ABCG8 p.Met429Val
[switch to full view]Comments [show]
None has been submitted yet.
    
                    
                        PMID: 15816807
                    
                    
                        [PubMed]
                    
                    Miwa K et al: "ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        3
                        
                            We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)].
                                
                                X
                                    ABCG8 p.Met429Val 15816807:3:83
                                        status: VERIFIED14 Nucleotide Annealing Position Mutation change* Forward primer (5 → 3 ) Reverse primer (5 → 3 ) temperature (◦ C) Enzyme Size (bp) ABCG5 Exon 7 C287R 859T → C TCACACACTAACTACCTTCTGTTGTC ATGATGGGGAATGTGAAAGAAA 54 BstUI 191 Exon 13 Q604E 1810C → G ATCTAGATTCACAATGAACTTTCTA GTCCCTGCAAGTTGTAAGAG 53 XhoI 193 ABCG8 Exon 2 C54Y 161G → A GGAGGTCAGAGACCTCAAgT GCCCACCCTTTTATTTCCAC 56 RsaI 107 Exon 8 T400K 1199C → A ACACCTGTGTGGAAAGGTAAGGT GCGGGTTCAGTAATAAAATGACAG 57 MseI 216 Exon 9 M429V 1285A → G ATGCTGTTGCCTCAGCATCT AAGCTGTGTTCCTCTGAGCT 56 Tsp45I 306 Exon 13 A632V 1895C → T ATGTCTGTGTCTCCAGATCCTCAGgG TACAGGACCATGAAGCCACCGCTGAcGCC 63 HaeIII 105 sterols to cholesterol are known to be positively related to cholesterol absorption and negatively to cholesterol synthesis [1-4].
X
                                    ABCG8 p.Met429Val 15816807:14:522
                                        status: NEW47 Genotype and allele frequencies A novel mutation of C287R and five SNPs (single nucleotide polymorphisms) (including a novel one ABCG8 M429V) were genotyped in our subjects.
X
                                    ABCG8 p.Met429Val 15816807:47:135
                                        status: VERIFIED48 Frequency distributions for the genotypes in exon 7 (C287R) and exon 13 (Q604E) of ABCG5, and in exon 2 (C54Y), exon 8 (T400K), exon 9 (M429V) and exon 13 (A632V) of ABCG8 are shown in Table 3.
X
                                    ABCG8 p.Met429Val 15816807:48:136
                                        status: VERIFIED51 Parameters Value Age (years) 62.4 +- 12.1 Gender (men/women) 48/52 BMI (kg/m2 ) 23.0 +- 3.5 Total cholesterol (mg/dl) 261 +- 48 Triacylglycerol (mg/dl) 135 +- 69 HDL-C (mg/dl) 56 +- 16 LDL-C (mg/dl) 179 +- 48 Sitosterol (µg/ml) 2.63 +- 1.0 Lathosterol (µg/ml) 3.00 +- 1.3 Table 3 Genotype distribution and allele frequencies of the polymorphisms in the ABCG5/ABCG8 gene Gene Mutation Nucleotide change Polymorphism Allele frequency ABCG5 Exon 7 C287R 859T → C T 0.99 C 0.01 Exon 13 Q604E 1810C → G C 0.89 G 0.11 ABCG8 Exon 2 C54Y 161G → A G 0.82 A 0.18 Exon 8 T400K 1199C → A C 0.88 A 0.12 Exon 9 M429V 1285A → G A 0.96 G 0.04 Exon 13 A632V 1895C → T C 0.995 T 0.005 found and the A632V variant was rare in our Japanese subjects.
X
                                    ABCG8 p.Met429Val 15816807:51:635
                                        status: VERIFIED57 Sitosterol Lathosterol Sitosterol/chol Polymorphism Genotype n (µg/ml) P value (µg/ml) P value (µg/mg) P value Lathosterol/chol (µg/mg) P value ABCG5 Exon 13 Q604E (1810C → G) QQ 78 2.63 +- 1.06 0.81 2.97 +- 1.36 0.73 1.03 +- 0.3 0.97 1.19 +- 0.55 0.84 QE 21 2.69 +- 0.72 3.09 +- 1.12 1.03 +- 0.40 1.16 +- 0.38 EE 1 1.2 3.2 0.6 1.57 ABCG8 Exon 2 C54Y (161G → A) CC 67 2.69 +- 0.98 0.19 2.82 +- 1.11 0.06 1.05 +- 0.36 0.06 1.12 +- 0.45 0.2 CY 30 2.57 +- 1.06 3.20 +- 1.33 1.02 +- 0.43 1.27 +- 0.57 YY 3 1.93 +- 0.31 4.23 +- 3.17 0.65 +- 0.12 1.38 +- 0.98 ABCG8 Exon 8 T400K (1199C → A) TT 76 2.64 +- 0.98 0.85 2.87 +- 1.10 0.14 1.03 +- 0.37 0.96 1.14 +- 0.45 0.17 TK 24 2.60 +- 1.07 3.34 +- 1.70 1.03 +- 0.44 1.31 +- 0.66 KK 0 ABCG8 Exon 9 M429V (1285A → G) MM 92 2.56 +- 0.94 0.003 3.03 +- 1.30 0.08 1.00 +- 0.36 0.002 1.19 +- 0.51 0.16 MV 8 3.64 +- 1.26 1.95 +- 0.53 1.45 +- 0.56 0.84 +- 0.36 VV 0 Table 5 Effect of the four polymorphism haplotypes in the ABCG5/ABCG8 gene on serum non-cholesterol levels Values are means +- S.D. The haplotype effects on serum non-cholesterol levels were assigned in all individuals using PHASE in 94 individuals.
X
                                    ABCG8 p.Met429Val 15816807:57:780
                                        status: VERIFIEDX
