70
status: NEW141 To test this, we used anti-Hsp70 antibodies to coimmunoprecipitate P574H that was bound to Hsp70 and evaluated the time course of the retention in a pulse-chase experiment.
X
ABCC7 p.Pro574His 10362539:141:67
status: NEW142 Fig. 6 shows that band B, but not band C, of wild-type CFTR, ∆F508 and P574H were all initially associated with Hsp70.
X
ABCC7 p.Pro574His 10362539:142:78
status: NEW144 However, band B of both ∆F508 and P574H retain their association with Hsp70 for Fig. 4.
X
ABCC7 p.Pro574His 10362539:144:41
status: NEW145 P574H cytoplasmic bodies are not part of the Golgi complex.
X
ABCC7 p.Pro574His 10362539:145:0
status: NEW146 COS-7 cells expressing P574H and grown at 37°C were either treated with brefeldin A (BFA) (5 µg/ml) (B) or the vehicle control (A) for 30 minutes before staining with anti-CFTR antibody.
X
ABCC7 p.Pro574His 10362539:146:23
status: NEW147 Cells expressing P574H grown at 37°C were stained with anti-CFTR antibody (C) and anti-Golgi (p58) antibody (D).
X
ABCC7 p.Pro574His 10362539:147:17
status: NEW149 P574H cytoplasmic bodies colocalize with ER markers and with Hsp70.
X
ABCC7 p.Pro574His 10362539:149:0
status: NEW150 Cells expressing P574H grown at 37°C were stained with anti-CFTR antibody (A) and with protein-disulphide isomerase antibody (PDI) (B).
X
ABCC7 p.Pro574His 10362539:150:17
status: NEW151 Cells expressing P574H grown at 37°C were stained with anti-CFTR antibody (C) and with anti-Hsp70 antibody (D).
X
ABCC7 p.Pro574His 10362539:151:17
status: NEW153 In addition, pulse-chase studies show that relatively more of P574H is associated with Hsp70 than is wild-type CFTR (Fig. 6B).
X
ABCC7 p.Pro574His 10362539:153:62
status: NEW154 This continued physical association of P574H and Hsp70 is consistent with the immunocytochemical colocalization of P574H and Hsp70.
X
ABCC7 p.Pro574His 10362539:154:39
status: NEWX
ABCC7 p.Pro574His 10362539:154:115
status: NEW158 The continued retention of P574H with Hsp70 suggests that the conformational maturation of P574H may be delayed or actually inhibited, consistent with the diminished ability of P574H to adopt the intermediate B conformation at 37°C.
X
ABCC7 p.Pro574His 10362539:158:27
status: NEWX
ABCC7 p.Pro574His 10362539:158:91
status: NEWX
ABCC7 p.Pro574His 10362539:158:177
status: NEW165 DISCUSSION Earlier work showed that CFTR containing the CF-associated mutations ∆F508, A455E, or P574H decreases cell membrane Cl- current primarily because the mutant proteins fail to fold correctly and therefore do not traffic out of the ER (Cheng et al., 1990; Lukacs et al., 1994; Ward and Kopito, 1994; Sheppard et al., 1995; Qu and Thomas, 1996; Qu et al., 1997; Yang et al., 1993; Zhang et al., 1998).
X
ABCC7 p.Pro574His 10362539:165:104
status: NEW167 The association of P574H and ∆F508 with Hsp70 is prolonged.
X
ABCC7 p.Pro574His 10362539:167:19
status: NEW168 HeLa cells infected with recombinant vaccinia virus encoding wild-type-CFTR, ∆F508 and P574H were pulsed for 15 minutes with [35S]methionine at 5 hours post-infection and chased for the indicated times with 10 mM cold methionine at 37°C.
X
ABCC7 p.Pro574His 10362539:168:94
status: NEW174 Wild-type-CFTR (᭺); P574H (᭛); ∆F508 (᭡).
X
ABCC7 p.Pro574His 10362539:174:27
status: NEW185 We found that, like ∆F508, the processing of P574H and A455E is temperature-sensitive.
X
ABCC7 p.Pro574His 10362539:185:52
status: NEW186 Moreover, unlike ∆F508 and A455E, P574H formed some mature protein at 37°C, and at 26°C, P574H generated relatively more mature protein than ∆F508.
X
ABCC7 p.Pro574His 10362539:186:41
status: NEWX
ABCC7 p.Pro574His 10362539:186:106
status: NEW187 Thus the processing defect is less severe for P574H, consistent with functional studies (Sheppard et al., 1995).
X
ABCC7 p.Pro574His 10362539:187:46
status: NEW188 These studies demonstrate that misprocessing is not an all-or-none phenomenon, but rather a continuum, with wild-type P574H >A455E>>∆F508.
X
ABCC7 p.Pro574His 10362539:188:118
status: NEW189 This is consistent with the clinical phenotype in CF patients: P574H and A455E are associated with a milder, pancreatic-sufficient phenotype and ∆F508 is associated with a severe, pancreatic-insufficient clinical phenotype (Kerem et al., 1990a,b; Kristidis et al., 1992; Veeze et al., 1994; Gan et al., 1995).
X
ABCC7 p.Pro574His 10362539:189:63
status: NEW192 This was especially clear for the P574H mutant: the appearance of the intermediate B form in cells treated with BFA occurred at the same time as the maturation of band B to band C in the cells not treated with BFA, suggesting, as has been shown for wild-type, that intermediate B goes on to become the mature band C form of the protein.
X
ABCC7 p.Pro574His 10362539:192:34
status: NEW193 At 37°C, P574H resides in the ER; P574H showed both the characteristic reticular pattern of immunocytochemical staining typical of ER as well as a unique punctate pattern of cytoplasmic bodies which colocalized with an ER marker.
X
ABCC7 p.Pro574His 10362539:193:14
status: NEWX
ABCC7 p.Pro574His 10362539:193:39
status: NEW194 More interestingly, P574H also colocalized with the chaperone Hsp70 in both the reticular ER and in the punctate bodies and was associated with Hsp70 by coimmunoprecipitation.
X
ABCC7 p.Pro574His 10362539:194:20
status: NEW195 When the temperature was reduced to 26°C, the cytoplasmic bodies containing P574H and Hsp70 were no longer observed, suggested they had dissipated and P574H proceeded to make both the intermediate B and the band C forms of protein.
X
ABCC7 p.Pro574His 10362539:195:81
status: NEWX
ABCC7 p.Pro574His 10362539:195:156
status: NEW196 The punctate bodies appeared only in cells expressing P574H.
X
ABCC7 p.Pro574His 10362539:196:54
status: NEW198 This morphological pattern is not simply due to the level of protein expression, because the absolute amount of recombinant protein expressed is low and protein expression was no greater for P574H than for any other forms of CFTR.
X
ABCC7 p.Pro574His 10362539:198:191
status: NEW200 Interestingly, the appearance of subcellular structures reminiscent of the P574H bodies have been reported following expression of other endogenous and recombinant membrane proteins.
X
ABCC7 p.Pro574His 10362539:200:75
status: NEW205 We do not know the functional significance of the P574H accumulated within the punctate bodies; it may represent a pool of protein which can convert to the intermediate B form when the temperature is lowered.
X
ABCC7 p.Pro574His 10362539:205:50
status: NEW206 The late onset of modest amounts of mature P574H band C at 37°C may represent a slow conversion or 'leak` from this protected pool to intermediate B.
X
ABCC7 p.Pro574His 10362539:206:43
status: NEW209 Alternatively, we cannot exclude the possibility that the punctate bodies in cells expressing P574H could represent an ER subcompartment en-route to degradation.
X
ABCC7 p.Pro574His 10362539:209:94
status: NEW211 The inability of P574H to form intermediate B and the prolonged retention of P574H by Hsp70 are consistent with this observation.
X
ABCC7 p.Pro574His 10362539:211:17
status: NEWX
ABCC7 p.Pro574His 10362539:211:77
status: NEW[hide] Pharmacologic restoration of delta F508 CFTR-media... Kidney Int. 2000 Mar;57(3):832-7. Zeitlin PL
Pharmacologic restoration of delta F508 CFTR-mediated chloride current.
Kidney Int. 2000 Mar;57(3):832-7., [PMID:10720936]
Abstract [show]
Cystic fibrosis (CF) is an autosomal inherited disorder caused by over 800 different mutations in the CFTR gene. The most common mutation, delta F508, causes a trafficking arrest in the endoplasmic reticulum and the CFTR protein is degraded. Restoration of CFTR trafficking in vitro restores cAMP-mediated chloride transport at the cell surface. The hypothesis of this discussion is that the short chain fatty acids, butyrate and 4-phenylbutyrate, up-regulate mature CFTR at the plasma membrane. Evidence that these compounds regulate CFTR production and maturation in part through effects on molecular chaperones in CF cells in culture is discussed. The oral drug, 4-phenylbutyrate, was tested in a Phase I clinical trial in CF subjects and further trials are underway. Other new therapeutic approaches directed at different classes of mutations in CFTR are also discussed. Chemical and pharmacologic agents that regulate endogenous gene expression at different steps in the biosynthetic processing pathway of a membrane glycoprotein will be needed to comprehensively treat a complex inherited disorder like cystic fibrosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
106 R347P affects the rate of chloride flow, Chemical and pharmacologic mediators of protein whereas R117H and P574H reduce the channel open trafficking are needed in CF and other diseases caused time.
X
ABCC7 p.Pro574His 10720936:106:107
status: NEW[hide] Cystic fibrosis mutations lead to carboxyl-termina... J Biol Chem. 2000 Jun 30;275(26):19577-84. Van Oene M, Lukacs GL, Rommens JM
Cystic fibrosis mutations lead to carboxyl-terminal fragments that highlight an early biogenesis step of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 2000 Jun 30;275(26):19577-84., 2000-06-30 [PMID:10764788]
Abstract [show]
Inefficient delivery of the cystic fibrosis transmembrane conductance regulator (CFTR) to the surface of cells contributes to disease in the majority of cystic fibrosis patients. Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa. These fragments appear early in biogenesis and degrade rapidly in four distinct cell types tested including the bronchial epithelial IB3-1 cell line. They were detected at highest levels with CFTRA455E where the 105-kDa fragment accounted for 40% of newly synthesized polypeptide but for only 20 and 7% of nascent wild type and mutant DeltaF508 proteins, respectively. The bands represent core- and unglycosylated forms of the same CFTR fragment supporting that precursor forms are correctly inserted into the membrane of the endoplasmic reticulum. Proteolytic cleavage would be predicted to occur on the cytosolic face of the endoplasmic reticulum within the NBD1-R domain segment, but pharmacological testing did not support involvement of the 26 S proteasome. The examined missense mutations in NBD1 manifest differently than the major mutant, DeltaF508, and highlight a critical conformational aspect of biogenesis of CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa.
X
ABCC7 p.Pro574His 10764788:1:140
status: NEW41 EXPERIMENTAL PROCEDURES Construction of CFTR Expression Plasmids-The CFTR mutants A455E, S549R, P574H, and Y563N were generated from pBQ6.2 (34) as described previously (35).
X
ABCC7 p.Pro574His 10764788:41:96
status: NEW84 Analysis of the S549R mutant showed measurable but intermediate levels of band C, whereas A455E, Y563N, and P574H mutants showed markedly reduced levels using both tagged and untagged CFTR.
X
ABCC7 p.Pro574His 10764788:84:109
status: NEW238 The A455E, Y563N, and P574H mutations do appear to be able to achieve at least nominal levels of chloride conduction at the cell surface based both on the presenting phenotype in CF patients (54) and on single channel and whole cell current measurements (55) in heterologous expression systems.
X
ABCC7 p.Pro574His 10764788:238:22
status: NEW239 In contrast to the Y563N and P574H mutations, where low levels of mature band C forms were detectable with long exposure and/or long label incorporation times in HEK293 cells (data not shown), fully glycosylated protein could not be detected for A455E using our assay systems.
X
ABCC7 p.Pro574His 10764788:239:29
status: NEW[hide] Future pharmacological treatment of cystic fibrosi... Respiration. 2000;67(4):351-7. Zeitlin PL
Future pharmacological treatment of cystic fibrosis.
Respiration. 2000;67(4):351-7., [PMID:10940786]
Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disorder that is caused by over 850 different mutations in the CF gene. It is useful to group these mutations according to the defect that results in the CFTR mRNA or protein. New pharmacological treatments targeted towards specific mutations that are relatively common are being developed. Class I mutations do not produce CFTR protein because of a premature stop signal in the CFTR DNA. These null mutations can be corrected by certain aminoglycosides which cause the aberrant stop signal to be skipped. Mutations leading to a CFTR protein that attains an unstable structure shortly after translation in the endoplasmic reticulum form class II. Class II mutations can be restored to the protein trafficking pathway by manipulation of chaperone protein/CFTR interactions with chemical chaperones or drugs that affect gene regulation such as the butyrates. Production of a CFTR with reduced Cl(-) transport on the basis of abnormal regulation of the chloride channel is the basis of class III. Genistein can overcome this block in regulation. Mutations that partially reduce chloride conductance through CFTR (class IV) can be stimulated with milrinone, which is a phosphodiesterase inhibitor. Finally, mutations that lead to a severe reduction in normal CFTR protein form class V. Increased levels of CFTR could be generated with the butyrates or supplemented with gene therapy. Although most of the reported mutations in CFTR are rare and unclassified, it may be possible to use genotype-phenotype correlations to determine the best approach.
Comments [show]
None has been submitted yet.
No. Sentence Comment
22 Examples of CFTR mutations organized by classification of the defect in CFTR biosynthesis Type Genotype Phenotype Defect Cell diagram Drugs that may improve phenotype G542X 621+1 G → T 3905insT W1282X R553X 1717-1 G → A PI no CFTR protein no cell surface chloride transport gentamicin G418 Class II [64] 'F508 N1303K (P574H)a (A455E)a PI defective CFTR processing defective CFTR trafficking no cell surface chloride transport chemical chaperones CPX phenylbutyrate deoxyspergualin Class III [64] G551D G551S PI defective chloride channel regulation reduced or absent cell surface chloride transport genistein pyrophosphate Class IV [64, 66] R117H R334W G314E R347P ('F508)a P574H PS reduced chloride conductance reduced levels of cell surface chloride transport genistein milrinone phenylbutyrate Class V [64] 3849+10 kb C → T 2789+5 G → A 3272-26 A → G A455E 3120+1 G → A 1811+1.6 kb A → G 5Tb PS normal CFTR channels reduced numbers of normal CFTR reduced cell surface chloride transport genistein milrinone phenylbutyrate a Some mutants have features of more than one class of defect.
X
ABCC7 p.Pro574His 10940786:22:332
status: NEWX
ABCC7 p.Pro574His 10940786:22:688
status: NEW75 Another misprocessed mutant, P574H, has been shown to associate with Hsp70 in a prolonged state unless the temperature of the culture was reduced to 26°C [48].
X
ABCC7 p.Pro574His 10940786:75:29
status: NEW[hide] Type I, II, III, IV, and V cystic fibrosis transme... Curr Opin Pulm Med. 2000 Nov;6(6):521-9. Choo-Kang LR, Zeitlin PL
Type I, II, III, IV, and V cystic fibrosis transmembrane conductance regulator defects and opportunities for therapy.
Curr Opin Pulm Med. 2000 Nov;6(6):521-9., [PMID:11100963]
Abstract [show]
Recent advances in cellular and molecular biology have furthered the understanding of several genetic diseases, including cystic fibrosis. Mutations that cause cystic fibrosis are now understood in terms of the specific molecular consequences to the cystic fibrosis transmembrane conductance regulator (CFTR) protein expression and function. This knowledge has spawned interest in the development of therapies aimed directly at correcting the defective CFTR itself. In this article, we review the molecular defect underlying each recognized class of CFTR mutation and the potential therapies currently under investigation. Opportunities for protein-repair therapy appear to be vast and range from naturally occurring compounds, such as isoflavonoids, to pharmaceuticals already in clinical use, including aminoglycoside antibiotics, butyrate analogues, phosphodiesterase inhibitors, and adenosine nucleotides. Future therapies may resemble designer compounds like benzo[c]quinoliziniums or take the form of small peptide replacements. Given the heterogeneity and progressive nature of cystic fibrosis, however, optimal benefit from protein-repair therapy will most likely require the initiation of combined therapies early in the course of disease to avoid irreparable organ damage.
Comments [show]
None has been submitted yet.
No. Sentence Comment
108 R347P affects the rate of chloride flow, whereas R117H and P574H reduce the channel open time.
X
ABCC7 p.Pro574His 11100963:108:59
status: NEW124 Missense mutations that belong to this class include P574H and A455E.
X
ABCC7 p.Pro574His 11100963:124:53
status: NEW[hide] Pharmacological treatment of the ion transport def... Expert Opin Investig Drugs. 2001 Jan;10(1):1-19. Roomans GM
Pharmacological treatment of the ion transport defect in cystic fibrosis.
Expert Opin Investig Drugs. 2001 Jan;10(1):1-19., [PMID:11116277]
Abstract [show]
Cystic fibrosis (CF) is a lethal monogenetic disease characterised by impaired water and ion transport over epithelia. The lung pathology is fatal and causes death in 95% of CF patients. The genetic basis of the disease is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR), a cAMP-regulated chloride channel. The most common mutation, DeltaF508, results in a protein that cannot properly be folded in the endoplasmic reticulum, is destroyed and hence does not reach the apical cell membrane. This paper will discuss those pharmacological approaches that are directed at correcting the defect in ion transport. At present, no clinically effective drug is available, although research has defined areas in which progress might be made. These are the following: (1) the drug 4-phenylbutyrate (4PBA) increases the expression of DeltaF508-CFTR in the cell membrane, probably by breaking the association between DeltaF508-CFTR and a chaperone; (2) a number of xanthines, in particular 8-cyclopentyl-1, 3-dipropylxanthine (CPX), are effective in activating CFTR, presumably by direct binding and also possibly by correcting the trafficking defect; (3) the isoflavone genistein can activate both wild-type and mutant CFTR, probably through direct binding to the channel; (4) purinergic agonists (ATP and UTP) can stimulate chloride secretion via a Ca(2+)-dependent chloride channel and in this way compensate for the defect in CFTR, but stable analogues will be required before this type of treatment has clinical significance; (5) treatment with inhaled amiloride may correct the excessive absorption of Na(+) ions and water by airway epithelial cells that appears connected to the defect in CFTR; although clinical tests have not been very successful so far, amiloride analogues with a longer half-life may give better results. The role of CFTR in bicarbonate secretion has not yet been established with certainty, but correction of the defect in bicarbonate secretion may be important in clinical treatment of the disease. Currently, major efforts are directed at developing a pharmacological treatment of the ion transport defect in CF, but much basic research remains to be done, in particular, with regard to the mechanism by which defective CFTR is removed in the endoplasmic reticulum by the ubiquitin-proteasome pathway, which is a central pathway in protein production and of significance for several other diseases apart from CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
199 A substituted benzimidazolone, NS-004, was shown to activate wild-type CFTR and ∆F508-CFTR chloride channels in Xenopus oocytes and Vero cells expressing these channels [105] and also restored near-normal CFTR activity in cells expressing the P574H-CFTR channel (a mild mutation of CF) [106].
X
ABCC7 p.Pro574His 11116277:199:250
status: NEW[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]
Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
85 These mutations, 574delA, C524X, Y563D, P574H, 2043delG, 3662delA, 3821delT, Q1238X, and 3849 ϩ 4AϾG, as well as the previous seven mutations, make no detectable contribution to mutation detection in the general U.S. CF population.
X
ABCC7 p.Pro574His 11388756:85:40
status: NEW[hide] Induction of HSP70 promotes DeltaF508 CFTR traffic... Am J Physiol Lung Cell Mol Physiol. 2001 Jul;281(1):L58-68. Choo-Kang LR, Zeitlin PL
Induction of HSP70 promotes DeltaF508 CFTR trafficking.
Am J Physiol Lung Cell Mol Physiol. 2001 Jul;281(1):L58-68., [PMID:11404246]
Abstract [show]
The DeltaF508 cystic fibrosis transmembrane conductance regulator (CFTR) is a temperature-sensitive trafficking mutant that is detected as an immature 160-kDa form (band B) in gel electrophoresis. The goal of this study was to test the hypothesis that HSP70, a member of the 70-kDa heat shock protein family, promotes DeltaF508 CFTR processing to the mature 180-kDa form (band C). Both pharmacological and genetic techniques were used to induce HSP70. IB3-1 cells were treated with sodium 4-phenylbutyrate (4PBA) to promote maturation of DeltaF508 CFTR to band C. A dose-dependent increase in band C and total cellular HSP70 was observed. Under these conditions, HSP70-CFTR complexes were increased and 70-kDa heat shock cognate protein-CFTR complexes were decreased. Increased DeltaF508 CFTR maturation was also seen after transfection with an HSP70 expression plasmid and exposure to glutamine, an inducer of HSP70. With immunofluorescence techniques, the increased appearance of CFTR band C correlated with CFTR distribution beyond the perinuclear regions. These data suggest that induction of HSP70 promotes DeltaF508 CFTR maturation and trafficking.
Comments [show]
None has been submitted yet.
No. Sentence Comment
281 Whether this approach would also overcome the defects caused by other trafficking mutants such as N1303K, P574H, or G480C remains to be tested.
X
ABCC7 p.Pro574His 11404246:281:106
status: NEW[hide] Analysis of exocrine pancreatic function in cystic... Eur J Clin Invest. 2001 Sep;31(9):796-801. Walkowiak J, Herzig KH, Witt M, Pogorzelski A, Piotrowski R, Barra E, Sobczynska-Tomaszewska A, Trawinska-Bartnicka M, Strzykala K, Cichy W, Sands D, Rutkiewicz E, Krawczynski M
Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency.
Eur J Clin Invest. 2001 Sep;31(9):796-801., [PMID:11589722]
Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common cause of exocrine pancreatic insufficiency in childhood. The aim of the present study is to evaluate the correlation between genotype and exocrine pancreatic insufficiency in CF patients. The special emphasis was put on the analysis of mild CFTR mutations. DESIGN: The study comprised 394 CF patients and 105 healthy subjects (HS). Elastase-1 concentrations were measured in all subjects. RESULTS: Severe pancreatic insufficiency was associated with the presence of two CFTR gene mutations (DeltaF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717-1G-A, R533X, W1282X, 621GT, 2183AAG, R560T, 2184insA and DeltaI507, G551D, 895T) and mild insufficiency with the presence of at least one mutation (R117H, 3171insC, A155P2, 138insL, 296 + 1G-A, E92GK, E217G, 2789 + 5G-A. 3849 + 1kbC-T/3849 + 1kbC-T) genotype resulted in high elastase-1-values. However, in case of patients with genotype DeltaF508/3849 + 10kbC-T, 1717-1GA/3849 + 10kbC-T as well as with DeltaF508/R334W, both high and low elastase-1 concentrations were found. Low E1 values were found in a patient with DeltaF508/R347P genotype. CONCLUSION: Patients who carry two 'severe' mutations develop pancreatic insufficiency, whereas those who carry at least one 'mild' usually remain pancreatic sufficient. However, the presence of one mild mutation does not exclude pancreatic insufficiency.
Comments [show]
None has been submitted yet.
No. Sentence Comment
86 Kristidis et al. [10] reported that pancreatic insufficiency strongly correlates also with two alleles of DI507, Q493X, G542X, R553X, W1282X, 621 1 1G-T, 1717±1G-A, 556delA, 3659delC, I148T, G480C, V520F and R560T while one or two mutations such as R117H, R334W, A455E, and P574H were correlated with a pancreatic sufficient phenotype.
X
ABCC7 p.Pro574His 11589722:86:279
status: NEW[hide] Towards the pharmacogenomics of cystic fibrosis. Pharmacogenomics. 2002 Jan;3(1):75-87. Sangiuolo F, D'Apice MR, Bruscia E, Lucidi V, Novelli G
Towards the pharmacogenomics of cystic fibrosis.
Pharmacogenomics. 2002 Jan;3(1):75-87., [PMID:11966405]
Abstract [show]
Cystic fibrosis (CF) is the most common lethal recessive genetic disease affecting children in Europe and the US. CF is a multiorgan disease and may present a variety of clinical symptoms, like chronic obstructive lung disease, exocrine pancreatic insufficiency (PI) and elevated sweat chloride concentration. CF mutations have also been found in other related clinical diseases such as congenital bilateral absence of the vas deferens (CBAVD), disseminated bronchiectasis and chronic pancreatitis. These clinical overlaps pose etiopathogenetic, diagnostic and therapeutic questions. Despite stunning advances in genomic technologies and drug discovery, drug therapy often improves disease symptoms but does not cure the disease. One of the main causes of this failure in CF cure may be attributable to genetic variability and to the scarce knowledge of CF biochemistry. Therefore, knowing the genotype of a patient might help improve drug efficacy, reduce toxicity and suggests innovative genomic-based therapy approaches.
Comments [show]
None has been submitted yet.
