ABCMdb

ABCC1 p.Lys1333Met

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 10777615 [PubMed] Gao M et al: "Comparison of the functional characteristics of the nucleotide binding domains of multidrug resistance protein 1."

No. Sentence Comment

80 The primers with the mismatched bases (boldface type) for K684M and K1333M were 5Ј-GGCTGCGGAATGTCGTC- CCTG-3Ј and 5Ј-GGAGCTGGGATGTCGTCCCTG-3Ј, respectively. Login to comment
84 The EcoRI-KpnI fragment with the K1333M mutation was isolated from pGEM-NBD2 and used to replace the equivalent region in pBSMRP1-fc-ATG to generate pBSMRP1-fc-ATG/ K1333M. Login to comment
85 The SphI-KpnI fragment was then isolated from the resulting plasmid and used to replace the same region in pFB-MRP1 and pFB-MRP1/K684M to give pFB-MRP1/K1333M and pFB-MRP1/Double Km, respectively. Login to comment
86 To generate pFBDual-halves/Double KM, the NcoI-KpnI fragment of pBSMRP1-fc-ATG/K1333M was isolated and used to replace the equivalent region of pFBDual-MRP1932-1531. Login to comment
205 In contrast, the rates of ATP-dependent LTC4 uptake by membranes containing either MRP1/K1333M or MRP1/Double KM were less than 5% of that of the membranes expressing the wild-type protein. Login to comment
217 Time and ATP-dependence of uptake is shown for MRP1 (f), NBD1 mutant MRP1/K684M (Œ), NBD2 mutant MRP1/K1333M (), and the double mutant MRP1/Double KM (ࡗ). Login to comment
227 LTC4 Transport by Co-expressed Half-molecules of MRP1 Containing Walker A Lysine Mutations-To further characterize the effect of the Walker A K684M and K1333M substitutions on the ability to photolabel each NBD with 8-azido-␣- [32 P]ATP, these mutations were introduced into each of the half-molecules, which were then expressed either together, or with the appropriate wild-type half-molecule, using dual expression vectors. Login to comment
231 The rates of LTC4 uptake by both halves of MRP1/K1333M and MRP1/Double KM were 8 and 5% that of the wild-type protein, respectively. Login to comment
237 As expected, the K1333M mutation also eliminated all labeling of NBD2. Login to comment
242 Consistent with the results obtained with the full-length protein, no labeling of either NBD was observed when either the K1333M or K684M mutant half-molecules were co-expressed with the appropriate wild-type half of the protein despite the demonstrable transport activity of the latter combination. Login to comment
247 A, membrane proteins from Sf21 cells expressing both halves of wild-type MRP1 (Dual-halves), NBD1 mutant (Dual-halves/ K684M), NBD2 mutant (Dual-halves/K1333M) and double mutant (Dual-halves/Double KM) were separated by SDS-PAGE on a 5-15% gradient gel and transferred to Immobilon-P membranes. Login to comment
250 Time and ATP dependence of uptake is shown for Dual-halves (f), Dual-halves/K684M (Œ), Dual-halves/K1333M (), and Dual-halves/ Double KM (ࡗ). Login to comment
330 In contrast, the K1333M mutation essentially eliminated transport and abolished 8-azido-ADP trapping by NBD2 and the low level of trapping detectable at NBD1. Login to comment
332 The combined results of LTC4 transport and photoaffinity labeling studies with the K684M, Ins708, and K1333M mutants are consistent with a model in which ATP hydrolysis at NBD1 is obligatorily coupled to hydrolysis at NBD2 but not vice versa. Login to comment
334 The lack of reciprocal coupling between the two NBDs of MRP1 and the different consequences of the K684M and K1333M mutations raise an important question with respect to the role played by NBD1 in substrate transport. Login to comment

PMID: 11507101 [PubMed] Qian YM et al: "Characterization of binding of leukotriene C4 by human multidrug resistance protein 1: evidence of differential interactions with NH2- and COOH-proximal halves of the protein."

No. Sentence Comment

149 Consistent with the suggestion that the two NBDs of MRP1 fulfill different functional roles, our previous studies demonstrated that Walker A mutations, K684M and K1333M, in NBD1 and NBD2, respectively, had different effects on the ability of the protein to transport LTC4 (25). Login to comment
151 As shown in Fig. 8C, either the double mutation K684M/K1333M or the single mutation K1333M abolished the ability of vanadate and ATP to inhibit LTC4 binding, whereas mutation K684M did not. Login to comment
235 C, effect of vanadate trapping on [3 H]LTC4 labeling of co-expressed expressed mutant forms of MRP11-932 and MRP1932-1531 in which NBD1 or NBD2 had been in activated by mutation of essential Walker A mutations (K684M in NBD1 and K1333M in NBD). Login to comment

PMID: 14965249 [PubMed] Haimeur A et al: "The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation."