                                    ABCG8 p.Met429Val 15816807:57:801
                                        status: NEW67 Of the 16 possible four-polymorphism haplotypes [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1285A/G (M429V)], six haplotypes were estimated to be present.
X
                                    ABCG8 p.Met429Val 15816807:67:110
                                        status: VERIFIED70 DISCUSSION The main findings of the present study performed in Japanese hypercholesterolaemic subjects are as follows: (i) two novel mutants or polymorphisms, C287R in ABCG5 and M429V in ABCG8, have been identified, and (ii) the M429V polymorphism is positively associated with serum sitosterol and sitosterol/cholesterol levels, whereas the other three polymorphisms are not associated with serum non-cholesterol levels.
X
                                    ABCG8 p.Met429Val 15816807:70:178
                                        status: VERIFIEDX
                                    ABCG8 p.Met429Val 15816807:70:229
                                        status: VERIFIED4 In carriers of the novel M429V variant, the serum level of sitosterol and the sitosterol/cholesterol ratio were significantly higher than those in non-carriers (3.64 compared with 2.56 µg/ml, and 1.45 µg/mg compared with 1.00 µg/mg respectively; P < 0.01 for both), and serum lathosterol tended to be lower (1.95 µg/ml compared with 3.03 µg/ml; P = 0.08), whereas no significant difference was observed in other lipid profiles.
X
                                    ABCG8 p.Met429Val 15816807:4:25
                                        status: VERIFIED6 We conclude that, in 8% of patients with hypercholesterolaemia, the novel ABCG8 M429V variant was associated with higher cholesterol absorption efficiency.
X
                                    ABCG8 p.Met429Val 15816807:6:80
                                        status: VERIFIED55 The novel M429V variant of ABCG8 was found to be positively associated with both higher sitosterol concentrations and their ratio to cholesterol (P < 0.01 for both).
X
                                    ABCG8 p.Met429Val 15816807:55:10
                                        status: VERIFIED74 Among the four polymorphisms examined, only the M429V variant was significantly associated with sitosterol concentration and its ratio to cholesterol.
X
                                    ABCG8 p.Met429Val 15816807:74:48
                                        status: VERIFIED93 In the present study, the novel M429V variant may have similar therapeutic implications of statins.
X
                                    ABCG8 p.Met429Val 15816807:93:32
                                        status: VERIFIED94 Finally, we did not find a specific ABCG5/ABCG8 haplotype that was more significantly associated with non-cholesterol sterol concentrations than the M429V variant alone.
X
                                    ABCG8 p.Met429Val 15816807:94:149
                                        status: VERIFIED95 This strongly suggests that the novel M429V variant itself, or another as yet undefined linked variant, has functional significance.
X
                                    ABCG8 p.Met429Val 15816807:95:38
                                        status: VERIFIED96 In terms of putative topology, M429V is predicted to be located in the first transmembrane domain of an N-terminal site.
X
                                    ABCG8 p.Met429Val 15816807:96:31
                                        status: VERIFIED97 From this point of view, the M429V variant is the marker rather than the cause of higher serum sitosterol concentration.
X
                                    ABCG8 p.Met429Val 15816807:97:29
                                        status: VERIFIED98 In conclusion, in 8% of Japanese patients with primary hypercholesterolaemia, the novel ABCG8 M429V variant is associated with higher serum sitosterol concentrations (probably due to higher cholesterol absorption efficiency), whereas no relationships with serum lipid concentrations are observed under dietary restriction.
X
                                    ABCG8 p.Met429Val 15816807:98:94
                                        status: VERIFIED
                    