No. Sentence Comment
111 Gentamicin Neomicin (G418) Class II Mutations that fail to be properly processed to a matureglycosylatedform and transported to the apical membrane ∆F508 N1303K P574H A455E PI Defective CFTR processing and trafficking.
X
ABCC7 p.Pro574His 11966405:111:168
status: NEW114 R117H R334W G314E R347P ∆F508 P574H PS Reduced chloride conductance Reduced levels of cell surface chloride transport Genistein Milrinone Phenylbutyrate UTP INS36217 Moli1901 Class V Mutations causing defects in CFTR channel expression levels.
X
ABCC7 p.Pro574His 11966405:114:37
status: NEW[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]
Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994].
X
ABCC7 p.Pro574His 12124743:46:269
status: NEW[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]
Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering.
X
ABCC7 p.Pro574His 12815607:64:1325
status: NEW[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]
Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency.
X
ABCC7 p.Pro574His 12865275:309:338
status: NEW[hide] Comparative pharmacology of the activity of wild-t... J Membr Biol. 2003 Jul 15;194(2):109-17. Derand R, Bulteau-Pignoux L, Becq F
Comparative pharmacology of the activity of wild-type and G551D mutated CFTR chloride channel: effect of the benzimidazolone derivative NS004.
J Membr Biol. 2003 Jul 15;194(2):109-17., 2003-07-15 [PMID:14502435]
Abstract [show]
The pharmacological activation of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel mutated at glycine 551 (G551D-CFTR) was studied in the presence of the benzimidazolone derivative NS004 and compared to that of wild-type (wt) CFTR. Using iodide ((125)I) efflux and whole-cell patch-clamp techniques we found dose-dependent stimulation of phosphorylated wt-CFTR channels by NS004 with an EC(50) approximately 11 microM. With non-phosphorylated CFTR, the effect of NS004 was apparent only at concentration >100 microM. In G551D-CFTR-expressing CHO cells, neither forskolin (from 0.1 to 10 microM) nor NS004 (from 0.1 to 200 microM) added separately were able to stimulate channel activity. However, in the presence of 10 microM forskolin, NS004 stimulated G551D-CFTR activity in a dose-dependent manner with an EC(50) approximately 1.5 microM. We also determined the half-maximal effective concentration of forskolin ( EC(50) approximately 3.2 microM) required to stimulate G551D channel activity in presence of 1.5 micro M NS004. No inhibitory effect was observed at high concentration of NS004 with both wt- and G551D-CFTR. Whole-cell recordings of CFTR chloride currents from cells expressing wild-type or G551D-CFTR in the presence of NS004 were linear, time- and voltage-independent. The inhibitory profile of G551D-CFTR channel activity was similar to that of wild type, i.e., inhibition by glibenclamide (100 microM) and DPC (250 microM) but not by DIDS (200 microM) nor calixarene (100 nM). These results show that NS004 activates wt-CFTR channel and restores G551D-CFTR channel activity, the potency of which depends on both the concentration of NS004 and the phosphorylation status of CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
204 Further studies have also demonstrated that NS004 is a modulator of P574H (Champigny et al., 1995), K1250A (Al-Nakkash et al., 2001) and delF508 (Gribkoff et al., 1994; He et al., 1998; Al-Nakkash et al., 2001).
X
ABCC7 p.Pro574His 14502435:204:68
status: NEW[hide] Genetic disorders of the pancreas. Gastroenterol Clin North Am. 2003 Sep;32(3):763-87. Morinville V, Perrault J
Genetic disorders of the pancreas.
Gastroenterol Clin North Am. 2003 Sep;32(3):763-87., [PMID:14562574]
Abstract [show]
The venues opened to all by the remarkable studies of the genome are just starting to become manifest; they can now distinguish different variants of a disease; they are given the tools to better understand the pathophysiology of illness; they hope to be able to provide better treatment alternatives to our patients. The examples described in this review demonstrate the applicability of these concepts to pancreatic disorders. Researchers may be just scratching the surface at this time, but the potential is enormous. Many philosophic and ethical questions need to be answered as physicians move along: Should all family members of an index case be screened? Who should pay for testing? Who should get results? But, without the participation of so many patients, their family members, and numerous volunteers, researchers would not have witnessed the bridging of so many gaps as they have so far. All of us may now look forward to the application of this incredible knowledge to the therapeutic solutions so eagerly awaited.
Comments [show]
None has been submitted yet.
No. Sentence Comment
84 Mutations of CFTR include: deltaF508, R117H, D1152H, P574H, 3120 G > A, 621 + 1 G > T, G1069R, N1303K.
X
ABCC7 p.Pro574His 14562574:84:53
status: NEW[hide] Isolated idiopathic chronic pancreatitis associate... Gastroenterol Clin Biol. 2003 Aug-Sep;27(8-9):821-4. Reboul MP, Laharie D, Amouretti M, Lacombe D, Iron A
Isolated idiopathic chronic pancreatitis associated with a compound heterozygosity for two mutations of the CFTR gene.
Gastroenterol Clin Biol. 2003 Aug-Sep;27(8-9):821-4., [PMID:14586256]
Abstract [show]
We report the case of a patient suffering from idiopathic chronic pancreatitis (ICP) and compound heterozygous for mutations G542X and S1235R of the cystic fibrosis transmembrane regulator (CFTR) gene. The patient had normal sweat test and no other clinical sign usually linked with a typical or moderate pathology (bronchiectasis, nasal polyposis, congenital absence of the vas deferens) of the CFTR gene. G542X is a severe mutation, which is usually found in classical cystic fibrosis when associated with other severe mutations. S1235R is a quite rare abnormality recently reported as being potentially pathogenic when combined in trans with a second CF mutation. Our case is quite similar to the only other six patients in the literature in whom only the pancreas is affected and who bear a rare mutation with moderate effect. The history and the clinical features of our patient indicate an unambiguous isolated ICP in which the presence of the S1235R mutation--in trans with regard to G542X--is likely responsible for the ICP phenotype. This case could throw light on some of the as yet poorly known abnormalities of the CFTR gene in the ICP phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
80 Patient CFTR no PolyT genotype Sex genotype Age (years) Sweat chloride (mmol/L) Anamnestic features known to be associated with atypical CF Reference 1 F508del/R117H 9T/7T M 45 29 CBAVD [4] 2 N1303K/R117H 9T/7T F n.a. 37 bronchiectasis, sinusitis, positive NPD [5] 3 R1162X/2789+5G>A 7T/7T F n.a. 108 chronic cough [5] 4 I336K/R75Q 7T/7T F 26 26 nasal polyposis [7] 5 F508del/L997F 9T/7T M 17 24 none [11] 6 3849+10kbC>T/3878delG 7T/7T M 14 n.a. none [11] 7 S1235R/L997F 5T/7T M 27 25 none [11] 8 F508del/R117H n.a. M 45 29 CBAVD, smooth P. aeruginosa [12] 9 F508del/I1027T n.a. F 32 59 none [12] 10 F508del/D1152H n.a. M 8 62 none [12] 11 F508del/D1152H n.a. F 15 32 none [12] 12 F508del/P574H n.a. F 26 81 sinus surgery, S. aureus, S. maltophilia [12] 13 F508del/3120G>A n.a. F 40 n.a. n.a. [12] 14 F508del/G1069R n.a. M 16 n.a. n.a. [12] 15 G542X/S1235R 7T/7T M 35 15 none [this study] n.a.: not available.
X
ABCC7 p.Pro574His 14586256:80:689
status: NEW[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]
Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes.
X
ABCC7 p.Pro574His 14641997:63:1397
status: NEWX
ABCC7 p.Pro574His 14641997:63:1493
status: NEWX
ABCC7 p.Pro574His 14641997:63:1589
status: NEW[hide] Emerging drug treatments for cystic fibrosis. Expert Opin Emerg Drugs. 2003 Nov;8(2):523-35. Zeitlin PL
Emerging drug treatments for cystic fibrosis.
Expert Opin Emerg Drugs. 2003 Nov;8(2):523-35., [PMID:14662004]
Abstract [show]
Cystic fibrosis (CF) is one of the most common life-shortening inherited disorders. Mutations in the cystic fibrosis transmembrane regulator (CFTR) gene disrupt the localisation and function of the cAMP-mediated chloride channel. Most of the morbidity and mortality arise from the lung disease which is characterised by excessive inflammation and chronic infection. Research into the mechanisms of wild-type and mutant CFTR biogenesis suggest that multiple drug targets can be identified. This review explores the current understanding of the nature of the different mutant CFTR forms and the potential for repair of the chloride channel defect. High-throughput screening, pharmacogenomics and proteomics bring recent technological advances to the field.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 The ∆F508 mutation and others such as N1303K or P574H [26], which are also misprocessed in the ER, have been grouped together as Class 2 mutations in CFTR [27].
X
ABCC7 p.Pro574His 14662004:53:55
status: NEW88 Class of mutation Molecular mechanism Pancreatic status (if known) Examples 1 No CFTR protein synthesis PI W1282X, G542X, R553X, 621 + 1 G→T, 1717-1 G→A, 3905insT, 394delTT 2 Abnormal CFTR processing and trafficking PI ∆F508, N1303K, P574H 3 Defective CFTR regulation (normal trafficking) PI G551D, G551S, G1349D, S1255P 4 Decreased CFTR chloride conductance PS R117H, R334W, R347P, P547H 5 Reduced synthesis and trafficking of normal CFTR PS A455E, 3849 + 10kb C→T, (5T) 6A Reduced apical stability PI S1455X, Q1412S, 4326delTC, 4279insA 6B Defective regulation of other ion channels PI G551D Note that the G551D is placed in Class 3 for defective regulation and Class 6B for defective regulation of the outwardly rectifying chloride channel.
X
ABCC7 p.Pro574His 14662004:88:255
status: NEW301 OSTEDGAARD LS, ZEIHER B, WELSH MJ: Processing of CFTR bearing the P574H mutation differs from wild-type and deltaF508-CFTR.
X
ABCC7 p.Pro574His 14662004:301:66
status: NEW[hide] Risk of pancreatitis with mutation of the cystic f... Am J Gastroenterol. 2004 Jul;99(7):1358-63. Choudari CP, Imperiale TF, Sherman S, Fogel E, Lehman GA
Risk of pancreatitis with mutation of the cystic fibrosis gene.
Am J Gastroenterol. 2004 Jul;99(7):1358-63., [PMID:15233679]
Abstract [show]
BACKGROUND: Between 5% and 15% of patients with recurrent pancreatitis have no identified etiology after routine investigation and advanced endoscopic evaluation. OBJECTIVE: To determine whether mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is a risk factor for idiopathic pancreatitis. METHODS: We compared the frequency of CFTR mutations as measured by DNA probe analysis in a case group of persons with idiopathic pancreatitis and a control group without pancreatitis, all of whom underwent endoscopic retrograde cholangiopancreatography. A separate analysis compared the prevalence of CFTR mutations between the case group and controls with pancreatitis of known etiology. A subgroup comparison was made between cases of pancreas divisum with pancreatitis and controls with pancreas divisum and no pancreatitis. RESULTS: CFTR mutations were present in 19 (19%) of 96 cases and 7 (3.5%) of 198 controls without pancreatitis (odds ratio, OR = 6.7; 95% CI, 2.8-16.3; p < 0.00001). Compared to the controls with a known cause of pancreatitis (N = 78), cases had a higher prevalence of CFTR mutations (19% vs 2.6%, OR = 9.4; CI, 2.1-41.7; p= 0.0005). Among subjects with pancreas divisum, CFTR mutations were present in 8 (22%) of 37 cases compared to 0 (0%) of 20 controls (OR = 11.8; CI, 8.9-14.7; p= 0.02). CONCLUSION: The risk of idiopathic pancreatitis is greater among persons with CFTR mutations as compared to persons without CFTR mutations. Among persons with pancreas divisum, CFTR mutations appear to increase the risk for pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
130 In a study of more than 500 CF patients, five mutations (R117H, R334W, R347P, A455E, and P574H) were found exclusively in pancreatic sufficient patients (8).
X
ABCC7 p.Pro574His 15233679:130:89
status: NEW[hide] Relation of sweat chloride concentration to severi... Pediatr Pulmonol. 2004 Sep;38(3):204-9. Davis PB, Schluchter MD, Konstan MW
Relation of sweat chloride concentration to severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2004 Sep;38(3):204-9., [PMID:15274098]
Abstract [show]
In cystic fibrosis (CF), sweat chloride concentration has been proposed as an index of CFTR function for testing systemic drugs designed to activate mutant CFTR. This suggestion arises from the assumption that greater residual CFTR function should lead to a lower sweat chloride concentration, as well as protection against severe lung disease. This logic gives rise to the hypothesis that the lower the sweat chloride concentration, the less severe the lung disease. In order to test this hypothesis, we studied 230 patients homozygous for the DeltaF508 allele, and 34 patients with at least one allele associated with pancreatic sufficiency, born since January 1, 1955, who have pulmonary function data and sweat chloride concentrations recorded in our CF center database, and no culture positive for B. cepacia. We calculated a severity index for pulmonary disease, using an approach which takes into account all available pulmonary function data as well as the patient's current age and survival status. Patients with alleles associated with pancreatic sufficiency had significantly better survival (P = 0.0083), lower sweat chloride concentration (81.4 +/- 23.8 vs. 103.2 +/- 14.2 mEq/l, P < 0.0001), slower rate of decline of FEV(1) % predicted (-0.75 +/- 0.34 vs. -2.34 +/- 0.17% predicted per year), and a better severity index than patients homozygous for the DeltaF508 allele (median 73rd percentile vs. median 55th percentile, P = 0.0004). However, the sweat chloride concentration did not correlate with the severity index, either in the population as a whole, or in the population of patients with alleles associated with pancreatic sufficiency, who are thought to have some residual CFTR function. These data suggest that, by itself, sweat chloride concentration does not necessarily predict a milder pulmonary course in patients with cystic fibrosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
27 T; G91R; E92K; P205S; G551S; Y563N; and P574H.23,24 Note that there are 36 mild alleles in 34 subjects, because two subjects had both the 3848 þ 10 kb C !
X
ABCC7 p.Pro574His 15274098:27:40
status: NEW[hide] Use of fecal elastase-1 to classify pancreatic sta... J Pediatr. 2004 Sep;145(3):322-6. Borowitz D, Baker SS, Duffy L, Baker RD, Fitzpatrick L, Gyamfi J, Jarembek K
Use of fecal elastase-1 to classify pancreatic status in patients with cystic fibrosis.
J Pediatr. 2004 Sep;145(3):322-6., [PMID:15343184]
Abstract [show]
OBJECTIVE: To test the hypothesis that some patients with cystic fibrosis (CF) are misclassified as pancreatic insufficient, using fecal elastase-1 (FE-1) to define pancreatic status. STUDY DESIGN: Subjects with CF at 33 CF centers filled out questionnaires and submitted a stool specimen that was analyzed for FE-1. Subjects taking pancreatic enzyme supplements (PES) were asked to discontinue them and perform a 3-day fecal fat balance study if their FE-1 was >200 microg/g stool and they had never had pancreatitis. RESULTS: The median value for FE-1 in 1215 subjects was 0 microg/g stool (range, 0-867). There was a significant difference between patients who had been prescribed PES (n=1131) and those who had FE-1 <200 microg/g stool (n=1074; P<.0001). Sixty-seven subjects met criteria for discontinuation of PES. The mean coefficient of fat absorption for these subjects was 96.1%. CONCLUSIONS: FE-1 is an accurate, easily obtained screening test to classify pancreatic status in patients with CF. This information is important for prognostication, treatment, and to avoid misclassification in clinical research. Measurement of FE-1 should become a standard of care for patients with CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
116 FE-1 values in subjects with CFTR mutations associated with pancreatic sufficiency11 N Mean (mg/g stool) Median (mg/g stool) Range (mg/g stool) Subjects with at least one PS allele* FE-1 >200 mg/g stool 16 584 582.9 349-773 FE-1 <200 mg/g stool 5 64.4 74.8 0-125 Subjects with at least one PS variable alleley FE-1>200 mg/g stool 29 496.2 493.6 224-798 FE-1 <200 mg/g stool 13 76.1 65.9 0-187 *Pancreatic sufficient dominant CF alleles G551S R117H R347H P574H R334W R352Q T3381 yVariable pancreatic sufficient CF mutations G85E 3849 + 10 kb C fi T R347P 2789 + 5G fi A A455E In summary, FE-1 is an accurate, easily obtained screening test to classify patients with CF as PI or PS.
X
ABCC7 p.Pro574His 15343184:116:454
status: NEW[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]
Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Pro574His 15371903:35:239
status: NEW[hide] COPII-dependent export of cystic fibrosis transmem... J Cell Biol. 2004 Oct 11;167(1):65-74. Wang X, Matteson J, An Y, Moyer B, Yoo JS, Bannykh S, Wilson IA, Riordan JR, Balch WE
COPII-dependent export of cystic fibrosis transmembrane conductance regulator from the ER uses a di-acidic exit code.
J Cell Biol. 2004 Oct 11;167(1):65-74., 2004-10-11 [PMID:15479737]
Abstract [show]
Cystic fibrosis (CF) is a childhood hereditary disease in which the most common mutant form of the CF transmembrane conductance regulator (CFTR) DeltaF508 fails to exit the endoplasmic reticulum (ER). Export of wild-type CFTR from the ER requires the coat complex II (COPII) machinery, as it is sensitive to Sar1 mutants that disrupt normal coat assembly and disassembly. In contrast, COPII is not used to deliver CFTR to ER-associated degradation. We find that exit of wild-type CFTR from the ER is blocked by mutation of a consensus di-acidic ER exit motif present in the first nucleotide binding domain. Mutation of the code disrupts interaction with the COPII coat selection complex Sec23/Sec24. We propose that the di-acidic exit code plays a key role in linking CFTR to the COPII coat machinery and is the primary defect responsible for CF in DeltaF508-expressing patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
403 Processing of CFTR bearing the P574H mutation differs from wild-type and ⌬F508-CFTR.
X
ABCC7 p.Pro574His 15479737:403:31
status: NEW[hide] The role of cystic fibrosis gene mutations in dete... Gastroenterol Clin North Am. 2004 Dec;33(4):817-37, vii. Cohn JA, Mitchell RM, Jowell PS
The role of cystic fibrosis gene mutations in determining susceptibility to chronic pancreatitis.
Gastroenterol Clin North Am. 2004 Dec;33(4):817-37, vii., [PMID:15528020]
Abstract [show]
This article reviews current concepts regarding the pathobiology of cystic fibrosis pancreatic disease. It summarizes recent studies on the relationship between CFTR mutations and pancreatitis, and it reviews several unresolved issues in the field.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 When these six nominal CF carriers were tested further by DNA sequencing, rare mutations were identified in five cases (D1152H, P574H, G1069R, 3120G > A; each detected rare mutation is mild-variable [18,30,48,49].
X
ABCC7 p.Pro574His 15528020:74:128
status: NEW78 The European data Table 1 Abnormal CFTR and PSTI genotypes detected in two studies of idiopathic chronic pancreatitis* CFTR genotype category N Genotypes detected in individual subjects US study (Noone et al [47]) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T**; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G>A; 621þ1G>T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T** CFsev / - (CF carriers) 1 N1303K / - CFm-v / - 7 R117H-7T / -; 5T / -**; 5T / -; 5T / -; 5T / -; 5T / -; 5T / - Normal (- / -) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers European study (Audrezet et al [50]) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T*** CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / - (CF carriers)**** 3 DF508 / -; DF508 / -; G542X / - CFm-v / - 9 L967S/-**; IVS18-20T>C/-**; c.4575þ2G>A/-; IVS3-6T>C; 5T/-; 5T/-; 5T/-; 5T/-; 5T/- Normal (- / -) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carrier * CFTR mutations were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v ) [18,47]; all detected CFsev mutations are CF-causing mutations according to current consensus criteria [79].
X
ABCC7 p.Pro574His 15528020:78:337
status: NEW[hide] Molecular pathology of the CFTR locus in male infe... Reprod Biomed Online. 2005 Jan;10(1):14-41. Claustres M
Molecular pathology of the CFTR locus in male infertility.
Reprod Biomed Online. 2005 Jan;10(1):14-41., [PMID:15705292]
Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is a form of infertility with an autosomal recessive genetic background in otherwise healthy males. CBAVD is caused by cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations on both alleles in approximately 80% of cases. Striking CFTR genotypic differences are observed in cystic fibrosis (CF) and in CBAVD. The 5T allele is a CBAVD mutation with incomplete penetrance. Recent evidence confirmed that a second polymorphic locus exists and is a major CFTR modifier. The development of minigene models have led to results suggesting that CFTR exon 9 is skipped in humans because of unusual suboptimal 5' splice sites. An extremely rare T3 allele has been reported and it has recently been confirmed that the T3 allele dramatically increases exon 9 skipping and should be considered as a 'CF' mutation. Routine testing for the most prevalent mutations in the CF Caucasian population will miss most CFTR gene alterations, which can be detected only through exhaustive scanning of CFTR sequences. Finally, a higher than expected frequency of CFTR mutations and/or polymorphisms is now found in a growing number of monosymptomatic disorders, which creates a dilemma for setting nosologic boundaries between CF and diseases related to CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
190 However a single mutation can cause more than one type of abnormality, and hence fall into multiple classes (for example, missense P574H is both a class 2 and class 4 mutation, missense G.'S.
X
ABCC7 p.Pro574His 15705292:190:131
status: NEW[hide] The impact of cystic fibrosis and PSTI/SPINK1 gene... Clin Lab Med. 2005 Mar;25(1):79-100. Cohn JA, Mitchell RM, Jowell PS
The impact of cystic fibrosis and PSTI/SPINK1 gene mutations on susceptibility to chronic pancreatitis.
Clin Lab Med. 2005 Mar;25(1):79-100., [PMID:15749233]
Abstract [show]
This article reviews current concepts regarding the pathobiology of cystic fibrosis pancreatic disease. It summarizes recent studies on the relationship between CFTR mutations and pancreatitis, and it reviews several unresolved issues in the field.
Comments [show]
None has been submitted yet.
No. Sentence Comment
77 When these six nominal CF carriers were tested further by DNA sequencing, rare mutations were identified in five cases (D1152H, P574H, G1069R, 3120G > A; each detected rare mutation is mild-variable [18,30,48,49].
X
ABCC7 p.Pro574His 15749233:77:128
status: NEW90 Table 1 Abnormal CFTR and PSTI genotypes detected in two studies of idiopathic chronic pancreatitis* CFTR genotype category N Genotypes detected in individual subjects US study (Noone et al [47]) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T**; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G>A; 621þ1G>T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T** CFsev / - (CF carriers) 1 N1303K / - CFm-v / - 7 R117H-7T / -; 5T / -**; 5T / -; 5T / -; 5T / -; 5T / -; 5T / - Normal (- / -) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers European study (Audrezet et al [50]) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T*** CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / - (CF carriers)**** 3 DF508 / -; DF508 / -; G542X / - CFm-v / - 9 L967S/-**; IVS18-20T>C/-**; c.4575þ2G>A/-; IVS3-6T>C; 5T/-; 5T/-; 5T/-; 5T/-; 5T/- Normal (- / -) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carrier * CFTR mutations were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v ) [18,47]; all detected CFsev mutations are CF-causing mutations according to current consensus criteria [79].
X
ABCC7 p.Pro574His 15749233:90:319
status: NEW[hide] Cystic fibrosis: an overview. J Clin Gastroenterol. 2005 Apr;39(4):307-17. Turcios NL
Cystic fibrosis: an overview.
J Clin Gastroenterol. 2005 Apr;39(4):307-17., [PMID:15758625]
Abstract [show]
Cystic fibrosis (CF) is one of the most common inherited disorders of white populations. The isolation and cloning of the gene in CF that encodes the production of a transport protein that acts as an apical membrane chloride channel, termed cystic fibrosis transmembrane conductance regulator (CFTR), have improved our understanding of the disorder's pathophysiology and has aided diagnosis, but has also revealed the disease's complexity. Gene replacement therapy is still far from being used in patients with CF, mostly because of difficulties in targeting the appropriate cells. Life expectancy of patients with this disorder has greatly improved over past decades because of better symptomatic treatment strategies. This article summarizes advances in understanding and treatment of CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 Pancreatic Sufficient CF Mutations Dominant Pancreatic-Sufficient Variable Pancreatic-Sufficient G551S G85E P574H R347P R117H 3849 + 10kb C !
X
ABCC7 p.Pro574His 15758625:55:108
status: NEW[hide] Reduced CFTR function and the pathobiology of idio... J Clin Gastroenterol. 2005 Apr;39(4 Suppl 2):S70-7. Cohn JA
Reduced CFTR function and the pathobiology of idiopathic pancreatitis.