No. Sentence Comment

240 In contrast, the comparable mutation in the WA motif of NBD2 (Lys1333 to Met) completely abolishes transport activity indicating an essential requirement for ATP hydrolysis by this domain [184]. Login to comment

PMID: 15152943 [PubMed] Szentpetery Z et al: "Functional studies on the MRP1 multidrug transporter: characterization of ABC-signature mutant variants."

No. Sentence Comment

42 When a highly conserved lysine residue within the Walker A motif in MRP1 was substituted for methionine in either the N-ABC or in the C-ABC unit, the K1333M mutation in the C-ABC nearly abolished ATP-dependent LTC4 uptake, whereas the K684M substitution in the N-ABC had a less pronounced effect (22,23). Login to comment

PMID: 15155846 [PubMed] Ren XQ et al: "Function of the ABC signature sequences in the human multidrug resistance protein 1."

No. Sentence Comment

3 We therefore investigated the effect of mutation of the signature sequences (G771D and G1433D) and of the Walker A motifs (K684M and K1333M) in the NBDs on the 8-azido-[␣-32 P]ATP photolabeling and 8-azido-[␣-32 P]ADP vanadate trapping of MRP1. Login to comment
8 Trapping at both NBD1 and NBD2 was almost completely inhibited by K684M and K1333M mutations and by the K684M/K1333M double mutation. Login to comment
56 The MRP1 K1333M mutant was constructed using the oligonucleotide DNA 5Ј CGGGAGCTGGGATGTCGTCCCTGAC3Ј (bold indicates a mismatched base) and the Gene Editor in vitro site-directed mutagenesis system (Promega, Madison, WI) according to the manufacturer`s protocol. Login to comment
57 The MRP1 K684M/K1333M double mutant was generated by exchanging DNA fragments from the single mutations. Login to comment
92 The expression levels of the N-terminal halves of the mutated dual NϩC fragments relative to that for wt NϩC were 0.98, 0.55, 0.41, 1.58, and 0.84 for N K684MϩC, NϩC K1333M, N K684MϩC K1333M, N G771DϩC, and NϩC G1433D, respectively. Login to comment
93 The expression levels of the C-terminal halves of the mutated dual NϩC fragments relative to that for wt NϩC were 0.85, 0.49, 0.37, 1.21, and 0.51 for N K684MϩC, NϩC K1333M, N K684MϩC K1333M, N G771DϩC ,and NϩC G1433D, respectively. Login to comment
113 Mutation of the Walker A motif in the N-terminal (K684M) NBD1 or the C-terminal (K1333M) NBD2 almost completely inhibited the labeling of the NBD in their respective fragments. Login to comment
127 Either single or double mutation of the Walker A motifs in NBD1 and/or NBD2 (K684M, K1333M, or K684M/K1333M double mutations) almost completely inhibited trapping by both NBD1 and NBD2 domains (Fig. 7A). Login to comment
141 Although ATP-dependent LTC4 transport by G771D and G1433D MRP1 mutants, as well as transport by the K684M and K1333M mutants in the Walker A motifs, were considerably decreased, GSH-dependent photolabeling with azido AG-A of these MRP1 mutants was retained. Login to comment

PMID: 15755910 [PubMed] Payen L et al: "Functional interactions between nucleotide binding domains and leukotriene C4 binding sites of multidrug resistance protein 1 (ABCC1)."

No. Sentence Comment

126 Mutation of the conserved Walker A Lys684 in NBD1 (Fig. 2) to methionine substantially reduces but does not eliminate MRP1 transport activity, whereas the comparable mutation in NBD2, K1333M, essentially inactivates the protein (Gao et al., 2000; Hou et al., 2000). Login to comment

PMID: 17187755 [PubMed] Yang R et al: "Hydrogen-bond formation of the residue in H-loop of the nucleotide binding domain 2 with the ATP in this site and/or other residues of multidrug resistance protein MRP1 plays a crucial role during ATP-dependent solute transport."

No. Sentence Comment

28 Accordingly, mutations of the residues that should interact with the γ-phosphate of the bound ATP [28,29], such as K1333M [19] or G771A [30], also almost abolished the ATP-dependent solute transport activity completely. Login to comment

PMID: 17295059 [PubMed] Chang XB et al: "A molecular understanding of ATP-dependent solute transport by multidrug resistance-associated protein MRP1."

No. Sentence Comment

259 In contrast, mutation of the Walker A motif K1333 residue in NBD2, such as K1333L [40, 141, 148], K1333M [16, 63, 118], K1333R [61] or K1333E [61], mainly affected ATP binding (at 4°C) at the mutated NBD2 [61, 148] and significantly decreased the ATP hydrolysis at the mutated NBD2 [61, 148]. Login to comment