                        PMID: 16507104
                    
                    
                        [PubMed]
                    
                    Pandit B et al: "A detailed Hapmap of the Sitosterolemia locus spanning 69 kb; differences between Caucasians and African-Americans."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        27
                        
                            In this paper, we report the detailed characterization of the SNPs present at the STSL in Caucasians drawn from Table 1: Polymorphisms reported at the STSL locus Name Position in the gene Polymorphism dbSNP cluster ID Restriction enzyme site altered Nucleotide Position ABCG5 P9P Exon 1 C/T rs49854016 BstN 1 22881725 R50C* Exon 2 C/T rs6756629 - 22881023 V523I Exon 11 G/A ss49854017 - 22863069 C600Y Exon 13 G/A ss49854018 - 22856345 Q604E* Exon 13 G/C rs6720173 Sml I 22856334 V622M Exon 13 G/A ss49854019 - 22856280 ABCG8 5' UTR-41 5' UTR C/T ss49854020 BstE II 22882085 5' UTR-19* 5' UTR T/G rs3806471 Tsp45 I 22882107 P17P Exon 1 G/C ss49854021 - 22882176 D19H* Exon 1 G/C rs11887534 - 22882180 INT1-21* Intron 1 C/A ss4148209 Mnl I 22887558 INT1-7* Intron 1 C/T ss4148210 BsmA 1 22887572 C54Y* Exon 2 G/A ss4148211 SexA I 22887676 E238L* Exon 6 G/A ss49854010 - 22895692 A259V* Exon 6 C/T ss49854012 Hae III 22895756 Q340E Exon 7 C/G ss49854024 - 22915101 T400K* Exon 8 C/A ss4148217 Mse I 22915366 M429V Exon 9 G/A - 22916932 INT9-19 Intron 9 C/T ss49854025 - 22917460 INT10-50* Intron 10 C/T ss4148220 - 22918168 A565A* Exon 11 C/T ss4148221 - 22918424 G575R* Exon 11 G/C rs49584011 Hha I 22918452 A632V* Exon 13 C/T rs6544718 Sty I 22920858 *Only these SNPs were found to be variant in the present study and the haplotypes (See Table 2 and 3) are ordered with these reported in sequence.
                                
                                X
                                    ABCG8 p.Met429Val 16507104:27:1006
                                        status: VERIFIED66 All of the SNPs shown in Table 1 except M429V in ABCG8 were analyzed.
X
                                    ABCG8 p.Met429Val 16507104:66:40
                                        status: VERIFIED67 M429V was reported only recently in a Japanese cohort [29], and was not included for analyses in this study.
X
                                    ABCG8 p.Met429Val 16507104:67:0
                                        status: VERIFIED114 Of the remaining 9 SNPs we genotyped and found no variants (Table 1), with the exception of M429V, which we did not genotype, the HapMap Consortium also do not report any genotyping data.
X
                                    ABCG8 p.Met429Val 16507104:114:92
                                        status: VERIFIED158 Additionally, one cSNP, M429V, which was reported to be relatively more frequent in the Japanese population [29], was also absent from the HapMap dataset analyzing the Chinese Han and the Tokyo Japanese DNA samples.
X
                                    ABCG8 p.Met429Val 16507104:158:24
                                        status: VERIFIED197 For example, the M429V SNP was reported in the Japanese samples and seems to play a role in cholesterol absorption [29].
X
                                    ABCG8 p.Met429Val 16507104:197:17
                                        status: VERIFIED
                    