J Clin Gastroenterol. 2005 Apr;39(4 Suppl 2):S70-7., [PMID:15758663]
Abstract [show]
Idiopathic chronic pancreatitis (ICP) is the leading cause of chronic pancreatitis in children and nonalcoholic adults. The risk of developing ICP is increased in individuals who have mutations of the cystic fibrosis gene (CFTR) and of a trypsin inhibitor gene (PSTI). In studies from the United States and France, the risk of ICP is increased about 40-fold by having two abnormal copies of the CFTR gene, about 14-fold by having the N34S PSTI mutation, and about 500-fold by having both. When ICP patients have two abnormal copies of the CFTR gene, there is also evidence of reduced residual CFTR protein function in extrapancreatic tissues based on clinical findings and nasal ion transport responses. Thus, pancreatitis risk is highest in individuals who have abnormalities in both the pancreatic ducts (CFTR) and acini (PSTI). These findings indicate that PSTI is a modifier gene for CFTR-related ICP and have implications for the diagnosis and pathogenesis of pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 nominal CF carriers were further tested by DNA sequencing, rare mutations were identified in 5 cases (D1152H, P574H, G1069R, 3120G.A); each detected rare mutation is mild to variable.18,30,48,49 Among the 9 compound heterozygotes, only one would have been corrected classified by CF carrier screening (1).
X
ABCC7 p.Pro574His 15758663:51:110
status: NEW69 Abnormal CFTR and PSTI Genotypes Detected in Two Studies of ICP CFTR Genotype Category* N Genotypes Detected in Individual Subjects U.S. study (Noone et al47 ) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T †; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G.A; 621 + 1G.T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T † CFsev / 2 (CF carriers) 1 N1303K / 2 CFm-v / 2 7 R117H-7T / 2; 5T / 2 †; 5T / 2; 5T / 2; 5T / 2; 5T / 2; 5T / 2 Normal (2 / 2) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers French study (Audrezet et al50 ) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T‡ CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / 2 (CF carriers)§ 3 DF508 / 2; DF508 / 2; G542X / 2 CFm-v / 2 9 L967S/2 †; IVS18-20T.C/ 2†; c.4575+2G.A/2; IVS3-6T.C; 5T/2; 5 /2; 5T/ 2; 5T/2; 5T/ 2 Normal (2 / 2) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carriers *Mutations of the cystic fibrosis (CF) gene (CFTR) were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v )18,47 ; all detected CFsev mutations are CF-causing mutations according to current consensus criteria.68 In the U.S. study, most patients were tested for rare mutations by DNA sequencing47 ; in the French study, most patients were tested by dHPL.50 †These patients were also carriers for the N34S mutation of a trypsin inhibitor gene (PSTI).
X
ABCC7 p.Pro574His 15758663:69:290
status: NEW[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]
Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
211 IBMX produced a small, CFTR-related secretory response in the jejunum, cecum, and rectum of G551D mice but had no effect in the nasal epithelium.78 NS-004 restored near-normal channel activity from P574H-CFTR (a mild, trafficking-impaired mutationinNBD1).79 Theseresultssuggestthat,inaddition to their direct effects on CFTR, these drugs may also have other effects that increase the number of channel proteins found in the membrane.
X
ABCC7 p.Pro574His 15880796:211:198
status: NEW[hide] Small-molecule correctors of defective DeltaF508-C... J Clin Invest. 2005 Sep;115(9):2564-71. Epub 2005 Aug 25. Pedemonte N, Lukacs GL, Du K, Caci E, Zegarra-Moran O, Galietta LJ, Verkman AS
Small-molecule correctors of defective DeltaF508-CFTR cellular processing identified by high-throughput screening.
J Clin Invest. 2005 Sep;115(9):2564-71. Epub 2005 Aug 25., [PMID:16127463]
Abstract [show]
The most common cause of cystic fibrosis (CF) is deletion of phenylalanine 508 (DeltaF508) in the CF transmembrane conductance regulator (CFTR) chloride channel. The DeltaF508 mutation produces defects in folding, stability, and channel gating. To identify small-molecule correctors of defective cellular processing, we assayed iodide flux in DeltaF508-CFTR-transfected epithelial cells using a fluorescent halide indicator. Screening of 150,000 chemically diverse compounds and more than 1,500 analogs of active compounds yielded several classes of DeltaF508-CFTR correctors (aminoarylthiazoles, quinazolinylaminopyrimidinones, and bisaminomethylbithiazoles) with micromolar potency that produced greater apical membrane chloride current than did low-temperature rescue. Correction was seen within 3-6 hours and persisted for more than 12 hours after washout. Functional correction was correlated with plasma membrane expression of complex-glycosylated DeltaF508-CFTR protein. Biochemical studies suggested a mechanism of action involving improved DeltaF508-CFTR folding at the ER and stability at the cell surface. The bisaminomethylbithiazoles corrected DeltaF508-CFTR in DeltaF508/DeltaF508 human bronchial epithelia but did not correct a different temperature-sensitive CFTR mutant (P574H-CFTR) or a dopamine receptor mutant. Small-molecule correctors may be useful in the treatment of CF caused by the DeltaF508 mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
9 The bisaminomethylbithiazoles corrected ∆F508-CFTR in ∆F508/∆F508 human bronchial epithelia but did not correct a different temperature-sensitive CFTR mutant (P574H-CFTR) or a dopamine receptor mutant.
X
ABCC7 p.Pro574His 16127463:9:180
status: NEW115 As an initial test of compound specificity for correction of defective ∆F508-CFTR processing, compounds were tested on P574H-CFTR, a mutant that like ∆F508-CFTR is retained at the ER but can be rescued by incubation for 24 hours at reduced temperature (26).
X
ABCC7 p.Pro574His 16127463:115:126
status: NEW119 Figure 5A shows that corr-4a and -2a, which produced robust chloride currents in ∆F508-CFTR-expressing cells, did not produce significant correction in P574H-CFTR cells, despite a positive low-temperature rescue control.
X
ABCC7 p.Pro574His 16127463:119:159
status: NEW179 (A) Apical membrane chloride current in FRT cells expressing the temperature-sensitive mutant P574H-CFTR.
X
ABCC7 p.Pro574His 16127463:179:94
status: NEW193 The lack of effect of some ∆F508-CFTR correctors on the temperature-sensitive mutant P574H-CFTR and the mutant DRD4-M345T suggests their specificity for the ∆F508 mutation, though further studies are needed to evaluate the numerous potential off-target specificities.
X
ABCC7 p.Pro574His 16127463:193:92
status: NEW202 A similar approach was used to generate BHK cells coexpressing ∆F508-CFTR and YFP-H148Q/I152L and FRT cells stably expressing P574H-CFTR.
X
ABCC7 p.Pro574His 16127463:202:133
status: NEW365 Processing of CFTR bearing the P574H mutation differs from wild-type and ∆F508-CFTR.
X
ABCC7 p.Pro574His 16127463:365:31
status: NEW358 Processing of CFTR bearing the P574H mutation differs from wild-type and ∆F508-CFTR.
X
ABCC7 p.Pro574His 16127463:358:31
status: NEW[hide] Nucleotide binding domains of human CFTR: a struct... Cell Mol Life Sci. 2005 Sep;62(18):2112-23. Eudes R, Lehn P, Ferec C, Mornon JP, Callebaut I
Nucleotide binding domains of human CFTR: a structural classification of critical residues and disease-causing mutations.
Cell Mol Life Sci. 2005 Sep;62(18):2112-23., [PMID:16132229]
Abstract [show]
Defective function of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) causes CF, the most frequent lethal inherited disease among the Caucasian population. The structure of this chloride ion channel includes two nucleotide-binding domains (NBDs), whose ATPase activity controls channel gating. Recently, the experimental structures of mouse and human CFTR NBD1 and our model of the human CFTR NBD1/NBD2 heterodimer have provided new insights into specific structural features of the CFTR NBD dimer. In the present work, we provide a structural classification of CF-causing mutations which may complement the existing functional classification. Our analysis also identified amino acid residues which may play a critical role in interdomain interaction and are located at the NBD1-NBD2 interface or on the surface of the dimer. In particular, a cluster of aromatic amino acids, which includes F508 and straddles the two NBDs, might be directly involved in the interaction of the NBD1/NBD2 heterodimer with the channel-forming membrane-spanning domains.
Comments [show]
None has been submitted yet.
No. Sentence Comment
131 Other examples (fig. 1) are: (i)A455E [38-40] (labeled B in fig. 2); (ii) P574H [40, 41] (labeled S in fig. 2); (iii) A559T [42, 43] (labeled Q in fig. 2).
X
ABCC7 p.Pro574His 16132229:131:74
status: NEW132 Worth noting is that A455E and P574H are mild alleles, as they have been found associated with preserved pancreatic function and residual secretion of chloride; in addition, a correlation between the A455E mutation and mild pulmonary disease has also been reported [38].
X
ABCC7 p.Pro574His 16132229:132:31
status: NEW336 333: 95-99 39 De Braekeleer M., Allard C., Leblanc J. P., Simard F. and Aubin G. (1997) Genotype-phenotype correlation in cystic fibrosis patients compound heterozygous for the A455E mutation. Hum. Genet. 101: 208-211 40 Van Oene M., Lukacs G. L. and Rommens J. M. (2000) Cystic fibrosis mutations lead to carboxyl-terminal fragments that highlight an early biogenesis step of the cystic fibrosis transmembrane conductance regulator. J. Biol. Chem. 275: 19577-19584 41 Ostedgaard L. S., Zeiher B. and Welsh M. J. (1999) Processing of CFTR bearing the P574H mutation differs from wild-type and deltaF508-CFTR.
X
ABCC7 p.Pro574His 16132229:336:551
status: NEW[hide] Combining immunoreactive trypsinogen and pancreati... J Pediatr. 2005 Sep;147(3):302-5. Sarles J, Berthezene P, Le Louarn C, Somma C, Perini JM, Catheline M, Mirallie S, Luzet K, Roussey M, Farriaux JP, Berthelot J, Dagorn JC
Combining immunoreactive trypsinogen and pancreatitis-associated protein assays, a method of newborn screening for cystic fibrosis that avoids DNA analysis.
J Pediatr. 2005 Sep;147(3):302-5., [PMID:16182665]
Abstract [show]
OBJECTIVES: To evaluate the performance of a strategy in which, after immunoreactive trypsinogen (IRT) determination, genetic analysis is replaced by a biological test, the pancreatitis-associated protein (PAP) enzyme-linked immunosorbent assay (ELISA). STUDY DESIGN: The French newborn screening program includes cystic fibrosis (CF) screening by the IRT/CFTR mutation strategy. PAP was assayed on screening cards, in parallel with IRT, in all newborns from 5 French regions (n = 204,749). Analysis of PAP values in CF and non-CF newborns with elevated IRT allowed direct comparison between the current strategy and the proposed IRT/PAP strategy. RESULTS: A protocol in which newborns with IRT >50 ng/mL and PAP >1.8 ng/mL and those with IRT >100 ng/mL and PAP >1.0 ng/mL are directly recalled for sweat testing would have the same performance as the IRT/CFTR mutation strategy. CONCLUSIONS: The IRT/PAP strategy is an alternative for CF newborn screening, which avoids the drawbacks of genetic analysis and is cheaper and easier to implement than the current IRT/CFTR mutation strategy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 A closer look at the results revealed that among the newborns with CF with moderately elevated IRT (50 to <100 ng/mL), 10 had genuine forms of the disease, their genotypes being DF508/DF508 (n = 6), DF508/P574H (n = 1), DF508/G542X (n = 1), DF508/G149R (n = 1), or DF508/?
X
ABCC7 p.Pro574His 16182665:44:205
status: NEW[hide] On the discovery and development of CFTR chloride ... Curr Pharm Des. 2006;12(4):471-84. Becq F
On the discovery and development of CFTR chloride channel activators.
Curr Pharm Des. 2006;12(4):471-84., [PMID:16472140]
Abstract [show]
Chloride channels play important roles in vital cellular signalling processes contributing to homeostasis in both excitable and non-excitable cells. Since 1987, more than ten ion channel genes have been identified as causing human hereditary diseases among them the genes for the voltage-dependent chloride channel ClC-1 (myotonia) and the cystic fibrosis transmembrane conductance regulator (CFTR) protein (cystic fibrosis). The CFTR gene was cloned in 1989 and its protein product identified as an ATP-gated and phosphorylation-regulated chloride channel during the following two years. Since then, searching for potent and specific small molecules able to modulate normal and mutated CFTR has become a crucial endpoint in the field for both our understanding of the physiological role that CFTR plays in epithelial cells and more importantly for the development of therapeutic agents to cure cystic fibrosis (CF). It is predicted that a pharmacological approach would help not only to restore the defective transport activity of mutant CFTR but also to correct the regulatory function of CFTR. This review describes the evolution of CFTR pharmacology and how during the last five years, high throughput screening assays have been developed to identify novel molecules, some of them probably constituting a reservoir of future therapeutic agents for CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Class V mutations (e.g. A455E, P574H) produce functional proteins with normal Cl-channel activity and regulation but at reduced rate of synthesis [19].
X
ABCC7 p.Pro574His 16472140:52:31
status: NEW175 Importantly, NS004 is a modulator of several mutated forms of CFTR; P574H [60], K1250A [61], delF508 [31, 35, 61] and G551D [59].
X
ABCC7 p.Pro574His 16472140:175:68
status: NEW[hide] The relevance of sweat testing for the diagnosis o... Clin Biochem Rev. 2005 Nov;26(4):135-53. Mishra A, Greaves R, Massie J
The relevance of sweat testing for the diagnosis of cystic fibrosis in the genomic era.
Clin Biochem Rev. 2005 Nov;26(4):135-53., [PMID:16648884]
Abstract [show]
Cystic fibrosis (CF) is the most common inherited disorder of childhood. The diagnosis of CF has traditionally been based on clinical features with confirmatory evidence by sweat electrolyte analysis. Since 1989 it has been possible to also use gene mutation analysis to aid the diagnosis. Cloning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has advanced our understanding of CF, in particular the molecular basis of an expanded CF phenotype. However, because there are over 1000 mutations and 200 polymorphisms, many without recognised effects on CFTR, the molecular diagnosis can be troublesome. This has necessitated measurement of CFTR function with renewed interest in the sweat test. This review provides an overview of the clinical features of CF, the diagnosis and complex genetics. We provide a detailed discussion of the structure and function of CFTR and the classification of CFTR mutations. Sweat electrolyte analysis is discussed, from the physiology of sweating to the rigours of a properly performed sweat test and its interpretation. With this information it is possible to understand the relevance of the sweat test in the genomic era.
Comments [show]
None has been submitted yet.
No. Sentence Comment
100 Some mutations, such as P574H have a defect in folding that is less severe than ΔF508, and as a result the protein reaches the plasma membrane and retains some function.74 Figure 2.
X
ABCC7 p.Pro574His 16648884:100:24
status: NEW440 Processing of CFTR bearing the P574H mutation differs from wild-type and deltaF508-CFTR.
X
ABCC7 p.Pro574His 16648884:440:31
status: NEW[hide] CFTR chloride channel drug discovery--inhibitors a... Curr Pharm Des. 2006;12(18):2235-47. Verkman AS, Lukacs GL, Galietta LJ
CFTR chloride channel drug discovery--inhibitors as antidiarrheals and activators for therapy of cystic fibrosis.
Curr Pharm Des. 2006;12(18):2235-47., [PMID:16787252]
Abstract [show]
The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a cAMP-activated chloride channel expressed in epithelia in the lung, intestine, pancreas, testis and other tissues, where it facilitates transepithelial fluid transport. In the intestine CFTR provides the major route for chloride secretion in certain diarrheas. Mutations in CFTR cause the hereditary disease cystic fibrosis, where chronic lung infection and deterioration in lung function cause early death. CFTR is a well-validated targeted for development of inhibitors for therapy of secretory diarrheas and activators for therapy in cystic fibrosis. Our lab has identified and optimized small molecule inhibitors of CFTR, as well as activators of DeltaF508-CFTR, the most common mutant CFTR causing cystic fibrosis. High-throughput screening of small molecule collections utilizing a cell-based fluorescence assay of halide transport yielded thiazolidinone and glycine hydrazide CFTR inhibitors that block enterotoxin-mediated secretory diarrhea in rodent models, including a class of non-absorbable inhibitors that target the CFTR pore at its external entrance. Benzothiophene, phenylglycine and sulfonamide potentiators were identified that correct the defective gating of DeltaF508-CFTR chloride channels, and other small molecules that correct its defective cellular processing. Small molecule modulators of CFTR function may be useful in the treatment of cystic fibrosis, secretory diarrhea and polycystic kidney disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
269 epithelia, but did not correct a different temperature-sensitive CFTR mutant (P574H-CFTR) or a dopamine receptor mutant.
X
ABCC7 p.Pro574His 16787252:269:78
status: NEW[hide] The role of the UPS in cystic fibrosis. BMC Biochem. 2007 Nov 22;8 Suppl 1:S11. Turnbull EL, Rosser MF, Cyr DM
The role of the UPS in cystic fibrosis.
BMC Biochem. 2007 Nov 22;8 Suppl 1:S11., [PMID:18047735]
Abstract [show]
CF is an inherited autosomal recessive disease whose lethality arises from malfunction of CFTR, a single chloride (Cl-) ion channel protein. CF patients harbor mutations in the CFTR gene that lead to misfolding of the resulting CFTR protein, rendering it inactive and mislocalized. Hundreds of CF-related mutations have been identified, many of which abrogate CFTR folding in the endoplasmic reticulum (ER). More than 70% of patients harbor the DeltaF508 CFTR mutation that causes misfolding of the CFTR proteins. Consequently, mutant CFTR is unable to reach the apical plasma membrane of epithelial cells that line the lungs and gut, and is instead targeted for degradation by the UPS. Proteins located in both the cytoplasm and ER membrane are believed to identify misfolded CFTR for UPS-mediated degradation. The aberrantly folded CFTR protein then undergoes polyubiquitylation, carried out by an E1-E2-E3 ubiquitin ligase system, leading to degradation by the 26S proteasome. This ubiquitin-dependent loss of misfolded CFTR protein can be inhibited by the application of 'corrector' drugs that aid CFTR folding, shielding it from the UPS machinery. Corrector molecules elevate cellular CFTR protein levels by protecting the protein from degradation and aiding folding, promoting its maturation and localization to the apical plasma membrane. Combinatory application of corrector drugs with activator molecules that enhance CFTR Cl- ion channel activity offers significant potential for treatment of CF patients. Publication history: Republished from Current BioData's Targeted Proteins database (TPdb; http://www.targetedproteinsdb.com).
Comments [show]
None has been submitted yet.
No. Sentence Comment
141 Promisingly, the activities of 'Corr` correctors are specific for ΔF508 CFTR in HBE cells and did not affect the CFTR mutants P574H or N1303K, or the dopamine receptor mutant [82].
X
ABCC7 p.Pro574His 18047735:141:132
status: NEW[hide] Evidence for direct CFTR inhibition by CFTR(inh)-1... Biochem J. 2008 Jul 1;413(1):135-42. Caci E, Caputo A, Hinzpeter A, Arous N, Fanen P, Sonawane N, Verkman AS, Ravazzolo R, Zegarra-Moran O, Galietta LJ
Evidence for direct CFTR inhibition by CFTR(inh)-172 based on Arg347 mutagenesis.
Biochem J. 2008 Jul 1;413(1):135-42., 2008-07-01 [PMID:18366345]
Abstract [show]
CFTR (cystic fibrosis transmembrane conductance regulator) is an epithelial Cl- channel inhibited with high affinity and selectivity by the thiazolidinone compound CFTR(inh)-172. In the present study, we provide evidence that CFTR(inh)-172 acts directly on the CFTR. We introduced mutations in amino acid residues of the sixth transmembrane helix of the CFTR protein, a domain that has an important role in the formation of the channel pore. Basic and hydrophilic amino acids at positions 334-352 were replaced with alanine residues and the sensitivity to CFTR(inh)-172 was assessed using functional assays. We found that an arginine-to-alanine change at position 347 reduced the inhibitory potency of CFTR(inh)-172 by 20-30-fold. Mutagenesis of Arg347 to other amino acids also decreased the inhibitory potency, with aspartate producing near total loss of CFTR(inh)-172 activity. The results of the present study provide evidence that CFTR(inh)-172 interacts directly with CFTR, and that Arg347 is important for the interaction.
Comments [show]
None has been submitted yet.
No. Sentence Comment
24 However, NBD mutants such as G551D, G1349D or P574H, do not show an altered sensitivity to CFTRinh-172 [9,12].
X
ABCC7 p.Pro574His 18366345:24:46
status: NEW[hide] Atypical cystic fibrosis and CFTR-related diseases... Clin Rev Allergy Immunol. 2008 Dec;35(3):116-23. Paranjape SM, Zeitlin PL
Atypical cystic fibrosis and CFTR-related diseases.
Clin Rev Allergy Immunol. 2008 Dec;35(3):116-23., [PMID:18493878]
Abstract [show]
Cystic fibrosis (CF), which is among the most common life-shortening recessive illnesses, is caused by mutations of the CF transmembrane conductance regulator (CFTR) and typically involves chronic infection and progressive obstruction of the respiratory tract as well as pancreatic exocrine insufficiency. Disease severity, to some extent, correlates with organ sensitivity to CFTR dysfunction and to the amount of functional protein, which is influenced by the type of mutation. Atypical CF represents approximately 2% of affected individuals, and includes cases presenting in adolescence or adulthood with pancreatic exocrine sufficiency, normal or borderline sweat chloride concentrations, or with a single predominant clinical feature. This review briefly describes diagnostic methods and phenotypic characteristics of classic and atypical CF, as well as CFTR-related diseases, conditions in which mutated CFTR may contribute to the pathogenesis but do not strictly fit established diagnostic criteria.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Determination of the transepithelial nasal potential difference has been beneficial in establishing a CF Table 1 Mutations, sites, and molecular consequences associated with either an atypical presentation of CF respiratory disease or pancreatic sufficiency or late-onset pancreatic insufficiency (http:// www.genet.sickkids.on.ca) Mutation Site Consequence Atypical presentation M1210I Exon 19 Met to Ile at 1210 S1455X Exon 24 Ser to Stop at 1455 1811+18G→A Intron 11 mRNA splicing defect L346P Exon 7 Leu to Pro at 346 Y161D Exon 4 Tyr to Asp at 161 R31C Exon 2 Arg to Cys at 31 I752S Exon 13 Ile to Ser at 752 2811G/T Exon 15 Sequence variation Pancreatic sufficiency or late-onset pancreatic insufficiency R600G Exon 13 Arg to Gly at 600 D1152H Exon 18 Asp to His at 1152 Y89C Exon 3 Tyr to Cys at 89 R117H Exon 4 Arg to His at 117 D110E Exon 4 Asp to Glu at 110 296 + 3insT Intron 2 mRNA splicing defect E217G Exon 6a Glu to Gly at 217 V392G Exon 8 Val to Gly at 392 N1088D Exon 17b Asn to Asp at 1088 S737F Exon 13 Missense 1716+1G→A Intron 10 mRNA splicing defect R334W Exon 7 Arg to Trp at 334 R347P Exon 7 Arg to Pro at 347 A455E Exon 9 Ala to Glu at 455 P574H Exon 12 Pro to His at 574 3850-3T→G Intron 19 mRNA splicing defect diagnosis in many atypical cases.
X
ABCC7 p.Pro574His 18493878:64:1179
status: NEWX
ABCC7 p.Pro574His 18493878:64:1193
status: NEW[hide] Direct sensing of intracellular pH by the cystic f... J Biol Chem. 2009 Dec 18;284(51):35495-506. Epub . Chen JH, Cai Z, Sheppard DN
Direct sensing of intracellular pH by the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel.
J Biol Chem. 2009 Dec 18;284(51):35495-506. Epub ., 2009-12-18 [PMID:19837660]
Abstract [show]
In cystic fibrosis (CF), dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel disrupts epithelial ion transport and perturbs the regulation of intracellular pH (pH(i)). CFTR modulates pH(i) through its role as an ion channel and by regulating transport proteins. However, it is unknown how CFTR senses pH(i). Here, we investigate the direct effects of pH(i) on recombinant CFTR using excised membrane patches. By altering channel gating, acidic pH(i) increased the open probability (P(o)) of wild-type CFTR, whereas alkaline pH(i) decreased P(o) and inhibited Cl(-) flow through the channel. Acidic pH(i) potentiated the MgATP dependence of wild-type CFTR by increasing MgATP affinity and enhancing channel activity, whereas alkaline pH(i) inhibited the MgATP dependence of wild-type CFTR by decreasing channel activity. Because these data suggest that pH(i) modulates the interaction of MgATP with the nucleotide-binding domains (NBDs) of CFTR, we examined the pH(i) dependence of site-directed mutations in the two ATP-binding sites of CFTR that are located at the NBD1:NBD2 dimer interface (site 1: K464A-, D572N-, and G1349D-CFTR; site 2: G551D-, K1250M-, and D1370N-CFTR). Site 2 mutants, but not site 1 mutants, perturbed both potentiation by acidic pH(i) and inhibition by alkaline pH(i), suggesting that site 2 is a critical determinant of the pH(i) sensitivity of CFTR. The effects of pH(i) also suggest that site 2 might employ substrate-assisted catalysis to ensure that ATP hydrolysis follows NBD dimerization. We conclude that the CFTR Cl(-) channel senses directly pH(i). The direct regulation of CFTR by pH(i) has important implications for the regulation of epithelial ion transport.
Comments [show]
None has been submitted yet.
No. Sentence Comment
349 In support of this idea, the effects of acidic and alkaline pHi on D572N-CFTR are reminiscent of the enhanced activity of P574H-CFTR, a CF mutant affecting a residue in the Walker B-D-loop region of NBD1 (52).
X
ABCC7 p.Pro574His 19837660:349:122
status: NEW[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]
Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure).
X
ABCC7 p.Pro574His 20059485:64:495
status: NEW57 PI prevalence and in silico prediction scores for 13 most frequent missense mutations identified in Canadian CF patients Mutation Total PI Total (PI + PS) PI prevalence Class PANTHER scorea POLYPHENa SIFTa p.R334W 1 9 0.11 CF-PS -7.4419 Possibly damaging 0.01 p.P67L 2 14 0.14 CF-PS -4.1736 Probably damaging 0 p.R347P 2 12 0.17 CF-PS -7.5259 Possibly damaging 0.01 p.R347H 1 5 0.20 CF-PS -6.8327 Possibly damaging 0 p.A455E 8 39 0.21 CF-PS -8.8641 Probably damaging 0 p.L206W 4 19 0.21 CF-PS -8.5817 Possibly damaging 0 p.P574H 4 7 0.57 CF-PI/PSb -8.1252 Probably damaging 0 p.G85E 15 24 0.63 CF-PI/PSb -7.3194 Possibly damaging 0 p.M1101K 22 33 0.67 CF-PI/PSb -5.8849 Probably damaging 0.01 p.R1066C 7 8 0.88 CF-PI -7.7424 Probably damaging 0 p.G551D 56 59 0.95 CF-PI -9.5654 Probably damaging 0 p.N1303K 47 49 0.96 CF-PI -9.7687 Probably damaging 0 p.V520F 7 7 1.00 CF-PI -7.1652 Benign 0 aPANTHER scores range from zero to negative values (maximum -12).
X
ABCC7 p.Pro574His 20059485:57:523
status: NEW[hide] Folding and rescue of a cystic fibrosis transmembr... J Biol Chem. 2010 Aug 27;285(35):27033-44. Epub 2010 Jun 15. Da Paula AC, Sousa M, Xu Z, Dawson ES, Boyd AC, Sheppard DN, Amaral MD
Folding and rescue of a cystic fibrosis transmembrane conductance regulator trafficking mutant identified using human-murine chimeric proteins.
J Biol Chem. 2010 Aug 27;285(35):27033-44. Epub 2010 Jun 15., 2010-08-27 [PMID:20551307]
Abstract [show]
Impairment of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel causes cystic fibrosis, a fatal genetic disease. Here, to gain insight into CFTR structure and function, we exploited interspecies differences between CFTR homologues using human (h)-murine (m) CFTR chimeras containing murine nucleotide-binding domains (NBDs) or regulatory domain on an hCFTR backbone. Among 15 hmCFTR chimeras analyzed, all but two were correctly processed, one containing part of mNBD1 and another containing part of mNBD2. Based on physicochemical distance analysis of divergent residues between human and murine CFTR in the two misprocessed hmCFTR chimeras, we generated point mutations for analysis of respective CFTR processing and functional properties. We identified one amino acid substitution (K584E-CFTR) that disrupts CFTR processing in NBD1. No single mutation was identified in NBD2 that disrupts protein processing. However, a number of NBD2 mutants altered channel function. Analysis of structural models of CFTR identified that although Lys(584) interacts with residue Leu(581) in human CFTR Glu(584) interacts with Phe(581) in mouse CFTR. Introduction of the murine residue (Phe(581)) in cis with K584E in human CFTR rescued the processing and trafficking defects of K584E-CFTR. Our data demonstrate that human-murine CFTR chimeras may be used to validate structural models of full-length CFTR. We also conclude that hmCFTR chimeras are a valuable tool to elucidate interactions between different domains of CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
305 The different effects of K584E on CFTR processing and Cl-channel function are reminiscent of A455E and P574H, two CF mutations associated with a milder clinical phenotype (44).
X
ABCC7 p.Pro574His 20551307:305:103
status: NEW306 Although production of the mature forms of A455E and P574H was reduced and very much delayed, A455E had channel activity similar to and P574H had channel activity greater than that of WT-CFTR (44).
X
ABCC7 p.Pro574His 20551307:306:53
status: NEWX
ABCC7 p.Pro574His 20551307:306:136
status: NEW[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]
Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function.
X
ABCC7 p.Pro574His 20932301:74:1209
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... Proc Natl Acad Sci U S A. 2011 Feb 15;108(7):2921-6. Epub 2011 Feb 1. Ostedgaard LS, Meyerholz DK, Vermeer DW, Karp PH, Schneider L, Sigmund CD, Welsh MJ
Cystic fibrosis transmembrane conductance regulator with a shortened R domain rescues the intestinal phenotype of CFTR-/- mice.
Proc Natl Acad Sci U S A. 2011 Feb 15;108(7):2921-6. Epub 2011 Feb 1., 2011-02-15 [PMID:21285372]
Abstract [show]
Gene transfer could provide a novel therapeutic approach for cystic fibrosis (CF), and adeno-associated virus (AAV) is a promising vector. However, the packaging capacity of AAV limits inclusion of the full-length cystic fibrosis transmembrane conductance regulator (CFTR) cDNA together with other regulatory and structural elements. To overcome AAV size constraints, we recently developed a shortened CFTR missing the N-terminal portion of the R domain (residues 708-759, CFTRDeltaR) and found that it retained regulated anion channel activity in vitro. To test the hypothesis that CFTRDeltaR could correct in vivo defects, we generated CFTR(-/-) mice bearing a transgene with a fatty acid binding protein promoter driving expression of human CFTRDeltaR in the intestine (CFTR(-/-);TgDeltaR). We found that intestinal crypts of CFTR(-/-);TgDeltaR mice expressed CFTRDeltaR and the intestine appeared histologically similar to that of WT mice. Moreover, like full-length CFTR transgene, the CFTRDeltaR transgene produced CFTR Cl(-) currents and rescued the CFTR(-/-) intestinal phenotype. These results indicate that the N-terminal part of the CFTR R domain is dispensable for in vivo intestinal physiology. Thus, CFTRDeltaR may have utility for AAV-mediated gene transfer in CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
271 BMC Genet 7:18-32. 42. Ostedgaard LS, Zeiher B, Welsh MJ (1999) Processing of CFTR bearing the P574H mutation differs from WT and deltaF508-CFTR.
X
ABCC7 p.Pro574His 21285372:271:95
status: NEW[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]
Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.
Comments [show]
None has been submitted yet.
No. Sentence Comment
131 Four mutations (p.S1255X, p.G330X, c.313delA, p.S364P) were identified only in African Americans, 8 mutations (p.G178R, p.T338I, c.262_ 263delTT, p.M1101K, c.442delA, p.K710X, p.P574H, p.Q1238X)wereidentifiedonlyinCaucasians,and3mu- tations (c.580-1GϾT, c.531delT, p.Q890X) were identified only in Hispanics.
X
ABCC7 p.Pro574His 21474639:131:178
status: NEW[hide] Application of high-resolution single-channel reco... Methods Mol Biol. 2011;741:419-41. Cai Z, Sohma Y, Bompadre SG, Sheppard DN, Hwang TC
Application of high-resolution single-channel recording to functional studies of cystic fibrosis mutants.
Methods Mol Biol. 2011;741:419-41., [PMID:21594800]
Abstract [show]
The patch-clamp technique is a powerful and versatile method to investigate the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel, its malfunction in disease and modulation by small molecules. Here, we discuss how the molecular behaviour of CFTR is investigated using high-resolution single-channel recording and kinetic analyses of channel gating. We review methods used to quantify how cystic fibrosis (CF) mutants perturb the biophysical properties and regulation of CFTR. By explaining the relationship between macroscopic and single-channel currents, we demonstrate how single-channel data provide molecular explanations for changes in CFTR-mediated transepithelial ion transport elicited by CF mutants.
Comments [show]
None has been submitted yet.
No. Sentence Comment
305 Using biochemical (N) and functional Table 27.1 Comparison of predicted apical membrane Cl- current and measured cAMP-activated apical membrane Cl- current for wild-type and mutant CFTRs CFTR N (%) i (%) Po (%) N × i × Po (%) ICFTR (apical) (%) Wild-type 100 100 100 100 100 F508del 4 100 30 1.2 0 G551D 100 100 2.5 2.5 1.5 R117H 100 86 28 24 15 P574H 15 100 139 21.1 17 N, the number of Cl-channels in the apical membrane; i, single-channel current amplitude; Po, open probability; N × i × Po, the predicted apical membrane Cl- current; ICFTR (apical), measured cAMP-activated apical membrane Cl- current.
X
ABCC7 p.Pro574His 21594800:305:359
status: NEW312 Table 27.1 compares the predicted values of N × i × Po with the observed values of ICFTR(apical) measured in FRT epithelia for F508del-CFTR and the CF mutants, R117H, G551D and P574H, which disrupt CFTR function by different mechanisms (33, 37, 59, 64, 65).
X
ABCC7 p.Pro574His 21594800:312:187
status: NEW[hide] Pharmacological therapy for cystic fibrosis: from ... J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45. Becq F, Mall MA, Sheppard DN, Conese M, Zegarra-Moran O
Pharmacological therapy for cystic fibrosis: from bench to bedside.
J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45., [PMID:21658632]
Abstract [show]
With knowledge of the molecular behaviour of the cystic fibrosis transmembrane conductance regulator (CFTR), its physiological role and dysfunction in cystic fibrosis (CF), therapeutic strategies are now being developed that target the root cause of CF rather than disease symptoms. Here, we review progress towards the development of rational new therapies for CF. We highlight the discovery of small molecules that rescue the cell surface expression and defective channel gating of CF mutants, termed CFTR correctors and CFTR potentiators, respectively. We draw attention to alternative approaches to restore epithelial ion transport to CF epithelia, including inhibitors of the epithelial Na(+) channel (ENaC) and activators of the Ca(2+)-activated Cl(-) channel TMEM16A. The expertise required to translate small molecules identified in the laboratory to drugs for CF patients depends on our ability to coordinate drug development at an international level and our ability to provide pertinent biological information using suitable disease models.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 Interestingly, Zielenski and Tsui [10] assigned A455E and P574H, two CF mutations associated with a milder clinical phenotype (pancreatic sufficiency) to Class V.
X
ABCC7 p.Pro574His 21658632:56:58
status: NEW58 Moreover, on reaching the cell surface A455E forms Cl-channels with open probability (Po), a measure of channel activity, similar to that of wild-type CFTR, whereas the Po of P574H exceeds that of wild-type CFTR [15].
X
ABCC7 p.Pro574His 21658632:58:175
status: NEW[hide] Recommendations for the classification of diseases... J Cyst Fibros. 2011 Jun;10 Suppl 2:S86-102. Bombieri C, Claustres M, De Boeck K, Derichs N, Dodge J, Girodon E, Sermet I, Schwarz M, Tzetis M, Wilschanski M, Bareil C, Bilton D, Castellani C, Cuppens H, Cutting GR, Drevinek P, Farrell P, Elborn JS, Jarvi K, Kerem B, Kerem E, Knowles M, Macek M Jr, Munck A, Radojkovic D, Seia M, Sheppard DN, Southern KW, Stuhrmann M, Tullis E, Zielenski J, Pignatti PF, Ferec C
Recommendations for the classification of diseases as CFTR-related disorders.
J Cyst Fibros. 2011 Jun;10 Suppl 2:S86-102., [PMID:21658649]
Abstract [show]
Several diseases have been clinically or genetically related to cystic fibrosis (CF), but a consensus definition is lacking. Here, we present a proposal for consensus guidelines on cystic fibrosis transmembrane conductance regulator (CFTR)-related disorders (CFTR-RDs), reached after expert discussion and two dedicated workshops. A CFTR-RD may be defined as "a clinical entity associated with CFTR dysfunction that does not fulfil diagnostic criteria for CF". The utility of sweat testing, mutation analysis, nasal potential difference, and/or intestinal current measurement for the differential diagnosis of CF and CFTR-RD is discussed. Algorithms which use genetic and functional diagnostic tests to distinguish CF and CFTR-RDs are presented. According to present knowledge, congenital bilateral absence of vas deferens (CBAVD), acute recurrent or chronic pancreatitis and disseminated bronchiectasis, all with CFTR dysfunction, are CFTR-RDs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
323 Using biochemical (N) and functional (i and Po) data, the apical CFTR Cl- current generated by the CF-PI mutant p.F508del-CFTR and the CF-PS mutants p.R117H-, p.R334W-, p.R347P-, p.A455E- and p.P574H-CFTR were predicted [166,167].
X
ABCC7 p.Pro574His 21658649:323:194
status: NEW332 For example, the CF-PS mutant p.P574H-CFTR disrupts CFTR processing, albeit not as severely as p.F508del-CFTR, but generates a CFTR Cl-channel with a Po value greater than that of wild-type CFTR [167].
X
ABCC7 p.Pro574His 21658649:332:32
status: NEW[hide] Congenital bilateral absence of vas deferens with ... Clin Genet. 1998 Mar;53(3):202-4. Arduino C, Ferrone M, Brusco A, Garnerone S, Fontana D, Rolle L, Carbonara AO
Congenital bilateral absence of vas deferens with a new missense mutation (P499A) in the CFTR gene.
Clin Genet. 1998 Mar;53(3):202-4., [PMID:9630075]
Abstract [show]
We describe a congenital bilateral absence of the vas deferens (CBAVD) patient with a compound heterozygosity in the cystic fibrosis transmembrane regulator (CFTR) gene for a stop mutation W1282X and a new missense mutation P499A. The P499A is interpreted as a mild mutation whose phenotypic effects, in this case limited to the development of wolffian duct derivatives, are revealed only in combination with a severe CFTR mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Other missense mutations in this domain (A455E, P574H, G576A, S549N) have been found associated with a mild CF phenotype and their functional analysis in transfected cells revealed a low transport efficiency of the chloride channel and a reduced protein expression at the apical cell surface, which can explain the mild clinical phenotype (6).
X
ABCC7 p.Pro574His 9630075:52:48
status: NEW[hide] Pathology of pancreatic and intestinal disorders i... J R Soc Med. 1998;91 Suppl 34:40-9. Wilschanski M, Durie PR
Pathology of pancreatic and intestinal disorders in cystic fibrosis.
J R Soc Med. 1998;91 Suppl 34:40-9., [PMID:9709387]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
152 A small number of more Table 1 Classification of cystic fibrosis gene mutation as severe, mild or indeterminate with respect to pancreatic function Severe Mild Variable (classes 1, I/ or 111) (classes IV or V) (classes IV or V) AF508 R117H G85E 1148T R334W 2789+5G-*A G480C R347P G551D A455E R560T P574H N1303K 3849+1 Okb C-+T G542X G551S W1282X P5748 621 +1 G-T R352Q 1717-1G-T T3381 556delA Adapted from Ref 20 with permission recently described mutations [G85E and 278+5G-÷AI are less clearly determinant with respect to the pancreatic sufficient and pancreatic insufficient phenotypes.
X
ABCC7 p.Pro574His 9709387:152:298
status: NEW[hide] Characterization of 19 disease-associated missense... Hum Mol Genet. 1998 Oct;7(11):1761-9. Vankeerberghen A, Wei L, Jaspers M, Cassiman JJ, Nilius B, Cuppens H
Characterization of 19 disease-associated missense mutations in the regulatory domain of the cystic fibrosis transmembrane conductance regulator.
Hum Mol Genet. 1998 Oct;7(11):1761-9., [PMID:9736778]
Abstract [show]
In order to gain a better insight into the structure and function of the regulatory domain (RD) of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, 19 RD missense mutations that had been identified in patients were functionally characterized. Nine of these (I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P) resulted in aberrant processing. No or a very small number of functional CFTR proteins will therefore appear at the cell membrane in cells expressing these mutants. These mutations were clustered in the N-terminal part of the RD, suggesting that this subdomain has a folding pattern that is very sensitive to amino acid changes. Mutations that caused no aberrant processing were further characterized at the electrophysiological level. First, they were studied at the whole cell level in Xenopus laevis oocytes. Mutants that induced a whole cell current that was significantly different from wild-type CFTR were subsequently analysed at the single channel level in COS1 cells transiently expressing the different mutant and wild-type proteins. Three mutant chloride channels, G622D, R792G and E822K CFTR, were characterized by significantly lower intrinsic chloride channel activities compared with wild-type CFTR. Two mutations, H620Q and A800G, resulted in increased intrinsic chloride transport activities. Finally, T665S and E826K CFTR had single channel properties not significantly different from wild-type CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
128 So far, only the P574H mutation, located in NBD1, has been shown to give rise to a protein with higher intrinsic chloride transport properties.
X
ABCC7 p.Pro574His 9736778:128:17
status: NEW[hide] Genetic disorders of membrane transport. II. Regul... Am J Physiol. 1998 Dec;275(6 Pt 1):G1221-6. Illek B, Fischer H, Machen TE
Genetic disorders of membrane transport. II. Regulation of CFTR by small molecules including HCO3-.
Am J Physiol. 1998 Dec;275(6 Pt 1):G1221-6., [PMID:9843756]
Abstract [show]
Cystic fibrosis (CF) affects a number of epithelial tissues, including those in the gastrointestinal tract. The goal of this review is to summarize data related to regulation of the protein product of the CF gene, CF transmembrane conductance regulator (CFTR), by a variety of small molecules. There has been a surge of interest in discovering small molecules that could be exogenously added to cells and tissues to regulate CFTR and could potentially be used alone or in combination with genetic approaches for therapy in CF. We will discuss the apparent mechanisms of action of genistein, milrinone, 8-cyclopentyl-1,3-dipropylxanthine, IBMX, and NS-004; several of which appear to interact directly with one or both nucleotide binding domains of CFTR. We also discuss how HCO-3 interacts with CFTR as both a permeating anion and a potential regulator of Cl- permeation through the CFTR ion channel. It is likely that there are complicated interactions between Cl- and HCO-3 in the secretion of both ions through the CFTR and the anion exchanger in intestinal cells, and these may yield a role of CFTR in regulation of intestinal HCO-3 secretion as well as of intra- and extracellular pH.
Comments [show]
None has been submitted yet.
No. Sentence Comment
103 NS-004 restored near normal channel activity from P574H-CFTR (a mild, trafficking-impaired mutation in NBD1) (3).
X
ABCC7 p.Pro574His 9843756:103:50
status: NEW[hide] Pharmacology of CFTR chloride channel activity. Physiol Rev. 1999 Jan;79(1 Suppl):S109-44. Schultz BD, Singh AK, Devor DC, Bridges RJ
Pharmacology of CFTR chloride channel activity.
Physiol Rev. 1999 Jan;79(1 Suppl):S109-44., [PMID:9922378]
Abstract [show]
Pharmacology of CFTR Chloride Channel Activity. Physiol. Rev. 79, Suppl.: S109-S144, 1999. - The pharmacology of cystic fibrosis transmembrane conductance regulator (CFTR) is at an early stage of development. Here we attempt to review the status of those compounds that modulate the Cl- channel activity of CFTR. Three classes of compounds, the sulfonylureas, the disulfonic stilbenes, and the arylaminobenzoates, have been shown to directly interact with CFTR to cause channel blockade. Kinetic analysis has revealed the sulfonylureas and arylaminobenzoates interact with the open state of CFTR to cause blockade. Suggestive evidence indicates the disulfonic stilbenes act by a similar mechanism but only from the intracellular side of CFTR. Site-directed mutagenesis studies indicate the involvement of specific amino acid residues in the proposed transmembrane segment 6 for disulfonic stilbene blockade and segments 6 and 12 for arylaminobenzoate blockade. Unfortunately, these compounds (sulfonylureas, disulfonic stilbenes, arylaminobenzoate) also act at a number of other cellular sites that can indirectly alter the activity of CFTR or the transepithelial secretion of Cl-. The nonspecificity of these compounds has complicated the interpretation of results from cellular-based experiments. Compounds that increase the activity of CFTR include the alkylxanthines, phosphodiesterase inhibitors, phosphatase inhibitors, isoflavones and flavones, benzimidazolones, and psoralens. Channel activation can arise from the stimulation of the cAMP signal transduction cascade, the inhibition of inactivating enzymes (phosphodiesterases, phosphatases), as well as the direct binding to CFTR. However, in contrast to the compounds that block CFTR, a detailed understanding of how the above compounds increase the activity of CFTR has not yet emerged.
Comments [show]
None has been submitted yet.
No. Sentence Comment
579 A second possibility is that the phosporylation state of the channel obtainedsurements, that NS004 similarly activated an additional CFTR mutant, P574H, while failing to activate the CF- during activation by forskolin is distinct from that after activation of the channel by exogenous PKA/ATP in ancausing R560T or DI507 CFTR mutants (70).
X
ABCC7 p.Pro574His 9922378:579:146
status: NEW[hide] Structure-function analysis of the histidine perme... J Biol Chem. 1991 Oct 5;266(28):18714-9. Shyamala V, Baichwal V, Beall E, Ames GF
Structure-function analysis of the histidine permease and comparison with cystic fibrosis mutations.
J Biol Chem. 1991 Oct 5;266(28):18714-9., [PMID:1717452]
Abstract [show]
Traffic ATPases constitute a superfamily of transporters that include prokaryotic permeases and medically important eukaryotic proteins, such as the multidrug resistance P-glycoprotein and the cystic fibrosis gene product. We present a structure-function analysis of a member of this superfamily, the prokaryotic histidine permease, using mutations generated both in vitro and in vivo, and assaying several biochemical functions. The analysis supports a previously predicted structural model and allows the assignment of specific functions to several predicted structural features. Mutations in the secondary structure features which form the nucleotide-binding pocket in general cause the loss of ATP binding activity. Mutations in the helical domain retain ATP binding activity. Several mutations have been identified which may affect the signaling mechanism between ATP hydrolysis and membrane translocation. We relate our findings to those emerging from the recent biochemical and genetic analyses of cystic fibrosis mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
159 A few mutations are located in the nucleotide-binding pocket, A455E,G458V, and P574H, and may be tolerated because they may have maintained partial activity, especially the two that are not located insites defined as critical for ATP binding by the HisPanalysis.
X
ABCC7 p.Pro574His 1717452:159:79
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]
Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray.
X
ABCC7 p.Pro574His 22658665:855:824
status: NEW[hide] Human-mouse cystic fibrosis transmembrane conducta... Proc Natl Acad Sci U S A. 2012 Jan 17;109(3):917-22. Epub 2011 Dec 30. Dong Q, Ostedgaard LS, Rogers C, Vermeer DW, Zhang Y, Welsh MJ
Human-mouse cystic fibrosis transmembrane conductance regulator (CFTR) chimeras identify regions that partially rescue CFTR-DeltaF508 processing and alter its gating defect.
Proc Natl Acad Sci U S A. 2012 Jan 17;109(3):917-22. Epub 2011 Dec 30., [PMID:22210114]
Abstract [show]
The DeltaF508 mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is the most common cause of cystic fibrosis. The mutation disrupts biosynthetic processing, reduces channel opening rate, and decreases protein lifetime. In contrast to human CFTR (hCFTR)-DeltaF508, mouse CFTR-DeltaF508 is partially processed to the cell surface, although it exhibits a functional defect similar to hCFTR-DeltaF508. To explore DeltaF508 abnormalities, we generated human-mouse chimeric channels. Substituting mouse nucleotide-binding domain-1 (mNBD1) into hCFTR partially rescued the DeltaF508-induced maturation defect, and substituting mouse membrane-spanning domain-2 or its intracellular loops (ICLs) into hCFTR prevented further DeltaF508-induced gating defects. The protective effect of the mouse ICLs was reverted by inserting mouse NBDs. Our results indicate that the DeltaF508 mutation affects maturation and gating via distinct regions of the protein; maturation of CFTR-DeltaF508 depends on NBD1, and the DeltaF508-induced gating defect depends on the interaction between the membrane-spanning domain-2 ICLs and the NBDs. These appear to be distinct processes, because none of the chimeras repaired both defects. This distinction was exemplified by the I539T mutation, which improved CFTR-DeltaF508 processing but worsened the gating defect. Our results, together with previous studies, suggest that many different NBD1 modifications improve CFTR-DeltaF508 maturation and that the effect of modifications can be additive. Thus, it might be possible to enhance processing by targeting several different regions of the domain or by targeting a network of CFTR-associated proteins. Because no one modification corrected both maturation and gating, perhaps more than a single agent will be required to correct all CFTR-DeltaF508 defects.
Comments [show]
None has been submitted yet.
No. Sentence Comment
281 Protein Sci 19: 1932-1947. 35. Ostedgaard LS, Zeiher B, Welsh MJ (1999) Processing of CFTR bearing the P574H mutation differs from wild-type and ΔF508-CFTR.
X
ABCC7 p.Pro574His 22210114:281:103
status: NEW[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]
Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Pro574His 16049310:51:3509
status: NEW150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide.
X
ABCC7 p.Pro574His 16049310:150:6858
status: NEWX
ABCC7 p.Pro574His 16049310:150:6903
status: NEW[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]
Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
94 D572N was identified in a Russian patient22 and P574H was identified in two patients with pancreatic sufficiency.23 The serine residue at position 573 is highly conserved across species, as are at least seven residues on either side in mammals, and two in amphibians and fish.24 A second mutation in this subject was not identified.
X
ABCC7 p.Pro574His 15858154:94:48
status: NEW[hide] Therapeutic approaches to repair defects in deltaF... Adv Drug Deliv Rev. 2002 Dec 5;54(11):1395-408. Powell K, Zeitlin PL
Therapeutic approaches to repair defects in deltaF508 CFTR folding and cellular targeting.
Adv Drug Deliv Rev. 2002 Dec 5;54(11):1395-408., [PMID:12458151]
Abstract [show]
The deltaF508 mutation in the cystic fibrosis transmembrane regulator (CFTR) gene is the most common mutation in CF. The mutant CFTR protein is defective with respect to multiple functions including cAMP-regulated chloride conductance, nucleotide transport, and regulatory actions on other ion channels. Since the deltaF508 protein is also temperature-sensitive and unstable during translation and folding in the endoplasmic reticulum (ER), most of the nascent chains are targeted for premature proteolysis from the ER. This paper focuses on the events that occur in the ER during folding and reviews potential targets for therapeutic intervention.
Comments [show]
None has been submitted yet.
No. Sentence Comment
92 The effect the DF508, as well as the N1303K, and P574H.
X
ABCC7 p.Pro574His 12458151:92:49
status: NEW93 on band C formation was reversible so that when the Class III mutations are defective in regulation of cells were placed back into culture at 37 8C, the chloride conductance through the CFTR at the amount of fully mature protein decreased with a plasma membrane and include the G551D and half-life of approximately 7 h (similar to wild type) G551S mutations.
X
ABCC7 p.Pro574His 12458151:93:49
status: NEW[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]
Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE.
X
ABCC7 p.Pro574His 12454843:105:200
status: NEW[hide] Cystic fibrosis and related diseases of the pancre... Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26. Naruse S, Kitagawa M, Ishiguro H, Fujiki K, Hayakawa T
Cystic fibrosis and related diseases of the pancreas.
Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26., [PMID:12079272]
Abstract [show]
The discovery of the gene for cystic fibrosis (CF), the cystic fibrosis transmembrane conductance regulator (CFTR), brought about a new era in the study of this disease. Identification of the molecular target has yielded a flood of data that add to our understanding of the pathogenesis, diagnosis and treatment of CF. The CFTR protein is a cAMP-regulated Cl(-) channel with multiple functions in epithelial cells. In the exocrine pancreas the CFTR plays a key role in the apical Cl(-), HCO(3)(-), and water transport in duct cells. The severe loss of functions, caused by mutations of the CFTR gene, leads to pathological lesions of the pancreas. Over 1200 CFTR mutations and polymorphisms have been identified and their diversity may explain the high level of heterogeneity in the CF phenotype. Mutation analyses of the CFTR gene have revealed a spectrum of CFTR-related diseases that do not fit the classical CF picture but are associated with dysfunction of CFTR, such as chronic pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
62 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic ®brosis of the pancreas'.
X
ABCC7 p.Pro574His 12079272:62:481
status: NEW64 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuQciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 W 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic &#ae;brosis of the pancreas'.
X
ABCC7 p.Pro574His 12079272:64:479
status: NEW[hide] Conformation, independent of charge, in the R doma... Biophys J. 2000 Mar;78(3):1293-305. Xie J, Zhao J, Davis PB, Ma J
Conformation, independent of charge, in the R domain affects cystic fibrosis transmembrane conductance regulator channel openings.
Biophys J. 2000 Mar;78(3):1293-305., [PMID:10692317]
Abstract [show]
The R domain of cystic fibrosis transmembrane conductance regulator (CFTR), when phosphorylated, undergoes conformational change, and the chloride channel opens. We investigated the contribution of R domain conformation, apart from the changes induced by phosphorylation, to channel opening, by testing the effect of the peptidyl-prolyl isomerase, cyclophilin A, on the CFTR channel. When it was applied after the channel had been opened by PKA phosphorylation, cyclophilin A increased the open probability of wild-type CFTR (from P(o) = 0.197 +/- 0.010 to P(o) = 0.436 +/- 0. 029) by increasing the number of channel openings, not open time. Three highly conserved proline residues in the R domain, at positions 740, 750, and 759, were considered as candidate targets for cyclophilin A. Mutations of these prolines to alanines (P3A mutant) resulted in a channel unresponsive to cyclophilin A but with pore properties similar to the wild type, under strict control of PKA and ATP, but with significantly increased open probability (P(o) = 0.577 +/- 0.090) compared to wild-type CFTR, again due to an increase in the number of channel openings and not open time. Mutation of each of the proline residues separately and in pairs demonstrated that all three proline mutations are required for maximal P(o). When P3A was expressed in 293 HEK cells and tested by SPQ assay, chloride efflux was significantly increased compared to cells transfected with wild-type CFTR. Thus, treatments favoring the trans-peptidyl conformation about conserved proline residues in the R domain of CFTR affect openings of CFTR, above and beyond the effect of PKA phosphorylation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
272 Although other CFTR mutants have chloride transport in excess of WT CFTR, they are either not processed efficiently (e.g., P574H or H949Y) (Sheppard et al., 1996a, b; Seibert et al., 1996) or open without PKA stimulation (e.g., CFTR-D836X), and thus are not subject to physiologic regulation (Sheppard et al., 1994).
X
ABCC7 p.Pro574His 10692317:272:123
status: NEW274 Although other CFTR mutants have chloride transport in excess of WT CFTR, they are either not processed efficiently (e.g., P574H or H949Y) (Sheppard et al., 1996a, b; Seibert et al., 1996) or open without PKA stimulation (e.g., CFTR-D836X), and thus are not subject to physiologic regulation (Sheppard et al., 1994).
X
ABCC7 p.Pro574His 10692317:274:123
status: NEW[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]
Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT.
X
ABCC7 p.Pro574His 10923036:107:108
status: NEW141 Some mutants are misprocessed (class II) but generate channels that retain significant activity which is sufficient to confer a milder clinical phenotype (for instance, A455E or P574H).
X
ABCC7 p.Pro574His 10923036:141:178
status: NEW171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele.
X
ABCC7 p.Pro574His 10923036:171:340
status: NEW[hide] Function of the second nucleotide-binding fold in ... FEBS Lett. 1999 Oct 8;459(2):177-85. Zerhusen B, Ma J
Function of the second nucleotide-binding fold in the CFTR chloride channel.
FEBS Lett. 1999 Oct 8;459(2):177-85., [PMID:10518014]
Abstract [show]
To test the role of nucleotide-binding fold (NBF) 2 and its interaction with the regulatory (R) domain in the function of the cystic fibrosis transmembrane conductance regulator (CFTR) channel, we used three deletion mutants of CFTR: DeltaR(708-835), DeltaNBF2(1185-1349) and DeltaR-DeltaNBF2. In lipid bilayers, DeltaNBF2 channel activity is ATP- and cAMP-dependent protein kinase (PKA)-dependent, but unlike wild-type (wt) CFTR, it displays a reduced activity and insensitivity to 5'-adenylylimidodiphosphate (AMP-PNP). Both DeltaR and DeltaR-DeltaNBF2 channels are PKA-independent, but DeltaR activity is reduced whereas DeltaR-DeltaNBF2 activity is increased. Deletion of NBF2 from CFTR affects protein trafficking and channel gating kinetics. The data suggest that NBF2 could have inhibitory and stimulatory roles in CFTR activity by interaction with NBF1 directly or indirectly via the R domain.
Comments [show]
None has been submitted yet.
No. Sentence Comment
212 Mutations in di¡erent regions of CFTR, either changes in single amino acids, i.e. vF508 and P574H [17], or regional deletions, i.e. vexon5 and v19 [20,28], all lead to di¤culty in proper folding and have a signi'cant impact on the processing of CFTR proteins.
X
ABCC7 p.Pro574His 10518014:212:97
status: NEW211 Mutations in di&#a1;erent regions of CFTR, either changes in single amino acids, i.e. vF508 and P574H [17], or regional deletions, i.e. vexon5 and v19 [20,28], all lead to di&#a4;culty in proper folding and have a signi'cant impact on the processing of CFTR proteins.
X
ABCC7 p.Pro574His 10518014:211:96
status: NEW[hide] Cystic fibrosis: a multiple exocrinopathy caused b... Am J Med. 1998 Jun;104(6):576-90. Schwiebert EM, Benos DJ, Fuller CM
Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein.
Am J Med. 1998 Jun;104(6):576-90., [PMID:9674722]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
223 They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X).
X
ABCC7 p.Pro574His 9674722:223:145
status: NEW238 Some of these mutations, however, such as A455E, P574H and G551S have been associated either with less severe pulmonary disease and/or less compromised Cl- channel function.
X
ABCC7 p.Pro574His 9674722:238:49
status: NEW[hide] Transmembrane domain of cystic fibrosis transmembr... Biochemistry. 1998 Jan 20;37(3):844-53. Wigley WC, Vijayakumar S, Jones JD, Slaughter C, Thomas PJ
Transmembrane domain of cystic fibrosis transmembrane conductance regulator: design, characterization, and secondary structure of synthetic peptides m1-m6.
Biochemistry. 1998 Jan 20;37(3):844-53., [PMID:9454574]
Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) give rise to cystic fibrosis (CF), the most common genetic disease in the Caucasian population. CFTR is organized into five putative domains, including two that are predicted to be transmembrane and consist of six membrane-spanning segments each. CFTR mediates regulated anion transport across the apical membrane of epithelial cells. The pore through which CFTR transports its solutes is thought to be formed by some combination of the amino-terminal membrane-spanning segments. Although these sequences are predicted to be alpha-helical in secondary structure, to date, no direct structural evidence has been presented testing this hypothesis. Here, we present the biophysical characterization of six peptides (m1-m6) representing the predicted amino-terminal membrane-spanning domain of CFTR. The peptides can be incorporated into liposomes and are soluble in SDS micelles and trifluoroethanol (TFE). FTIR and CD spectroscopy indicate all six peptides adopt a stable, predominantly alpha-helical secondary structure in these environments. In contrast, peptide m6 undergoes a shift from alpha-helix to beta-sheet when dissolved in 20% methanol. Additionally, the peptides show an increase in beta-sheet in TFE, a known inducer of alpha-helices, relative to that seen in the nativelike environments. These results have implications for the folding of this complex membrane protein and suggest that the possible functional role of m6 is manifested through a shift in secondary structure.
Comments [show]
None has been submitted yet.
No. Sentence Comment
261 The critical importance of this intramembrane residue to CFTR structure is highlighted by the CF-causing mutation of proline 205 to serine (54), which prevents proper folding and processing of CFTR (52) and causes a form of cystic fibrosis similar to other misprocessing mutants such as A455E and P574H (55).
X
ABCC7 p.Pro574His 9454574:261:297
status: NEW[hide] Modeling of nucleotide binding domains of ABC tran... J Bioenerg Biomembr. 1997 Oct;29(5):503-24. Bianchet MA, Ko YH, Amzel LM, Pedersen PL
Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR).
J Bioenerg Biomembr. 1997 Oct;29(5):503-24., [PMID:9511935]
Abstract [show]
Members of the ABC transporter superfamily contain two nucleotide binding domains. To date, the three dimensional structure of no member of this super-family has been elucidated. To gain structural insight, the known structures of several other nucleotides binding proteins can be used as a framework for modeling these domains. We have modeled both nucleotide binding domains of the protein CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) using the two similar domains of mitochondrial F1-ATPase. The models obtained, provide useful insights into the putative functions of these domains and their possible interaction as well as a rationale for the basis of Cystic Fibrosis causing mutations. First, the two nucleotide binding domains (folds) of CFTR are each predicted to span a 240-250 amino acid sequence rather than the 150-160 amino acid sequence originally proposed. Second, the first nucleotide binding fold, is predicted to catalyze significant rates of ATP hydrolysis as a catalytic base (E504) resides near the y phosphate of ATP. This prediction has been verified experimentally [Ko, Y.H., and Pedersen, P.L. (1995) J. Biol. Chem. 268, 24330-24338], providing support for the model. In contrast, the second nucleotide binding fold is predicted at best to be a weak ATPase as the glutamic acid residue is replaced with a glutamine. Third, F508, which when deleted causes approximately 70% of all cases of cystic fibrosis, is predicted to lie in a cleft near the nucleotide binding pocket. All other disease causing mutations within the two nucleotide binding domains of CFTR either reside near the Walker A and Walker B consensus motifs in the heart of the nucleotide binding pocket, or in the C motif which lies outside but near the nucleotide binding pocket. Finally, the two nucleotide binding domains of CFTR are predicted to interact, and in one of the two predicted orientations, F508 resides near the interface. This is the first report where both nucleotide binding domains of an ABC transporter and their putative domain-domain interactions have been modeled in three dimensions. The methods and the template used in this work can be used to analyze the structures and function of the nucleotide binding domains of all other members of the ABC transporter super-family.
Comments [show]
None has been submitted yet.
No. Sentence Comment
360 The CFTR NBD1 model that results (Fig. 6) gathers the disease causing mutations in three different clusters: (1) mutations affecting the nucleotide binding pocket and the putative general base: A455E, G458V, E504Q AI507 AF508 P574H; (2) mutations in motif C which are probably related to an interaction with region D: S549[R,N,I] G551[S,D], R553Q; and (3) mutations within or near motif B, L558S, A559T, R560T, Y563N and mutations S492F and G480C.
X
ABCC7 p.Pro574His 9511935:360:226
status: NEW[hide] Diagnosing cystic fibrosis: blood, sweat, and tear... Arch Dis Child. 1997 Feb;76(2):85-8. Wallis C
Diagnosing cystic fibrosis: blood, sweat, and tears.
Arch Dis Child. 1997 Feb;76(2):85-8., [PMID:9068292]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 Pancreatic insuYciency appears to correlate with diVerent gene mutations at the CFTR locus21 (for example R117H, R334W, R347P, P574H), but to date there has not been a satisfactory correlation between a high chloride conduction (that is a high sweat test result )22 or severe pulmonary disease and genotyping.23 The most surprising finding to emanate from the numerous phenotype-genotype correlation studies that festoon the cystic fibrosis literature, is a new understanding of the wide phenotypic range that an individual, homozygous for a mutation in the CFTR gene, can present.
X
ABCC7 p.Pro574His 9068292:29:127
status: NEW[hide] Cytoplasmic loop three of cystic fibrosis transmem... J Biol Chem. 1996 Nov 1;271(44):27493-9. Seibert FS, Linsdell P, Loo TW, Hanrahan JW, Riordan JR, Clarke DM
Cytoplasmic loop three of cystic fibrosis transmembrane conductance regulator contributes to regulation of chloride channel activity.
J Biol Chem. 1996 Nov 1;271(44):27493-9., [PMID:8910333]
Abstract [show]
To examine the contribution of the large cytoplasmic loops of the cystic fibrosis transmembrane conductance regulator (CFTR) to channel activity, the three point-mutations (S945L, H949Y, G970R) were characterized that have been detected in the third cytoplasmic loop (CL3, residues 933-990) in patients with cystic fibrosis. Chinese hamster ovary cell lines stably expressing wild-type CFTR or mutant G970R-CFTR yielded polypeptides with apparent masses of 170 kDa as the major products, whereas the major products of mutants S945L-CFTR and H949Y-CFTR had apparent masses of 150 kDa. The 150-kDa forms of CFTR were sensitive to endoglycosidase H digestion, indicating that these mutations interfered with maturation of the protein. Increased levels of mature CFTR (170 kDa) could be obtained for mutant H949Y when cells were grown at a lower temperature (26 degrees C) or incubated in the presence of 10% glycerol. For all mutants, the open probability (P0) of the CFTR channels was significantly altered. S945L-CFTR and G970R-CFTR showed a severe reduction in the P0, whereas the H949Y mutation doubled the P0 relative to wild-type. The changes in P0 predominantly resulted from an alteration of the mean burst durations which suggests that CL3 is involved in obtaining and/or maintaining stability of the open state. In addition, mutants S945L and G970R had current-voltage relationships that were not completely linear over the range +/-80 mV, but showed slight outward rectification. The fact that CL3 mutations can have subtle effects on channel conductance indicates that this region may be physically close to the inner mouth of the pore.
Comments [show]
None has been submitted yet.
No. Sentence Comment
147 A similar effect was noted previously for the CF-associated NBF1 mutation P574H.
X
ABCC7 p.Pro574His 8910333:147:74
status: NEW150 The occurrence of substantial activity for these mutants correlates well with the observation that patients affected by the P574H and H949Y mutations suffer from a less severe form of CF and are pancreatic sufficient (Kerem et al., 1990; Ghanem et al., 1994).
X
ABCC7 p.Pro574His 8910333:150:124
status: NEW[hide] Effect of cystic fibrosis-associated mutations in ... J Biol Chem. 1996 Aug 30;271(35):21279-84. Cotten JF, Ostedgaard LS, Carson MR, Welsh MJ
Effect of cystic fibrosis-associated mutations in the fourth intracellular loop of cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 1996 Aug 30;271(35):21279-84., [PMID:8702904]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) contains multiple membrane spanning sequences that form a Cl- channel pore and cytosolic domains that control the opening and closing of the channel. The fourth intracellular loop (ICL4), which connects the tenth and eleventh transmembrane spans, has a primary sequence that is highly conserved across species, is the site of a preserved sequence motif in the ABC transporter family, and contains a relatively large number of missense mutations associated with cystic fibrosis (CF). To investigate the role of ICL4 in CFTR function and to learn how CF mutations in this region disrupt function, we studied several CF-associated ICL4 mutants. We found that most ICL4 mutants disrupted the biosynthetic processing of CFTR, although not as severely as the most common DeltaF508 mutation. The mutations had no discernible effect on the channel's pore properties; but some altered gating behavior, the response to increasing concentrations of ATP, and stimulation in response to pyrophosphate. These effects on activity were similar to those observed with mutations in the nucleotide-binding domains, suggesting that ICL4 might help couple activity of the nucleotide-binding domains to gating of the Cl- channel pore. The data also explain how these mutations cause a loss of CFTR function and suggest that some patients with mutations in ICL4 may have a milder clinical phenotype because they retain partial activity of CFTR at the cell membrane.
Comments [show]
None has been submitted yet.
No. Sentence Comment
84 In Fig. 2 the processing of ⌬F508 and the milder CF-associated mutant, P574H (10), are provided for reference.
X
ABCC7 p.Pro574His 8702904:84:78
status: NEW122 Expression of wild-type, ⌬F508, P574H, and ICL4 mutants.
X
ABCC7 p.Pro574His 8702904:122:39
status: NEW222 For example, H1085R is misprocessed like ⌬F508, yet it is reported to occur in a patient with a pancreatic sufficient phenotype.
X
ABCC7 p.Pro574His 8702904:222:128
status: NEW223 Conversely, our data with the mutants R1066L, R1066H, and A1067T are similar to that obtained with the "mild" mutants A455E and P574H (10) in that they retained partial processing and function.
X
ABCC7 p.Pro574His 8702904:223:128
status: NEW83 In Fig. 2 the processing of DF508 and the milder CF-associated mutant, P574H (10), are provided for reference.
X
ABCC7 p.Pro574His 8702904:83:71
status: NEW121 Expression of wild-type, DF508, P574H, and ICL4 mutants.
X
ABCC7 p.Pro574His 8702904:121:32
status: NEW[hide] Contribution of proline residues in the membrane-s... J Biol Chem. 1996 Jun 21;271(25):14995-5001. Sheppard DN, Travis SM, Ishihara H, Welsh MJ
Contribution of proline residues in the membrane-spanning domains of cystic fibrosis transmembrane conductance regulator to chloride channel function.
J Biol Chem. 1996 Jun 21;271(25):14995-5001., [PMID:8663008]
Abstract [show]
Proline residues located in membrane-spanning domains of transport proteins are thought to play an important structural role. In the cystic fibrosis transmembrane conductance regulator (CFTR), the predicted transmembrane segments contain four prolines: Pro99, Pro205, Pro324, and Pro1021. These residues are conserved across species, and mutations of two (P99L and P205S) are associated with cystic fibrosis. To evaluate the contribution of these prolines to CFTR Cl- channel function, we mutated each residue individually to either alanine or glycine or mutated all four simultaneously to alanine (P-Quad-A). We also constructed the two cystic fibrosis-associated mutations. cAMP agonists stimulated whole cell Cl- currents in HeLa cells expressing the individual constructs that resembled those produced by wild-type CFTR. However, the amount of current was decreased in the rank order: wild-type CFTR = Pro324 > Pro1021 > Pro99 >/= Pro205 mutants. The anion selectivity sequence of the mutants (Br- >/= Cl- > I-) resembled wild-type except for P99L (Br- >/= Cl- = I-). Although the Pro99, Pro324, and Pro1021 mutants produced mature protein, the amount of mature protein was much reduced with the Pro205 mutants, and the P-Quad-A made none. Because the Pro99 constructs produced mature protein but had altered whole cell currents, we investigated their single-channel properties. Mutant channels were regulated like wild-type CFTR; however, single-channel conductance was decreased in the rank order: wild-type CFTR >/= P99G > P99L >/= P99A. These results suggest that proline residues in the transmembrane segments are important for CFTR function, Pro205 is critical for correct protein processing, and Pro99 may contribute either directly or indirectly to the Cl- channel pore.
Comments [show]
None has been submitted yet.
No. Sentence Comment
192 In this regard they are similar to the CF mutations A455E and P574H that disrupt processing but generate channels that retain significant activity (23).
X
ABCC7 p.Pro574His 8663008:192:62
status: NEW217 The mechanism of dysfunction of P205S resembles that of the nucleotide-binding domain 1 pancreatic sufficiency mutants A455E and P574H, which are misprocessed (23).
X
ABCC7 p.Pro574His 8663008:217:129
status: NEW198 In this regard they are similar to the CF mutations A455E and P574H that disrupt processing but generate channels that retain significant activity (23).
X
ABCC7 p.Pro574His 8663008:198:62
status: NEW225 The mechanism of dysfunction of P205S resembles that of the nucleotide-binding domain 1 pancreatic sufficiency mutants A455E and P574H, which are misprocessed (23).
X
ABCC7 p.Pro574His 8663008:225:129
status: NEW[hide] Chloride channels and cystic fibrosis of the pancr... Biosci Rep. 1995 Dec;15(6):531-41. Gray MA, Winpenny JP, Verdon B, McAlroy H, Argent BE
Chloride channels and cystic fibrosis of the pancreas.
Biosci Rep. 1995 Dec;15(6):531-41., [PMID:9156582]
Abstract [show]
Cystic fibrosis (CF) affects approximately 1 in 2000 people making it one of the commonest fatal, inherited diseases in the Caucasian population. CF is caused by mutations in a cyclic AMP-regulated chloride channel known as CFTR, which is found on the apical plasma membrane of many exocrine epithelial cells. In the CF pancreas, dysfunction of the CFTR reduces the secretory activity of the tubular duct cells, which leads to blockage of the ductal system and eventual fibrosis of the whole gland. One possible approach to treating the disease would be to activate an alternative chloride channel capable of bypassing defective CFTR. A strong candidate for this is a chloride channel regulated by intracellular calcium, which has recently been shown to protect the pancreas in transgenic CF mice. Pharmacological intervention directed at activating this calcium-activated Cl- conductance might provide a possible therapy to treat the problems of pancreatic dysfunction in CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
117 The second group involves residues within NBD1 (A455E and P574H) which are located close to the walker A (residues 458-464) and B (residues 568-572) motifs, crucial for ATP binding.
X
ABCC7 p.Pro574His 9156582:117:58
status: NEW121 However, these channels were fully functional with normal conductance and normal, or greater than normal, Po (P574H).
X
ABCC7 p.Pro574His 9156582:121:110
status: NEW118 The second group involves residues within NBD1 (A455E and P574H) which are located close to the walker A (residues 458-464) and B (residues 568-572) motifs, crucial for ATP binding.
X
ABCC7 p.Pro574His 9156582:118:58
status: NEW122 However, these channels were fully functional with normal conductance and normal, or greater than normal, Po (P574H).
X
ABCC7 p.Pro574His 9156582:122:110
status: NEW[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]
Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles.
X
ABCC7 p.Pro574His 7472820:43:907
status: NEW107 Electrophysiologic studies on the mild mutations A455E and P574H revealed that single-channel conductance was not different from the normal CFFR channel but that less protein reached the membrane.
X
ABCC7 p.Pro574His 7472820:107:59
status: NEW[hide] A cystic fibrosis mutation associated with mild lu... N Engl J Med. 1995 Jul 13;333(2):95-9. Gan KH, Veeze HJ, van den Ouweland AM, Halley DJ, Scheffer H, van der Hout A, Overbeek SE, de Jongste JC, Bakker W, Heijerman HG
A cystic fibrosis mutation associated with mild lung disease.
N Engl J Med. 1995 Jul 13;333(2):95-9., [PMID:7539891]
Abstract [show]
BACKGROUND: Cystic fibrosis is the most common lethal autosomal recessive disorder among whites. Among Dutch patients with cystic fibrosis, delta F508 is the most common mutation and A455E the second most common mutation of the cystic fibrosis transmembrane conductance regulator gene on chromosome 7. A455E is associated with preserved pancreatic function and residual secretion of chloride across membranes. We investigated whether it is also associated with less severe pulmonary disease in patients with cystic fibrosis. METHODS: A total of 33 patients with compound heterozygosity for the A455E mutation were matched according to age and sex with patients who were homozygous for the delta F508 mutation. The pairs were analyzed with respect to the following outcome variables: age at diagnosis, pulmonary-function values, and the frequency of pseudomonas colonization, pancreatic sufficiency, and diabetes mellitus. RESULTS: Cystic fibrosis was diagnosed at a later age in the patients with the A455E mutation than in the delta F508 homozygotes (mean age at diagnosis, 15.0 vs. 3.1 years; P < 0.001). Fewer patients with the A455E mutation had pancreatic insufficiency (21.2 percent vs. 93.9 percent, P < 0.001), and none had diabetes mellitus (0 percent vs. 27.3 percent, P = 0.004). Forced expiratory volume in one second (FEV1) and forced vital capacity (FVC) were significantly higher in the patients with the A455E mutation (mean FEV1, 73.9 percent of the predicted value vs. 54.3 percent of the predicted value; P = 0.002; mean FVC, 88.7 percent of the predicted value vs. 76.3 percent of the predicted value; P = 0.04). Fewer patients with the A455E mutation were colonized with Pseudomonas aeruginosa (33.3 percent vs. 60.6 percent, P = 0.02). CONCLUSIONS: A455E is a common mutation causing cystic fibrosis in the Netherlands. Although several mutations are known to be associated with less severe pancreatic disease, our findings demonstrate a correlation between the A455E mutation and mild pulmonary disease. Because mortality in this disease depends primarily on the progression of pulmonary disease, patients with the A455E mutation have a better prognosis than patients who are homozygous for the delta F508 mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 Since the gene for cystic fibrosis was cloned, there have been several studies on associations between the genotype and the phenotype in cystic fibrosis.5-8 A number of mutations (R117H, R334W, R347P, A455E, and P574H) appear to be associated with pancreatic sufficiency9 and residual transmembrane transport of chloride.10,11 The most common mutation, ⌬F508, is associated with pancreatic insufficiency and severe pulmonary disease.5,6 There is great variation in the severity of lung disease, but until now no mutation associated with mild pulmonary disease has been found.
X
ABCC7 p.Pro574His 7539891:29:212
status: NEW28 Since the gene for cystic fibrosis was cloned, there have been several studies on associations between the genotype and the phenotype in cystic fibrosis.5-8 A number of mutations (R117H, R334W, R347P , A455E, and P574H) appear to be associated with pancreatic sufficiency9 and residual transmembrane transport of chloride.10,11 The most common mutation, F508, is associated with pancreatic insufficiency and severe pulmonary disease.5,6 There is great variation in the severity of lung disease, but until now no mutation associated with mild pulmonary disease has been found.
X
ABCC7 p.Pro574His 7539891:28:213
status: NEW[hide] A change in gating mode leading to increased intri... EMBO J. 1995 Jun 1;14(11):2417-23. Champigny G, Imler JL, Puchelle E, Dalemans W, Gribkoff V, Hinnrasky J, Dott K, Barbry P, Pavirani A, Lazdunski M
A change in gating mode leading to increased intrinsic Cl- channel activity compensates for defective processing in a cystic fibrosis mutant corresponding to a mild form of the disease.
EMBO J. 1995 Jun 1;14(11):2417-23., [PMID:7540133]
Abstract [show]
The effects of the mild cystic fibrosis (CF) mutation P574H were analysed and compared with those of three severe ones (delta I507, delta F508 and R560T). Immunochemical and functional analyses indicate that the rank order of CFTR expression at the cell surface is: wild type CFTR > P574H >> delta F508 >> R560T approximately 0. Patch-clamp analysis indicates that the open probability of P574H Cl- channels is almost twice as high as that of the wild type CFTR-Cl- channel. This increased intrinsic activity of individual P574H CFTR-Cl- channels compensates for the lower number of P574H CFTR-Cl- channels reaching the cell surface, and probably explains the milder form of CF associated with the P574H mutation. NS004, a recently described activator, restores near normal CFTR activity in cells expressing the P574H-CFTR channel. The P574H mutation modifies the gating mode of the channel with a large increase (approximately x 7) in the mean channel open time. Proline 574 might play an important role in the process connecting ATP hydrolysis at the nucleotide binding domain and opening and closing events of the CFTR-Cl- channel.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 Immunochemical and functional analyses indicate that the rank order of CFTR expression at the cell surface is: wild type CFTR > P574H > > AF508 > > R560T - 0.
X
ABCC7 p.Pro574His 7540133:1:128
status: NEW2 Patch-clamp analysis indicates that the open probability of P574H Cl- channels is almost twice as high as that ofthe wild type CFTR-CI- channel.
X
ABCC7 p.Pro574His 7540133:2:60
status: NEW3 This increased intrinsic activity of individual P574H CFTR-Cl- channels compensates for the lower number of P574H CFTR-Cl- channels reaching the cell surface, and probably explains the milder form of CF associated with the P574H mutation.
X
ABCC7 p.Pro574His 7540133:3:48
status: NEWX
ABCC7 p.Pro574His 7540133:3:107
status: NEWX
ABCC7 p.Pro574His 7540133:3:108
status: NEW4 NS004, a recently described activator, restores near normal CFTR activity in cells expressing the P574H-CFTR channel.
X
ABCC7 p.Pro574His 7540133:4:98
status: NEW5 The P574H mutation modifies the gating mode of the channel with a large increase (.X7) in the mean channel open time.
X
ABCC7 p.Pro574His 7540133:5:4
status: NEW19 This work analyses the molecular properties of a CFTR protein expressed with a recombinant vaccinia virus, which carries the mutation P574H, previously shown to be associated with a mild form of the disease (Kristidis et al., 1992).
X
ABCC7 p.Pro574His 7540133:19:134
status: NEW22 Results Immunolocalization of P574H-CFTR and other CFTR mutant proteins Recombinant vaccinia viruses expressing wild type or mutant CFTR were constructed to study the effects of al. P 574 H AF 508 R 560 T Fig. 1.
X
ABCC7 p.Pro574His 7540133:22:30
status: NEW23 Immunodetection of wild type, AF508-, R560T- and P574H-CFTRs in Vero cells.
X
ABCC7 p.Pro574His 7540133:23:49
status: NEW24 Standard fluorescence microscopic photomicrographs (A, C, E and G) and XY and XZ confocal optical section (B, D, F and H) of Vero cells expressing wild type (A and B), P574H- (C and D), AF508- (E and F) and R560T-CFTRs (G and H).
X
ABCC7 p.Pro574His 7540133:24:168
status: NEW27 A1507, AF508, R560T and to compare them with the P574H mutation.
X
ABCC7 p.Pro574His 7540133:27:49
status: NEW34 In cells expressing P574H-CFTR, the immunolabelling was mainly intracellular, and preferentially localized in the Golgi region, although some cells also exhibited focal CFTR labelling on the plasma membrane (Figure 1C and D).
X
ABCC7 p.Pro574His 7540133:34:20
status: NEW38 Figure 2 shows the percentage of cells that were positive for membrane immunolabelling after incubation with the 80 c ._ CD 60 m 40 E c 20 0 _ Vero M Chang I -E _m7A - WT P574H AF508 R560T Fig. 2.
X
ABCC7 p.Pro574His 7540133:38:174
status: NEW39 Analysis of the cell surface expression of wild type, AF508-, R560T- and P574H-CFTRs.
X
ABCC7 p.Pro574His 7540133:39:73
status: NEW40 The number of Vero and Chang cells used for the analysis was equal to 125 and 223 for wild type CFTR, 59 and 288 for AF508, 169 and 317 for R560T, 88 and 479 for P574H respectively.
X
ABCC7 p.Pro574His 7540133:40:162
status: NEW45 The percentage of cells with positive plasma-membrane labelling was lower for P574H and AF508, but remained significantly higher than zero (20-30% for P574H and 2-6% for AF508).
X
ABCC7 p.Pro574His 7540133:45:78
status: NEWX
ABCC7 p.Pro574His 7540133:45:151
status: NEW46 No R560T-expressing cells exhibited plasma-membrane immunolabelling.
X
ABCC7 p.Pro574His 7540133:46:78
status: NEWX
ABCC7 p.Pro574His 7540133:46:151
status: NEW50 A diffuse band of 160-170 kDa corresponding to the fully glycosylated CFTR was only detected in cells infected with the recombinant virus expressing wild type CFTR, but in some experiments small amounts of 160-170 kDa glycosylated protein could be observed in cells expressing AF508 or P574H (not shown).
X
ABCC7 p.Pro574His 7540133:50:286
status: NEW52 In addition, the absence of fully glycosylated forms of CFTR in cells expressing A1507, AF508, R560T and P574H mutant proteins confirms that these mutations are associated with defective processing.
X
ABCC7 p.Pro574His 7540133:52:105
status: NEW53 Functional characterization of P574H-CFTR as compared with other CFTR mutant proteins The functional activity of CFTR mutant proteins was measured in two different experimental conditions that permit activation of the CFTR-CI- channels.
X
ABCC7 p.Pro574His 7540133:53:31
status: NEWX
ABCC7 p.Pro574His 7540133:53:105
status: NEW54 In the first 'Mock WT P574H R560TAF508 A1507 170kDam F 140kDamp _ mm ----MD Fig. 3.
X
ABCC7 p.Pro574His 7540133:54:22
status: NEWX
ABCC7 p.Pro574His 7540133:54:31
status: NEW55 Western blotting analysis of the 'mock'-infected, wild type, AF508-, R560T- and P574H-CFTRs.
X
ABCC7 p.Pro574His 7540133:55:22
status: NEWX
ABCC7 p.Pro574His 7540133:55:80
status: NEW68 Very different results were observed for P574H (Figure 4C-E).
X
ABCC7 p.Pro574His 7540133:68:41
status: NEW71 1050 Istim-Ictrl 700 (pA) 350 P574H R560T A1507 urIC) 0L It) C~ a ° Fig. 4.
X
ABCC7 p.Pro574His 7540133:71:30
status: NEW72 Functional analysis of the A1507-, R560T- and P574H-CFTRs.
X
ABCC7 p.Pro574His 7540133:72:30
status: NEWX
ABCC7 p.Pro574His 7540133:72:46
status: NEW75 (C) Time-course of the activation of the P574H-CFTR mediated 125p- efflux by 10 ,uM forskolin (O), 20 ,uM NS004 (M) and 10 jM forskolin + 20 ,uM NS004 (A).
X
ABCC7 p.Pro574His 7540133:75:41
status: NEW77 Results are shown as mean SD (D) Whole cell patch-clamp studies of wild type, A1507, AF508, R560T and P574H after stimulation by 10 jM forskolin.
X
ABCC7 p.Pro574His 7540133:77:102
status: NEW78 (E) Activation of the A1507, R560T and P574H -C1- currents (Istim) by 20 jM NS004 and/or forskolin 10 jiM.
X
ABCC7 p.Pro574His 7540133:78:39
status: NEWX
ABCC7 p.Pro574His 7540133:78:102
status: NEW81 wild type, P574H and AF508 respectively).
X
ABCC7 p.Pro574His 7540133:81:11
status: NEW84 Values of the Cl- current did not differ very significantly between P574H and the wild type proteins, suggesting that in that configuration there might be no significant difference in activity between the two different channel proteins.
X
ABCC7 p.Pro574His 7540133:84:68
status: NEW85 Figure 4E shows that NS004 can stimulate the CFTR-C1- current in P574H-CFTR expressing cells, either when used alone or in combination with forskolin.
X
ABCC7 p.Pro574His 7540133:85:65
status: NEW86 A Cl- current in R560T and A1507 expressing cells was stimulated by forskolin (Figure 4D), but its amplitude remained always very small in comparison with the Cl- current generated by the expression of wild type CFTR (2.6 and 3.7% of the wild type, for A1507 and R560T respectively), and the stimulating effect of NS004 remained modest (Figure 4E).
X
ABCC7 p.Pro574His 7540133:86:65
status: NEW87 The mutant protein P574H has a higher intrinsic Ct channel activity than wild type In order to understand why the P574H mutant protein displayed a high residual C1- channel activity, despite its defective cell-surface expression, the properties of the P574H-Cl- channel were compared with those of the wild type CFTR using the cell-attached patch-clamp technique.
X
ABCC7 p.Pro574His 7540133:87:19
status: NEWX
ABCC7 p.Pro574His 7540133:87:114
status: NEWX
ABCC7 p.Pro574His 7540133:87:252
status: NEW88 When cells expressing wild type or P574H Cl- channels were exposed to NS004, an increase in the open probability was noticed in both cases (not shown), but the comparison shown here was performed after stimulation by a 'cocktail' of forskolin (5 ,uM), 8-(4-chlorophenylthio)adenosine 3',5'-cyclic monophosphate (cpt-cAMP, 100 ,uM) and isobutylmethylxanthine (IBMX, 100 gM) and in the absence of NS004.
X
ABCC7 p.Pro574His 7540133:88:19
status: NEWX
ABCC7 p.Pro574His 7540133:88:35
status: NEWX
ABCC7 p.Pro574His 7540133:88:114
status: NEWX
ABCC7 p.Pro574His 7540133:88:251
status: NEW89 Long lasting recordings of P574H mutant CFTR and wild type CFTR show the typical difference observed between the activity of the two C1- channels (Figure 5A).
X
ABCC7 p.Pro574His 7540133:89:27
status: NEWX
ABCC7 p.Pro574His 7540133:89:35
status: NEW90 Although the unitary current amplitude was not modified by the P574H mutation (Figure 5B), the mean number of active Cl- channels was reduced by a factor of -2 (i.e. 46% of the wild type CFTR) (Figure 5C) and the open probability of the channel was increased by 59% (Figure SD).
X
ABCC7 p.Pro574His 7540133:90:27
status: NEWX
ABCC7 p.Pro574His 7540133:90:63
status: NEW91 The conductance of the P574H C1- channel is 5.1 pS, very similar if not identical to that found for the normal CFTR channel (5.3 pS) under the same conditions.
X
ABCC7 p.Pro574His 7540133:91:23
status: NEWX
ABCC7 p.Pro574His 7540133:91:63
status: NEW92 Figure 5E presents a comparative analysis of the mean open and mean closed times of P574H CFTR and normal CFTR after stimulation by the cocktail of forskolin, cpt-cAMP and IBMX.
X
ABCC7 p.Pro574His 7540133:92:23
status: NEWX
ABCC7 p.Pro574His 7540133:92:84
status: NEW93 The P574H mutation led to a large increase (a factor of 6.8) in the mean open time of the Cl- channel to a value of 10.4 s.
X
ABCC7 p.Pro574His 7540133:93:4
status: NEWX
ABCC7 p.Pro574His 7540133:93:84
status: NEW97 .-.. 2 4 time(minutes) 6 Istim-lctd (pA) I J * NS004 1OgM U ForskliO±M O NS004 + Forsk 1 E WT P574H N-4.
X
ABCC7 p.Pro574His 7540133:97:101
status: NEW98 Po-0.72 o.4pAIC _L|j C_. -C ~- - Al - - --- --- -- N-4, Po-0.6 N-8, Po.0.31 cJ/\S71q2 i(pA) 8 4How P574H A _._ E 1.___ *FfoP574H2~~ III , * I I~~~~~~~~- 0 35I~~~~I~~II' InLLLEiJ~~~~+60 mV 60 mV ,.
X
ABCC7 p.Pro574His 7540133:98:99
status: NEW99 : wr(rw o P574H (r-7) Mean open Mean doe tl -e Fig. 5.
X
ABCC7 p.Pro574His 7540133:99:10
status: NEW100 Single channel comparison between wild type and P574H mutant Cl- channels.
X
ABCC7 p.Pro574His 7540133:100:48
status: NEWX
ABCC7 p.Pro574His 7540133:100:76
status: NEW101 (A) Typical cell-attached recordings on forskolin-stimulated WT-CFTR-infected cell (left) and P574H-CFTR infected cell (right); c = closed state of the channels.
X
ABCC7 p.Pro574His 7540133:101:94
status: NEW102 (B) Mean I-V relationships for wild type and P574H mutant CFTR.
X
ABCC7 p.Pro574His 7540133:102:10
status: NEWX
ABCC7 p.Pro574His 7540133:102:45
status: NEW103 (C) Histograms showing the mean number of active CFTR-Cl- channels in wild type and P574H CFTR expressing cells.
X
ABCC7 p.Pro574His 7540133:103:48
status: NEWX
ABCC7 p.Pro574His 7540133:103:84
status: NEW104 (D) Histograms showing the mean open probability of active CFTR-Cl- channels in wild type and P574H CFTR expressing cells at ±60 mV.
X
ABCC7 p.Pro574His 7540133:104:94
status: NEW106 (E) Histograms showing the mean open and closed time for wild type and P574H Cl- channels at -60 mV.
X
ABCC7 p.Pro574His 7540133:106:71
status: NEWX
ABCC7 p.Pro574His 7540133:106:83
status: NEW109 No significant Cl- channel activity was observed in cells expressing the two mutant proteins A1507 and R560T-CFTR corresponding to severe mutations.
X
ABCC7 p.Pro574His 7540133:109:71
status: NEW117 A different situation was observed with the P574H mutation.
X
ABCC7 p.Pro574His 7540133:117:44
status: NEW119 In this case the anti-CFTR monoclonal antibody labelled the cell surface of 20-30% of P574H-CFTR expressing cells (Figures 1 and 2).
X
ABCC7 p.Pro574His 7540133:119:86
status: NEW121 This alteration in the traffic toward the cell surface of the P574H mutant protein was confirmed by functional studies.
X
ABCC7 p.Pro574His 7540133:121:62
status: NEW122 The number of active channels per patch (estimated by assuming independence between the channels present in a patch) was about half for P574H as compared with wild type (Figure 5C and D).
X
ABCC7 p.Pro574His 7540133:122:86
status: NEWX
ABCC7 p.Pro574His 7540133:122:136
status: NEW123 Immature P574H-CFTR accumulated mainly in the Golgi apparatus and in the cytoplasm, whereas diffuse labelling restricted to the cytoplasm was observed for AF508-CFTR.
X
ABCC7 p.Pro574His 7540133:123:9
status: NEW125 An interesting property of the P574H mutant protein is that it is associated with defective sorting and increased intrinsic activity of the Cl- channel (Figures 4 and 5).
X
ABCC7 p.Pro574His 7540133:125:31
status: NEWX
ABCC7 p.Pro574His 7540133:125:136
status: NEW126 This increased Cl- channel activity is not due to a change of the channel conductance (5.1 pS and 5.3 pS, for P574H- and WT-CFTR, respectively) but is associated with an increase in the time during which the channels remain open.
X
ABCC7 p.Pro574His 7540133:126:9
status: NEWX
ABCC7 p.Pro574His 7540133:126:110
status: NEW128 The open probability of the P574H-CFTR Cl- channel is nearly 60% higher than normal.
X
ABCC7 p.Pro574His 7540133:128:28
status: NEW129 An initial conclusion from these observations is that mutations associated with mild CF: (i) can lead to partial defective processing, less severe than previously observed for severe mutations, and (ii) are not necessarily associated with a decrease in intrinsic channel activity as previously reported for R 117H, R334W and R347P.
X
ABCC7 p.Pro574His 7540133:129:109
status: NEW132 A second conclusion is that the 'quality control' which prevents the trafficking of mutated CFTR-Cl- channels to the plasma membrane does not only eliminate mutants with reduced or abolished Cl- channel activity, since the intrinsic activity of the P574H mutant protein is higher than normal.
X
ABCC7 p.Pro574His 7540133:132:249
status: NEW134 2421 A E I aL The P574H mutation has been identified in compound heterozygotes where it is associated with other mutations such as AF508 (Kristidis et al., 1992).
X
ABCC7 p.Pro574His 7540133:134:20
status: NEW136 Results from 125v efflux measurements (Figure 4) indicate that the P574H- Cl- channel activity is -70% of the activity measured with wild type CFTR-expressing Vero cells (as measured by the ratios of the maximal stimulation factors).
X
ABCC7 p.Pro574His 7540133:136:67
status: NEW137 This would mean, assuming that the activity observed in Vero cells can be extrapolated to polarized epithelial cells, that residual in vivo Cl- transport activity for patients bearing P574H mutation would be at most 35% of the normal value.
X
ABCC7 p.Pro574His 7540133:137:20
status: NEWX
ABCC7 p.Pro574His 7540133:137:184
status: NEW142 The association of the P574H mutation with a mild clinical status of the disease is certainly explained by the relatively high intrinsic activity of the corresponding CFTR-C1- channel.
X
ABCC7 p.Pro574His 7540133:142:23
status: NEW150 The P574H mutation also increases the mean closed times at -60 mV but only by a factor of 2.6.
X
ABCC7 p.Pro574His 7540133:150:4
status: NEW155 The P574H mutation described in this work favours the long open state situation, and as such might become useful for further mechanistic studies of the Cl- channel activity as have been recently carried out with the normal CFTR protein (Fisher and Machen, 1994).
X
ABCC7 p.Pro574His 7540133:155:4
status: NEW164 Light fluorescence microscopy Vero and Chang cells were grown on Lab Tek chamber slides and were infected using a recombinant vaccinia virus expression system carrying either the wild type or the mutant (AF508, R560T or P574H CFTR) cDNAs under the control of the T7 promoter.
X
ABCC7 p.Pro574His 7540133:164:220
status: NEW51 A diffuse band of 160-170 kDa corresponding to the fully glycosylated CFTR was only detected in cells infected with the recombinant virus expressing wild type CFTR, but in some experiments small amounts of 160-170 kDa glycosylated protein could be observed in cells expressing AF508 or P574H (not shown).
X
ABCC7 p.Pro574His 7540133:51:286
status: NEW56 Western blotting analysis of the 'mock'-infected, wild type, AF508-, R560T- and P574H-CFTRs.
X
ABCC7 p.Pro574His 7540133:56:80
status: NEW69 Very different results were observed for P574H (Figure 4C-E).
X
ABCC7 p.Pro574His 7540133:69:41
status: NEW73 Functional analysis of the A1507-, R560T- and P574H-CFTRs.
X
ABCC7 p.Pro574His 7540133:73:46
status: NEW76 (C) Time-course of the activation of the P574H-CFTR mediated 125p- efflux by 10 ,uM forskolin (O), 20 ,uM NS004 (M) and 10 jM forskolin + 20 ,uM NS004 (A).
X
ABCC7 p.Pro574His 7540133:76:41
status: NEW79 (E) Activation of the A1507, R560T and P574H -C1- currents (Istim) by 20 jM NS004 and/or forskolin 10 jiM.
X
ABCC7 p.Pro574His 7540133:79:39
status: NEW82 wild type, P574H and AF508 respectively).
X
ABCC7 p.Pro574His 7540133:82:11
status: NEW94 The P574H mutation led to a large increase (a factor of 6.8) in the mean open time of the Cl-channel to a value of 10.4 s.
X
ABCC7 p.Pro574His 7540133:94:4
status: NEW105 (B) Mean I-V relationships for wild type and P574H mutant CFTR.
X
ABCC7 p.Pro574His 7540133:105:45
status: NEW107 (D) Histograms showing the mean open probability of active CFTR-Cl-channels in wild type and P574H CFTR expressing cells at &#b1;60 mV.
X
ABCC7 p.Pro574His 7540133:107:93
status: NEW120 A different situation was observed with the P574H mutation.
X
ABCC7 p.Pro574His 7540133:120:44
status: NEW124 This alteration in the traffic toward the cell surface of the P574H mutant protein was confirmed by functional studies.
X
ABCC7 p.Pro574His 7540133:124:62
status: NEW131 The open probability of the P574H-CFTR Cl-channel is nearly 60% higher than normal.
X
ABCC7 p.Pro574His 7540133:131:28
status: NEW135 A second conclusion is that the 'quality control' which prevents the trafficking of mutated CFTR-Cl-channels to the plasma membrane does not only eliminate mutants with reduced or abolished Cl-channel activity, since the intrinsic activity of the P574H mutant protein is higher than normal.
X
ABCC7 p.Pro574His 7540133:135:247
status: NEW139 Results from 125v efflux measurements (Figure 4) indicate that the P574H- Cl- channel activity is -70% of the activity measured with wild type CFTR-expressing Vero cells (as measured by the ratios of the maximal stimulation factors).
X
ABCC7 p.Pro574His 7540133:139:67
status: NEW140 This would mean, assuming that the activity observed in Vero cells can be extrapolated to polarized epithelial cells, that residual in vivo Cl-transport activity for patients bearing P574H mutation would be at most 35% of the normal value.
X
ABCC7 p.Pro574His 7540133:140:183
status: NEW145 The association of the P574H mutation with a mild clinical status of the disease is certainly explained by the relatively high intrinsic activity of the corresponding CFTR-C1-channel.
X
ABCC7 p.Pro574His 7540133:145:23
status: NEW153 The P574H mutation also increases the mean closed times at -60 mV but only by a factor of 2.6.
X
ABCC7 p.Pro574His 7540133:153:4
status: NEW158 The P574H mutation described in this work favours the long open state situation, and as such might become useful for further mechanistic studies of the Cl-channel activity as have been recently carried out with the normal CFTR protein (Fisher and Machen, 1994).
X
ABCC7 p.Pro574His 7540133:158:4
status: NEW167 Light fluorescence microscopy Vero and Chang cells were grown on Lab Tek chamber slides and were infected using a recombinant vaccinia virus expression system carrying either the wild type or the mutant (AF508, R560T or P574H CFTR) cDNAs under the control of the T7 promoter.
X
ABCC7 p.Pro574His 7540133:167:220
status: NEW[hide] Increased incidence of cystic fibrosis gene mutati... Hum Mol Genet. 1995 Apr;4(4):635-9. Pignatti PF, Bombieri C, Marigo C, Benetazzo M, Luisetti M
Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis.
Hum Mol Genet. 1995 Apr;4(4):635-9., [PMID:7543317]
Abstract [show]
In order to identify a possible hereditary predisposition to the development of obstructive pulmonary disease of unknown origin, we have looked for the presence of Cystic Fibrosis Transmembrane Regulator (CFTR) gene mutations in unrelated patients with no signs of Cystic Fibrosis (CF). We screened for 70 common mutations, and also for rare mutations by denaturing gradient gel electrophoresis analysis. In this search, different CFTR gene mutations (R75Q, delta F508, R1066C, M1137V and 3667ins4) were found in five out of 16 adult Italian patients with disseminated bronchiectasis, a significant increase over the expected frequency of carriers. Moreover, three rare CFTR gene DNA polymorphisms (G576A, R668C, and 2736 A-->G), not deemed to be the cause of CF, were found in two patients, one of which was a compound heterozygote with R1066C. These results indicate that CFTR gene mutations, and perhaps also DNA polymorphisms, may be involved in the etiopathogenesis of at least some cases of bronchiectasis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
31 List of CFTR gene mutations and DNA polymorphisms screened Mutations R75Q/X/L, G85E, 394deITT 457TAT->G, R117H 621 + 1G->T 711 + 5G->A L206W 875 + 40 A->G 936 del TA 1001 + 11C->T R334W, R347 P/H/L, 1154insTC A455E, V456F DF5O8 1717-IG->A, 1717-8G->A G542X, G551D, Q552X, R553X P574H 1898 + 3A->G 2183 AA->G, 2184delA, R709X D836Y, 2694 T/G 2752-22 A/G 2789 + 5 G->A, 2790-2 A-»G Q890X 3041-71 G/C 3132delTG 3271 + 18 C-»T, 3272-26 A->G H1054D, G1061R, R1066C/H, A1067T, H1085R, Y1092X, 3320 ins5 D1152H R1162X, 3667ins4, 3737delA, 11234V 3849 + 10 kb C-»T, 3850-1 G-»A SI25IN, S1255P, 3905insT, 3898insC, D127ON, W1282X, R1283M, 4002 A/G 4005 + 1 G-»A N1303 K/H, 4029 A/G D1377H Q1411 X 4404 C/T, 4521 G/A Location e 3 e 4 i 4 i 5 e 6a i 6a e 6b i 6b e 7 e 9 e 10 i 10 e 11 e 12 i 12 e 13 e 14a i 14a i 14b e 15 i 15 e 17a i 17a e 17b e 18 e 19 i 19 e 20 i 20 e2l e 22 e 23 e24 Listing is in order of location along the CFTR gene, e = exon; i = intron.
X
ABCC7 p.Pro574His 7543317:31:278
status: NEW121 Mutations R75Q/ X/L,621 + 1G->T, 1717-1G->A, P574H,2183AA->G, RI066C, andN13O3K, were examined by restriction site generating PCR as described (30).
X
ABCC7 p.Pro574His 7543317:121:45
status: NEW[hide] Mechanism of dysfunction of two nucleotide binding... EMBO J. 1995 Mar 1;14(5):876-83. Sheppard DN, Ostedgaard LS, Winter MC, Welsh MJ
Mechanism of dysfunction of two nucleotide binding domain mutations in cystic fibrosis transmembrane conductance regulator that are associated with pancreatic sufficiency.
EMBO J. 1995 Mar 1;14(5):876-83., [PMID:7534226]
Abstract [show]
Variability in the severity of cystic fibrosis (CF) is in part due to specific mutations in the CF transmembrane conductance regulator (CFTR) gene. To understand better how mutations in CFTR disrupt Cl- channel function and to learn about the relationship between genotype and phenotype, we studied two CF mutants, A455E and P574H, that are associated with pancreatic sufficiency. A455E and P574H are located close to conserved ATP binding motifs in CFTR. Both mutants generated cAMP-stimulated apical membrane Cl- currents in heterologous epithelial cells, but current magnitudes were reduced compared with wild-type. Patch-clamp analysis revealed that both mutants had normal conductive properties and regulation by phosphorylation and nucleotides. These mutants had normal or increased Cl- channel activity: A455E had an open-state probability (Po) similar to wild-type, and P574H had an increased Po because bursts of activity were prolonged. However, both mutants produced less mature glycosylated protein, although levels were greater than observed with the delta F508 mutant. These changes in channel activity and processing provide a quantitative explanation for the reduced apical Cl- current. These data also dissociate structural requirements for channel function from features that determine processing. Finally, the results suggest that the residual function associated with these two mutants is sufficient to confer a milder clinical phenotype and infer approaches to developing treatments.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 To understand better how mutations in CFTR disrupt Cl- channel function and to learn about the relationship between genotype and phenotype, we studied two CF mutants, A455E and P574H, that are associated with pancreatic sufficiency.
X
ABCC7 p.Pro574His 7534226:1:176
status: NEW2 A455E and P574H are located close to conserved ATP binding motifs in CFTR.
X
ABCC7 p.Pro574His 7534226:2:10
status: NEW5 These mutants had normal or increased Cl- channel activity: A455E had an open-state probability (PO) similar to wild-type, and P574H had an increased PO because bursts of activity were prolonged.
X
ABCC7 p.Pro574His 7534226:5:126
status: NEW27 Two such mutations are located within NBD1: A455E and P574H (Kerem et al., 1990; Kristidis et al., 1992).
X
ABCC7 p.Pro574His 7534226:27:54
status: NEW29 A455E and P574H affect residues in NBD1 that are located close to the Walker A (residues 458-464) and B (residues 568-572) motifs, respectively.
X
ABCC7 p.Pro574His 7534226:29:10
status: NEW31 Therefore, we tested the hypothesis that A455E and P574H might alter the function of CFTR Cl- channels.
X
ABCC7 p.Pro574His 7534226:31:51
status: NEW33 86 Oxford University Press Results Expression of A455E and P574H generates cAMP-activated CL currents To learn whether A455E and P574H could form regulated Cl- channels in epithelia, we expressed these mutants in cAMP~ N E ._0. -1 P574H cAMPI A455E 'cAMP 5 pA/cm2L 5 min b Fig. 1. cAMP agonists activate apical membrane CF- currents in FRT epithelia expressing A455E and P574H.
X
ABCC7 p.Pro574His 7534226:33:61
status: NEWX
ABCC7 p.Pro574His 7534226:33:62
status: NEWX
ABCC7 p.Pro574His 7534226:33:131
status: NEWX
ABCC7 p.Pro574His 7534226:33:132
status: NEW44 Figure 1 shows that A455E and P574H generated cAMP-stimulated apical Cl- currents, but AF508 did not.
X
ABCC7 p.Pro574His 7534226:44:30
status: NEW45 However, the magnitude of current generated by A455E and P574H was <20% that of wild-type CFTR in the rank order: wild-type CFTR>> P574H > A455E > AF508.
X
ABCC7 p.Pro574His 7534226:45:30
status: NEWX
ABCC7 p.Pro574His 7534226:45:57
status: NEWX
ABCC7 p.Pro574His 7534226:45:131
status: NEW46 When we expressed A455E and P574H in HeLa cells and studied them with the whole-cell patch-clamp technique, we found properties qualitatively similar to those observed with wild-type CFTR (Welsh et al., 1992; Riordan, 1993).
X
ABCC7 p.Pro574His 7534226:46:28
status: NEWX
ABCC7 p.Pro574His 7534226:46:57
status: NEWX
ABCC7 p.Pro574His 7534226:46:131
status: NEW47 Figure 2 shows data from studies of P574H; similar results were obtained with A455E (data not shown).
X
ABCC7 p.Pro574His 7534226:47:28
status: NEWX
ABCC7 p.Pro574His 7534226:47:36
status: NEW51 In contrast, when P574H was expressed using the same conditions, cAMP agonists stimulated current in only five out of 12 cells, IP Cl [CI]E 7 ; - 25~O20 h / -200 Fig. 2.
X
ABCC7 p.Pro574His 7534226:51:18
status: NEW52 Whole-cell properties of P574H.
X
ABCC7 p.Pro574His 7534226:52:18
status: NEWX
ABCC7 p.Pro574His 7534226:52:25
status: NEW66 CFTR 0 * I1 -50 * CFTR A A455E * P574H pA Fig. 3.
X
ABCC7 p.Pro574His 7534226:66:33
status: NEW67 Single-channel properties of A455E and P574H.
X
ABCC7 p.Pro574His 7534226:67:33
status: NEWX
ABCC7 p.Pro574His 7534226:67:39
status: NEW68 (A) Representative single-channel recordings are from excised inside-out membrane patches from HeLa cells transiently expressing wild-type CFTR, A455E or P574H.
X
ABCC7 p.Pro574His 7534226:68:39
status: NEWX
ABCC7 p.Pro574His 7534226:68:154
status: NEW72 The voltages were -45 (CFTR), -46 (A455E) or -47 mV (P574H).
X
ABCC7 p.Pro574His 7534226:72:53
status: NEW73 (B) Single-channel I-V relationships of CFTR (U), A455E (A) and P574H (A).
X
ABCC7 p.Pro574His 7534226:73:53
status: NEWX
ABCC7 p.Pro574His 7534226:73:64
status: NEW76 Conductance was CFT'R 7.76 ± 0.14, A455E 7.40 ± 0.25 and P574H 7.84 ± 0.26 pS; n = 6.
X
ABCC7 p.Pro574His 7534226:76:67
status: NEW81 Single-channel properties of A455E and P574H To determine why A455E and P574H generated less macroscopic Cl- current, we examined their single-channel properties in excised, inside-out patches of membrane.
X
ABCC7 p.Pro574His 7534226:81:39
status: NEWX
ABCC7 p.Pro574His 7534226:81:72
status: NEW83 The tracings show that the single-channel current amplitudes of A455E and P574H were similar to that of wild-type CFTR.
X
ABCC7 p.Pro574His 7534226:83:74
status: NEW88 However, P574H showed a different pattern of activity.
X
ABCC7 p.Pro574His 7534226:88:9
status: NEW92 Figure 3C shows that the PO of A455E was similar to that of wild-type CFTR, whereas the PO of P574H was increased significantly.
X
ABCC7 p.Pro574His 7534226:92:94
status: NEW95 We focused primarily on P574H to determine why the P0 of this mutant was greater than that of wild-type CFTR.
X
ABCC7 p.Pro574His 7534226:95:24
status: NEW96 Maximum likelihood A 0.5pA 2s 50OC mV 0.6 PO 0.4 0.2- -0.1 - -1.2 0.0 J- - -0.4 A B pi (/S) al (f/S) pi 02I -- C2 _ ° a1 a2 12 CFTR A455E P574H CFTR A455E P574H Fig. 4.
X
ABCC7 p.Pro574His 7534226:96:24
status: NEWX
ABCC7 p.Pro574His 7534226:96:145
status: NEWX
ABCC7 p.Pro574His 7534226:96:162
status: NEW97 Effect of A455E and P574H on single-channel kinetics.
X
ABCC7 p.Pro574His 7534226:97:20
status: NEWX
ABCC7 p.Pro574His 7534226:97:146
status: NEWX
ABCC7 p.Pro574His 7534226:97:163
status: NEW100 (B) Effect of A455E and P574H on rate constants determined by the maximum likelihood fit to the model in (A).
X
ABCC7 p.Pro574His 7534226:100:24
status: NEW101 Data are from four CFTR, two A455E and six P574H single-channel patches.
X
ABCC7 p.Pro574His 7534226:101:24
status: NEWX
ABCC7 p.Pro574His 7534226:101:43
status: NEW103 The voltages were -50 ± 2 (CFTR), -48 ± I (P574H) and -47 ± 1 mV (A455E).
X
ABCC7 p.Pro574His 7534226:103:53
status: NEW110 The effect of P574H on the rate constants is summarized in Figure 4B.
X
ABCC7 p.Pro574His 7534226:110:14
status: NEW111 The major effect of the P574H mutation was to decrease PI and al to -40% of wild-type values.
X
ABCC7 p.Pro574His 7534226:111:14
status: NEWX
ABCC7 p.Pro574His 7534226:111:24
status: NEW118 All of the changes in rate constants produced by P574H tend to increase Tb.
X
ABCC7 p.Pro574His 7534226:118:49
status: NEW119 The increase in burst duration is responsible for the increase in PO (Figure 3C), but it is partially offset by the decreased frequency with which P574H channels move into the bursting state (i.e. the decreased I31).
X
ABCC7 p.Pro574His 7534226:119:49
status: NEWX
ABCC7 p.Pro574His 7534226:119:147
status: NEW120 In two experiments we examined the gating kinetics of single phosphorylated A455E Cl- channels.
X
ABCC7 p.Pro574His 7534226:120:147
status: NEW124 Regulation of A455E and P574H by intracellular nucleotides Intracellular MgATP regulates CFTR through interactions with the NBDs.
X
ABCC7 p.Pro574His 7534226:124:24
status: NEW127 Therefore, we tested the hypothesis that ATP-dependent regulation of A455E and P574H was altered.
X
ABCC7 p.Pro574His 7534226:127:79
status: NEW129 At each concentration of MgATP tested, A455E had PO values similar to those of wild-type CFTR, whereas P574H had higher values of PO.
X
ABCC7 p.Pro574His 7534226:129:103
status: NEW131 Figure 5B shows that ADP (1 mM) produced an equivalent inhibition of wild-type CFTR, A455E and P574H.
X
ABCC7 p.Pro574His 7534226:131:95
status: NEW133 Analysis of the processing of A455E and P574H The data indicate that the reduced apical membrane Cl- current produced by A455E and P574H cannot be attributed to the reduced function of single mutant channels.
X
ABCC7 p.Pro574His 7534226:133:40
status: NEWX
ABCC7 p.Pro574His 7534226:133:131
status: NEW139 However, band C production was reduced in A455E and P574H and was not apparent until 12-24 h after infection, and only then as a faint A B CFTR A455E P574H MgATP (mM) Fig. 5.
X
ABCC7 p.Pro574His 7534226:139:52
status: NEWX
ABCC7 p.Pro574His 7534226:139:152
status: NEW140 Effects of MgATP concentration and ADP on the activity of phosphorylated A455E and P574H channels.
X
ABCC7 p.Pro574His 7534226:140:52
status: NEWX
ABCC7 p.Pro574His 7534226:140:83
status: NEWX
ABCC7 p.Pro574His 7534226:140:152
status: NEW142 and intracellular MgATP concentration for A455E, P574H and wild-type CFTR Cl- channels.
X
ABCC7 p.Pro574His 7534226:142:49
status: NEWX
ABCC7 p.Pro574His 7534226:142:77
status: NEW143 Data points are the mean ± SEM of n = 4-6 for CFTR (-), n = 5 for A455E (A) and n = 3-5 for P574H (0) at each concentration.
X
ABCC7 p.Pro574His 7534226:143:96
status: NEW144 The voltages were -86 ± 1 (CFTR), -49 ± 2 (A455E) and -49 ± 1 mV (P574H).
X
ABCC7 p.Pro574His 7534226:144:78
status: NEW147 (B) Effect of intracellular ADP on the activities of CFTR, A455E and P574H Cl- channels.
X
ABCC7 p.Pro574His 7534226:147:69
status: NEW149 Values are the mean ± SEM of n = 4 for CFTR, A455E and P574H; the voltages were -49 ± 1 (CFTR), -48 ± 2 (A455E) and -52 ± 1 mV (P574H).
X
ABCC7 p.Pro574His 7534226:149:59
status: NEWX
ABCC7 p.Pro574His 7534226:149:60
status: NEW150 Percent inhibition of NXP0 by 1 mM ADP was CFTR 77 ± 3, A455E 70 ± 3 and P574H 75 ± 6%.
X
ABCC7 p.Pro574His 7534226:150:81
status: NEW156 Although the production of mature band C protein was greatly reduced in A455E and P574H, it was greater than that observed with AF508.
X
ABCC7 p.Pro574His 7534226:156:82
status: NEW157 Discussion Relationship between apical membrane CL currents and the properties of mutant CFTR Because the A455E and P574H mutations cause CF, we hypothesized that Cl- transport would be reduced in cells expressing these mutants.
X
ABCC7 p.Pro574His 7534226:157:116
status: NEW161 If we set each of these variables to 100% for wild-type CFTR, we can then compare the apical Cl- current generated by wild-type and AF508 CFTR with that produced by A455E and P574H. Table I presents values of each variable, the predicted value of fCI(apical) determined by calculating N x i X P0 and the observed value of fCI(apical).
X
ABCC7 p.Pro574His 7534226:161:174
status: NEW164 Thus, these data provide a molecular explanation for the quantitative decrease in cAMP-stimulated apical membrane Cl- current generated by A455E and P574H. Table I.
X
ABCC7 p.Pro574His 7534226:164:148
status: NEW165 Comparison of predicted apical membrane Cl- current, N X i X PO, and measured cAMP-stimulated apical membrane Cl- current, f'(apical), for wild-type and mutant CFTR N i PO N X i X PO fl'(apical) (%) (%) (%) (%) (%) Wild-type 100 100 100 100 100 AF508 4 100 38 1.6 0 A455E 11 100 93 10.5 8 P574H 15 100 139 21.1 17 N, the number of Cl- channels in the apical membrane; i, single-channel current; PO- open-state probability.
X
ABCC7 p.Pro574His 7534226:165:287
status: NEW171 Mechanism of altered gating by A455E and P574H A455 and P574 lie near the conserved Walker A and B motifs of NBD1.
X
ABCC7 p.Pro574His 7534226:171:41
status: NEW174 P574H decreased 01, a rate constant that is also controlled by ATP and which describes the transition to the bursting state.
X
ABCC7 p.Pro574His 7534226:174:0
status: NEW175 Because of the proximity of P574 to D572 (the Walker B aspartate of NBD1), we speculate that P574H alters the interaction of NBD1 with MgATP, and/ or the consequences thereof, and hence slows the rate of channel opening.
X
ABCC7 p.Pro574His 7534226:175:93
status: NEW176 P574H also altered al.
X
ABCC7 p.Pro574His 7534226:176:0
status: NEW177 It is interesting to compare the effect that different mutations in NBD1 had on al: P574H decreased a1, A455E did not change al, and K464A (a mutant of the Walker A lysine of NBDl; Carson and Welsh, 1995) appeared to increase the rate of channel closing.
X
ABCC7 p.Pro574His 7534226:177:84
status: NEW181 Expression of wild-type CFTR, AF508, A455E and P574H.
X
ABCC7 p.Pro574His 7534226:181:47
status: NEW187 The radioactivity in gels of immunoprecipitated and phosphorylated wild-type CFTR, AF508, A455E and P574H was quantitated as described in Materials and methods.
X
ABCC7 p.Pro574His 7534226:187:100
status: NEW188 The values are the mean + SEM of n = 3 for CFTR, AF508, A455E and P574H.
X
ABCC7 p.Pro574His 7534226:188:66
status: NEW189 understand how CFTR is regulated by the NBDs and to learn how P574H alters this function.
X
ABCC7 p.Pro574His 7534226:189:62
status: NEW192 Our data from A455E, plus the finding that P574H altered P2, suggest that the NBDs may also be involved in regulating gating within a burst.
X
ABCC7 p.Pro574His 7534226:192:43
status: NEW194 Cellular processing ofA455E and P574H An important mechanism of dysfunction of CFTR containing CF-associated mutations is misprocessing, so that the mutant protein fails to leave the endoplasmic reticulum and traffic to the Golgi complex and then on to the cell surface (Cheng et al., 1990).
X
ABCC7 p.Pro574His 7534226:194:32
status: NEW198 Our data indicate that processing mutations are not necessarily an all-or-none defect; in contrast to AF508, some of the mutant A455E and P574H protein had a glycosylation pattern consistent with processing in the Golgi complex and generated cAMP-stimulated apical Cl- currents.
X
ABCC7 p.Pro574His 7534226:198:138
status: NEW199 We evaluated the processing of A455E and P574H in HeLa and FRT cells incubated at 37°C.
X
ABCC7 p.Pro574His 7534226:199:41
status: NEW204 More strikingly, P574H, which was also misprocessed, formed a channel that was even more active than wild-type.
X
ABCC7 p.Pro574His 7534226:204:17
status: NEW209 Implications for cystic fibrosis These data suggest that the mutations A455E and P574H cause CF because they disrupt the processing of CFTR and its delivery to the cell surface.
X
ABCC7 p.Pro574His 7534226:209:81
status: NEW210 However, they also suggest that these mutations are associated with a milder (PS) clinical phenotype because a small amount of the 881 CFTR A kDa 210 - 170- 116 - 98 - AF508 N. A455E I I P574H 4- Band C 4- Band B B band C bands A+B P574H aL mutant protein is processed correctly, retains normal or greater than normal Cl- channel function and thus generates residual cAMP-stimulated apical membrane C1- cur- rents.
X
ABCC7 p.Pro574His 7534226:210:187
status: NEWX
ABCC7 p.Pro574His 7534226:210:232
status: NEW220 These values are in the same range as those found for A455E (8%) and P574H (17%).
X
ABCC7 p.Pro574His 7534226:220:69
status: NEW223 A455E or P574H could prove to be of value in the development of therapies designed to augment the delivery to and the retention of mutant protein at the plasma membrane (Cheng et al., 1990; Lukacs et al., 1993).
X
ABCC7 p.Pro574His 7534226:223:9
status: NEW224 Although AF508 could be used to assess the processing defect, A455E or P574H might prove to be more tractable models for evaluating strategies to correct mislocalization because the processing defect is only partial and the conductance and regulation of the Cl- channels is more nearly normal.
X
ABCC7 p.Pro574His 7534226:224:71
status: NEW226 Such strategies might also be applied to patients bearing the A455E and P574H mutations because they appear to have at least some functional protein present in the plasma membrane.
X
ABCC7 p.Pro574His 7534226:226:72
status: NEW34 -1 P574H cAMPI A455E 'cAMP 5 pA/cm2L 5 min b Fig. 1. cAMP agonists activate apical membrane CF- currents in FRT epithelia expressing A455E and P574H.
X
ABCC7 p.Pro574His 7534226:34:3
status: NEWX
ABCC7 p.Pro574His 7534226:34:143
status: NEW48 Figure 2 shows data from studies of P574H; similar results were obtained with A455E (data not shown).
X
ABCC7 p.Pro574His 7534226:48:36
status: NEW53 Whole-cell properties of P574H.
X
ABCC7 p.Pro574His 7534226:53:25
status: NEW69 (A) Representative single-channel recordings are from excised inside-out membrane patches from HeLa cells transiently expressing wild-type CFTR, A455E or P574H.
X
ABCC7 p.Pro574His 7534226:69:154
status: NEW74 (B) Single-channel I-V relationships of CFTR (U), A455E (A) and P574H (A).
X
ABCC7 p.Pro574His 7534226:74:64
status: NEW77 Conductance was CFT'R 7.76 &#b1; 0.14, A455E 7.40 &#b1; 0.25 and P574H 7.84 &#b1; 0.26 pS; n = 6.
X
ABCC7 p.Pro574His 7534226:77:65
status: NEW82 Single-channel properties of A455E and P574H To determine why A455E and P574H generated less macroscopic Cl-current, we examined their single-channel properties in excised, inside-out patches of membrane.
X
ABCC7 p.Pro574His 7534226:82:39
status: NEWX
ABCC7 p.Pro574His 7534226:82:72
status: NEW84 The tracings show that the single-channel current amplitudes of A455E and P574H were similar to that of wild-type CFTR.
X
ABCC7 p.Pro574His 7534226:84:74
status: NEW89 However, P574H showed a different pattern of activity.
X
ABCC7 p.Pro574His 7534226:89:9
status: NEW93 Figure 3C shows that the PO of A455E was similar to that of wild-type CFTR, whereas the PO of P574H was increased significantly.
X
ABCC7 p.Pro574His 7534226:93:94
status: NEW98 Effect of A455E and P574H on single-channel kinetics.
X
ABCC7 p.Pro574His 7534226:98:20
status: NEW102 Data are from four CFTR, two A455E and six P574H single-channel patches.
X
ABCC7 p.Pro574His 7534226:102:43
status: NEW104 The voltages were -50 &#b1; 2 (CFTR), -48 &#b1; I (P574H) and -47 &#b1; 1 mV (A455E).
X
ABCC7 p.Pro574His 7534226:104:51
status: NEW112 The major effect of the P574H mutation was to decrease PI and al to -40% of wild-type values.
X
ABCC7 p.Pro574His 7534226:112:24
status: NEW125 Regulation of A455E and P574H by intracellular nucleotides Intracellular MgATP regulates CFTR through interactions with the NBDs.
X
ABCC7 p.Pro574His 7534226:125:24
status: NEW128 Therefore, we tested the hypothesis that ATP-dependent regulation of A455E and P574H was altered.
X
ABCC7 p.Pro574His 7534226:128:79
status: NEW130 At each concentration of MgATP tested, A455E had PO values similar to those of wild-type CFTR, whereas P574H had higher values of PO.
X
ABCC7 p.Pro574His 7534226:130:103
status: NEW132 Figure 5B shows that ADP (1 mM) produced an equivalent inhibition of wild-type CFTR, A455E and P574H.
X
ABCC7 p.Pro574His 7534226:132:95
status: NEW134 Analysis of the processing of A455E and P574H The data indicate that the reduced apical membrane Cl-current produced by A455E and P574H cannot be attributed to the reduced function of single mutant channels.
X
ABCC7 p.Pro574His 7534226:134:40
status: NEWX
ABCC7 p.Pro574His 7534226:134:130
status: NEW141 Effects of MgATP concentration and ADP on the activity of phosphorylated A455E and P574H channels.
X
ABCC7 p.Pro574His 7534226:141:83
status: NEW[hide] Cystic fibrosis: genotypic and phenotypic variatio... Annu Rev Genet. 1995;29:777-807. Zielenski J, Tsui LC
Cystic fibrosis: genotypic and phenotypic variations.
Annu Rev Genet. 1995;29:777-807., [PMID:8825494]
Abstract [show]
Cystic fibrosis (CF) is a common genetic disorder in the Caucasian population. The gene was identified in 1989 on the basis of its map location on chromosome 7. The encoded gene product, named cystic fibrosis transmembrane conductance regulator (CFTR), corresponds to a cAMP-regulated chloride channel found almost exclusively in the secretory epithelial cells. Although the major mutation that results in a single amino acid deletion (F508) accounts for 70% of the disease alleles, more than 550 additional mutant alleles of different forms have been detected. Many of these mutations can be divided into five general classes in terms of their demonstrated or presumed molecular consequences. In addition, a good correlation has been found between CFTR genotype and one of the clinical variables--pancreatic function status. An unexpected finding, however, is the documentation of CFTR mutations in patients with atypical CF disease presentations, including congenital absence of vas deferens and several pulmonary diseases. Thus, the implication of CFTR mutation is more profound than CF alone.
Comments [show]
None has been submitted yet.
No. Sentence Comment
644 Several missense mutations (e.g. P574H and A455E) are reasoned to have mild molecular consequence because they are found associated with pancreatic sufficiency-a mild phenotype (lOS).
X
ABCC7 p.Pro574His 8825494:644:33
status: NEW[hide] Association of pancreatic adenocarcinoma, mild lun... Clin Chem. 1994 Oct;40(10):1972-4. Tsongalis GJ, Faber G, Dalldorf FG, Friedman KJ, Silverman LM, Yankaskas JR
Association of pancreatic adenocarcinoma, mild lung disease, and delta F508 mutation in a cystic fibrosis patient.
Clin Chem. 1994 Oct;40(10):1972-4., [PMID:7522998]
Abstract [show]
A case of adenocarcinoma of the pancreas and mild lung disease in a 39-year-old man homozygous for the delta F508 cystic fibrosis mutation is presented. Cystic fibrosis is the most common lethal genetic disease in Caucasians, and is most commonly associated with severe obstructive lung disease. To our knowledge, this is only the fifth case of adenocarcinoma of the pancreas in a CF patient to be reported and the first case for which molecular data are available. The rare incidence of this type of malignancy in the general population suggests a possible association of CF with this malignant disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 CorrelatIon of phenotype and genotype of CFTR mutations Key phenotypic Lung disease SweatC1 Exocnne pancreas function Vasdeferens Associated CFTR mutations Pancreatic InsuffIcIent Pancreatic sufficient Normalsweat C1 Severe Less severe Relatively mild Elevated Elevated Normal Insufficient Sufficient Sufficient Absent Absent Absent SF508, G542X, R553X, G5510, Ni 303K, Wi 282X, RI 17H, and others 2789 + 5G>A, R117H, R334W, R347P, A455E, P574H, S945L, G85E, and others G551S, R117H, 3849 + 10kb C>T, and others Congenitalabsence of the vas deferens None Normal or elevated Sufficient Absent F508C, Ri 17H, Di D1152H, and others FIg. 2.
X
ABCC7 p.Pro574His 7522998:44:439
status: NEW[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population.
X
ABCC7 p.Pro574His 7525963:21:357
status: NEW[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]
Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.
Comments [show]
None has been submitted yet.
No. Sentence Comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.).
X
ABCC7 p.Pro574His 7521710:121:501
status: NEW[hide] A novel mutation in exon 3 of the CFTR gene. Hum Genet. 1993 Apr;91(3):233-5. Guillermit H, Jehanne M, Quere I, Audrezet MP, Mercier B, Ferec C
A novel mutation in exon 3 of the CFTR gene.
Hum Genet. 1993 Apr;91(3):233-5., [PMID:7682984]
Abstract [show]
We have screened the 27 exons of the cystic fibrosis transmembrane conductance regulator gene in 87 non-delta F508 chromosomes of Breton origin using the combined techniques of denaturing gradient gel electrophoresis and direct sequencing. By this process, we have detected a new missense mutation, G91R, which results in an arginine for glycine at codon 91. Three affected patients with a delta F508/G91R genotype are pancreatic sufficient. Such observations could facilitate a better understanding of the functional importance of different regions of the encoded product and of the pathogenesis of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 Other missense mutations reported by Kristidis et al. (1991) as being located in the transmembrane domain, i.e. R117H (exon 4), R334W (exon 7), R347P (exon 7), A455E (exon 9) and P574H (exon 12), are associated with pancreatic sufficiency; these observations are consistent with the genetic hypothesis that pancreatic sufficiency is a 235 dominant phenotypic trait associated with about 10% of the CF alleles.
X
ABCC7 p.Pro574His 7682984:63:179
status: NEW[hide] Genetic determinants of airways' colonisation with... Lancet. 1993 Jan 23;341(8839):189-93. Kubesch P, Dork T, Wulbrand U, Kalin N, Neumann T, Wulf B, Geerlings H, Weissbrodt H, von der Hardt H, Tummler B
Genetic determinants of airways' colonisation with Pseudomonas aeruginosa in cystic fibrosis.
Lancet. 1993 Jan 23;341(8839):189-93., [PMID:7678316]
Abstract [show]
Exocrine pancreatic insufficiency and lung infection with Pseudomonas aeruginosa are major features of cystic fibrosis (CF). This monogenic disease is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. 267 children and adolescents with CF who were regularly seen at the same centre were assessed for an association of the CFTR mutation genotype with exocrine pancreatic function and the age of onset of chronic colonisation with P aeruginosa. The major mutation delta F508 accounted for 74% of CF alleles; 33 further CFTR mutations had been detected on the CF chromosomes of the study population by June, 1992. With the exception of delta F508/R347P compound heterozygotes, patients of the same mutation genotype were either pancreas insufficient (PI) or pancreas sufficient (PS). The age-specific colonisation rates with P aeruginosa were significantly lower in PS than in PI patients. The missense and splice site mutations that are "mild" CF alleles with respect to exocrine pancreatic function were also "low risk" alleles for the acquisition of P aeruginosa. On the other hand, the proportion of P aeruginosa-positive patients increased most rapidly in the PI delta F508 compound heterozygotes who were carrying a termination mutation in the nucleotide binding fold-encoding exons. Pancreatic status and the risk of chronic airways' colonisation with P aeruginosa are predisposed by the CFTR mutation genotype and can be differentiated by the type and location of the mutations in the CFTR gene.
Comments [show]
None has been submitted yet.
No. Sentence Comment
71 The NBF gene mutations in the study population were all severe disease alleles with respect to pancreatic function, and none of the rare PS alleles G551S, Y563N, P574H was detected.4,25 Hence, our findings do not necessarily imply that a NBF mutation should a priori be considered a "high risk" allele but rather that the more common "severe" disease alleles cluster in the NBF.
X
ABCC7 p.Pro574His 7678316:71:162
status: NEW[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]
Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
122 This hypothesis has been well supported by analysis of patients, which shows that individuals with one or two copies of the missense alleles such as Rll7H, R334W, R347P, A455E (Ref. 12) or P574H (Ref. 12) are found to be PS, whereas those with two copies of nonsense, frameshift, splice-site or a subset of the missense mutations are invariably PI TIGNOVEMBER1992 VOt.
X
ABCC7 p.Pro574His 1279852:122:189
status: NEW[hide] Genetic determination of exocrine pancreatic funct... Am J Hum Genet. 1992 Jun;50(6):1178-84. Kristidis P, Bozon D, Corey M, Markiewicz D, Rommens J, Tsui LC, Durie P
Genetic determination of exocrine pancreatic function in cystic fibrosis.
Am J Hum Genet. 1992 Jun;50(6):1178-84., [PMID:1376016]
Abstract [show]
We showed elsewhere that the pancreatic function status of cystic fibrosis (CF) patients could be correlated to mutations in the CF transmembrane conductance regulator (CFTR) gene. Although the majority of CF mutations--including the most common, delta F508--strongly correlated with pancreatic insufficiency (PI), approximately 10% of the mutant alleles may confer pancreatic sufficiency (PS). To extend this observation, genomic DNA of 538 CF patients with well-documented pancreatic function status were analyzed for a series of known mutations in their CFTR genes. Only 20 of the 25 mutations tested were found in this population. They accounted for 84% of the CF chromosomes, with delta F508 being the most frequent (71%), and the other mutations accounted for less than 5% each. A total of 30 different, complete genotypes could be determined in 394 (73%) of the patients. The data showed that each genotype was associated only with PI or only with PS, but not with both. This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as delta F508, delta I507, Q493X, G542X, R553X, W1282X, 621 + 1G----T, 1717-1G----A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.
Comments [show]
None has been submitted yet.
No. Sentence Comment
10 This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as AF508, A1507, Q493X, G542X, R553X, W1282X, 621 + 1G-PT, 1717-1G--'A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.
X
ABCC7 p.Pro574His 1376016:10:240
status: NEW58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both.
X
ABCC7 p.Pro574His 1376016:58:143
status: NEWX
ABCC7 p.Pro574His 1376016:58:756
status: NEW66 As shown in table 3, meconium ileus Table 2 1181 Table 3 Frequency of 25 CF Mutations in Chromosomes of the Toronto Study Population Mutation AF508 ...... G551D...... G542X...... 621 +1G-'T N1303K..... W1282X..... R1 17H...... 1717-1G-~A R560T...... A1507 ...... R553X...... V52OF ...... R334W ..... A455E...... I148T ...... Q493X...... P574H...... R347P ...... SS6delA ..... 3659delC .... G480C...... 444delA ..... D110H...... G458V...... S549R ...... Y563N......
X
ABCC7 p.Pro574His 1376016:66:339
status: NEW73 Complete CF Genotypes for 394 Patients No. OF PATIENTS GENOTYPE WITH Allele 1 Allele 2 pla P AF508 ...... AF508 277 (49) 2 G551D 21 (1) 0 G542X 18 (9)c 0 621+1G-~T 11 (1) 0 AI507 7 (1) 0 N1303K 6 (1) 0 R560T 5 0 1717-lG-A 5 (1) 0 556delA 3 0 Q493X 3 0 R553X 3 (1) 0 W1282X 3 0 3659delC 2 0 1148T 1 0 R117H 0 9 A445E 0 2 P574H 0 2 R347P 0 1 G551D ..... 1717-lG-~A 2 0 621+1G-~T 1 0 G480C 1 0 G551D 1 0 V520F 1 (1) 0 G542X ..... V520F 1 0 1148T ...... W1282X 1 (1) 0 W1282X .... W1282X 1 0 N1303K .... R553X 1 (1) 0 R117H ..... R117H 0 1 G542X 0 1 R334W ..... R334W 0 1 a1 Numbers in parentheses are number of patients with neonatal meconium ileus.
X
ABCC7 p.Pro574His 1376016:73:320
status: NEW81 Table 4 Classification of CF Gene Mutations as Severe or Mild with Respect to Pancreatic Function Type of Mutation Severe (location) Mild (location) Missense (point mutation) ...... 1148T (exon 4) R117H (exon 4) G480C (exon 9) R334W (exon 7) VS2OF (exon 10) GSS1D (exon 11) R347P (exon 7) RS60T (exon 11) A455E (exon 9) N1303K (exon 21) P574H (exon 12) Single amino acid deletion ........ AFS08 (exon 10) A1507 (exon 10) Stop codon (nonsense) ..... Q493X (exon 10) G542X (exon 11) R553X (exon 11) W1282X (exon 20) Splice junction ... 621 + 1G-T (intron 4) 1717-1G-T (intron 10) Frameshift ........ 556delA (exon 4) 3659delC (exon 19) with any of the mild mutations was associated with PS.
X
ABCC7 p.Pro574His 1376016:81:337
status: NEW85 Accordingly, the mutations R117H, R334W, R347P, A455E, and P574H may be regarded as mild, whereas AF508, AI507, Q493X, G542X, R553X, W1282X, 621 + 1G-T, 1717-1G--A, 556delA, 3659delC, 1148T, G480C, V520F, GSS1D, and R560T are severe.
X
ABCC7 p.Pro574His 1376016:85:59
status: NEW[hide] Simultaneous screening for 11 mutations in the cys... Mol Cell Probes. 1992 Feb;6(1):33-9. Cuppens H, Buyse I, Baens M, Marynen P, Cassiman JJ
Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot.
Mol Cell Probes. 1992 Feb;6(1):33-9., [PMID:1372093]
Abstract [show]
An assay is described in which 11 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can be screened simultaneously. Six different exons of the CFTR gene are amplified in a single multiplex amplification. Biotinylated dUTP is incorporated into the different fragments during the amplification process. A sample of this mixture is then hybridized to 21 different poly-dT tailed oligonucleotide probes which are bound to a nylon membrane. In order to screen the different mutations in a single step hybridization, the length of the different oligonucleotides and the amount used in the assay were optimized. The detection is performed by binding avidin-alkaline phosphatase to the biotin, followed by a chemiluminescent reaction. By means of this fast and sensitive assay, about 85% of all the cystic fibrosis mutations in the Belgian population can be detected.
Comments [show]
None has been submitted yet.
No. Sentence Comment
19 Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population .
X
ABCC7 p.Pro574His 1372093:19:187
status: NEW[hide] The cystic fibrosis transmembrane conductance regu... J Cyst Fibros. 2002 Mar;1(1):13-29. Vankeerberghen A, Cuppens H, Cassiman JJ
The cystic fibrosis transmembrane conductance regulator: an intriguing protein with pleiotropic functions.
J Cyst Fibros. 2002 Mar;1(1):13-29., [PMID:15463806]
Abstract [show]
Cystic fibrosis is a frequent autosomal recessive disorder that is caused by the malfunctioning of a small chloride channel, the cystic fibrosis transmembrane conductance regulator. The protein is found in the apical membrane of epithelial cells lining exocrine glands. Absence of this channel results in imbalance of ion concentrations across the cell membrane. As a result, fluids secreted through these glands become more viscous and, in the end, ducts become plugged and atrophic. Little is known about the pathways that link the malfunctioning of the CFTR protein with the observed clinical phenotype. Moreover, there is no strict correlation between specific CFTR mutations and the CF phenotype. This might be explained by the fact that environmental and additional genetic factors may influence the phenotype. The CFTR protein itself is regulated at the maturational level by chaperones and SNARE proteins and at the functional level by several protein kinases. Moreover, CFTR functions also as a regulator of other ion channels and of intracellular membrane transport processes. In order to be able to function as a protein with pleiotropic actions, CFTR seems to be linked with other proteins and with the cytoskeleton through interaction with PDZ-domain-containing proteins at the apical pole of the cell. Progress in cystic fibrosis research is substantial, but still leaves many questions unanswered.
Comments [show]
None has been submitted yet.
No. Sentence Comment
390 Mutations that cause a small defect in maturation but normal or increased chloride transport activity, like A455E and P574H tend to be classified in this fifth class of mutations w162x.
X
ABCC7 p.Pro574His 15463806:390:118
status: NEW[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT.
X
ABCC7 p.Pro574His 16963320:78:239
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... Drugs. 2010 Feb 12;70(3):241-59. doi: 10.2165/11316160-000000000-00000. Becq F
Cystic fibrosis transmembrane conductance regulator modulators for personalized drug treatment of cystic fibrosis: progress to date.
Drugs. 2010 Feb 12;70(3):241-59. doi: 10.2165/11316160-000000000-00000., [PMID:20166764]
Abstract [show]
This article considers the issue of personalized drug discovery for the orphan disease cystic fibrosis (CF) to deliver a candidate for therapeutic development. CF is a very complicated disease due to numerous anomalies of the gene leading to progressive severity and morbidity. Despite extensive research efforts, 20 years after the cloning of the CF gene, CF patients are still waiting for a curative treatment as prescribed medications still target the secondary manifestations of the disease rather than the gene or the CF transmembrane conductance regulator (CFTR) protein. New therapeutics aimed at improving mutant CFTR functions, also known as 'protein repair therapy' are nevertheless hoped and predicted to replace some of the currently used therapy, while improving the quality of life as well as life expectancy of CF patients. Although there is substantial variability in the cost of treating CF between countries, a protein repair therapy should also alleviate the financial burden of medical costs for CF patients and their families. Finding new drugs or rediscovering old ones for CF is critically dependent on the delivery of molecular and structural information on the CFTR protein, on its mutated version and on the network of CFTR-interacting proteins. The expertise needed to turn compounds into marketable drugs for CF will depend on our ability to provide biological information obtained from pertinent models of the disease and on our success in transferring safe molecules to clinical trials. Predicting a drug-induced response is also an attractive challenge that could be rapidly applied to patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 [38] Class V mutations (e.g. A455E, P574H) are responsible for the production of functional proteins with normal Cl-channel activity and regulation, but at a reduced rate of synthesis.
X
ABCC7 p.Pro574His 20166764:105:36
status: NEW[hide] Understanding how cystic fibrosis mutations disrup... Int J Biochem Cell Biol. 2014 Jul;52:47-57. doi: 10.1016/j.biocel.2014.04.001. Epub 2014 Apr 13. Wang Y, Wrennall JA, Cai Z, Li H, Sheppard DN
Understanding how cystic fibrosis mutations disrupt CFTR function: from single molecules to animal models.
Int J Biochem Cell Biol. 2014 Jul;52:47-57. doi: 10.1016/j.biocel.2014.04.001. Epub 2014 Apr 13., [PMID:24727426]
Abstract [show]
Defective epithelial ion transport is the hallmark of the life-limiting genetic disease cystic fibrosis (CF). This abnormality is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), the ATP-binding cassette transporter that functions as a ligand-gated anion channel. Since the identification of the CFTR gene, almost 2000 disease-causing mutations associated with a spectrum of clinical phenotypes have been reported, but the majority remain poorly characterised. Studies of a small number of mutations including the most common, F508del-CFTR, have identified six general mechanisms of CFTR dysfunction. Here, we review selectively progress to understand how CF mutations disrupt CFTR processing, stability and function. We explore CFTR structure and function to explain the molecular mechanisms of CFTR dysfunction and highlight new knowledge of disease pathophysiology emerging from large animal models of CF. Understanding CFTR dysfunction is crucial to the development of transformational therapies for CF patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2031 Even more notable was the CF-PS mutation P574H, which disrupted CFTR processing, but formed a "super" normal channel, distinguished by greatly prolonged, but less frequent channel openings compared to wild-type CFTR (Sheppard et al., 1995; Champigny et al., 1995).
X
ABCC7 p.Pro574His 24727426:2031:41
status: NEW[hide] Trimethylangelicin promotes the functional rescue ... Am J Physiol Lung Cell Mol Physiol. 2014 Jul 1;307(1):L48-61. doi: 10.1152/ajplung.00305.2013. Epub 2014 May 9. Favia M, Mancini MT, Bezzerri V, Guerra L, Laselva O, Abbattiscianni AC, Debellis L, Reshkin SJ, Gambari R, Cabrini G, Casavola V
Trimethylangelicin promotes the functional rescue of mutant F508del CFTR protein in cystic fibrosis airway cells.
Am J Physiol Lung Cell Mol Physiol. 2014 Jul 1;307(1):L48-61. doi: 10.1152/ajplung.00305.2013. Epub 2014 May 9., [PMID:24816489]
Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) carrying the F508del mutation is retained in endoplasmic reticulum and fails to traffic to the cell surface where it functions as a protein kinase A (PKA)-activated chloride channel. Pharmacological correctors that rescue the trafficking of F508del CFTR may overcome this defect; however, the rescued F508del CFTR still displays reduced chloride permeability. Therefore, a combined administration of correctors and potentiators of the gating defect is ideal. We recently found that 4,6,4'-trimethylangelicin (TMA), besides inhibiting the expression of the IL-8 gene in airway cells in which the inflammatory response was challenged with Pseudomonas aeruginosa, also potentiates the cAMP/PKA-dependent activation of wild-type CFTR or F508del CFTR that has been restored to the plasma membrane. Here, we demonstrate that long preincubation with nanomolar concentrations of TMA is able to effectively rescue both F508del CFTR-dependent chloride secretion and F508del CFTR cell surface expression in both primary or secondary airway cell monolayers homozygous for F508del mutation. The correction effect of TMA seems to be selective for CFTR and persisted for 24 h after washout. Altogether, the results suggest that TMA, besides its anti-inflammatory and potentiator activities, also displays corrector properties.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 Fischer rat thyroid (FRT) epithelial cells, stably coexpressing human F508del CFTR and the high-sensitivity halide-sensing green fluorescent analog yellow fluorescent protein (HS-YFP) YFP-H148Q/ I152L (FRT-F508del) or stably transfected with a plasmid coding for P574H-CFTR and carrying the resistance gene for zeocin (FRT-P574H) were a generous gift from Dr. L. J. Galietta (Gaslini Institute, Genoa, Italy).
X
ABCC7 p.Pro574His 24816489:46:263
status: NEWX
ABCC7 p.Pro574His 24816489:46:323
status: NEW47 FRT-F508del and FRT-P574H cells were grown in Coon`s modified Ham`s F-12 medium plus 10% FBS, L-glutamine, and penicillin/streptomycin at 37&#b0;C under 5% CO2.
X
ABCC7 p.Pro574His 24816489:47:20
status: NEW279 Last, to analyze if the correction effect of TMA was specific for the F508del mutation of CFTR, TMA corrector activity was tested on FRT cells stably expressing P574H-CFTR (FRT-P574H), a mutant of CFTR that, like F508del CFTR, is retained at the ER and can be rescued by incubation for 24 h at reduced temperature (42).
X
ABCC7 p.Pro574His 24816489:279:161
status: NEWX
ABCC7 p.Pro574His 24816489:279:177
status: NEW280 FRT-P574H cell monolayers were incubated for 24 h with 100 nM TMA or at 27&#b0;C, and the chloride efflux in response to FSK plus IBMX was measured as described in MATERIALS AND METHODS.
X
ABCC7 p.Pro574His 24816489:280:4
status: NEW287 produce a significant correction in FRT-P574H cells [0.0005 afe; 0.0003 èc;(F/F0)/min, n afd; 4], with respect to the positive low-temperature rescue response [0.011 afe; 0.001 èc;(F/F0)/min, n afd; 5], suggesting that the TMA correction effect is specific for F508del mutation of CFTR.
X
ABCC7 p.Pro574His 24816489:287:40
status: NEW321 Importantly, we found that TMA corrector activity is specific for the F508del mutation since TMA incubation fails to activate the temperature-sensitive mutant P574H-CFTR (42).
X
ABCC7 p.Pro574His 24816489:321:159
status: NEW333 J. Zabner for providing CuFi-1 cells, Dr. L. J. Galietta for providing FRT cells stably coexpressing human F508del CFTR and high-sensitivity halide-sensing GFP analog YFP H148Q/ I152L and the P574H-CFTR FRT cells, and Dr. E. Ficker for providing the mutated constructs of hERG.
X
ABCC7 p.Pro574His 24816489:333:192
status: NEW