                        PMID: 18522623
                    
                    
                        [PubMed]
                    
                    Rudkowska I et al: "Polymorphisms in ABCG5/G8 transporters linked to hypercholesterolemia and gallstone disease."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        3
                        
                            Various polymorphisms (A632V, T400K, D19H, M429V, and C54Y) in the ABCG8 and ABCG5 (Q604E) gene have been found to be associated with several facets of cholesterol metabolism, including baseline cholesterol level, cholesterol kinetics, individual responsiveness of plasma cholesterol to dietary and pharmaceutical interventions for hypercholesterolemia, and increased risk of gallstones.
                                
                                X
                                    ABCG8 p.Met429Val 18522623:3:43
                                        status: VERIFIED29 ROLE OF RACE-RELATED DIFFERENCES IN ABC GENOTYPES Miwa et al.,15 studying a Japanese population, concluded that carriers of a novel ABCG8 M429V allele or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V in the ABCG8 gene), were associated with higher cholesterol absorption efficiency, as well as lower cholesterol synthesis rates.
X
                                    ABCG8 p.Met429Val 18522623:29:138
                                        status: VERIFIEDX
                                    ABCG8 p.Met429Val 18522623:29:283
                                        status: VERIFIED31 Also, polymorphisms of Q604E and T400K alleles may not be as important in the regulation of non-cholesterol-sterol levels in the Japanese population.15 In a more recent trial, no detection of this SNP (ABCG8 M429V allele) was recorded in either the Caucasian or the African-American population studied, thereby potentially demonstrating a race-specific polymorphism.16 In general, these studies demonstrate the benefits of using an intermediate phenotype, such as cholesterol absorption and synthesis, to determine the link between SNPs and blood lipids in relation to a dietary treatment.
X
                                    ABCG8 p.Met429Val 18522623:31:208
                                        status: VERIFIED
                    
                        PMID: 17632509
                    
                    
                        [PubMed]
                    
                    Buch S et al: "A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        48
                        
                            The coding SNPs responsible for amino acid changes L36P, Q340E, M429V and G575R were monomorphic.
                                
                                X
                                    ABCG8 p.Met429Val 17632509:48:64
                                        status: NEW
                    
                        PMID: 22655090
                    
                    
                        [PubMed]
                    
                    Li Q et al: "ATP-binding cassette transporter G5 and G8 polymorphisms and several environmental factors with serum lipid levels."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        241
                        
                            020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000  hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers.
                                
                                X
                                    ABCG8 p.Met429Val 22655090:241:1181
                                        status: NEWX
                                    ABCG8 p.Met429Val 22655090:241:1293
                                        status: NEW239 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers.
X
                                    ABCG8 p.Met429Val 22655090:239:1181
                                        status: NEWX
                                    ABCG8 p.Met429Val 22655090:239:1293
                                        status: NEW
                    
                        PMID: 19932478
                    
                    
                        [PubMed]
                    
                    Lu Y et al: "The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        1795
                        
                            In 100 hypercholesterolaemic Japanese subjects, Miwa et al. [56] reported that carriers of the M429V variant of ABCG8 or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V ABCG8) had higher cholesterol absorption efficiency than non-carriers.
                                
                                X
                                    ABCG8 p.Met429Val 19932478:1795:95
                                        status: NEWX
                                    ABCG8 p.Met429Val 19932478:1795:250
                                        status: NEW1865 Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from Y54C on cholesterol lowering response to atorvastatin ABCG8 M429V (A > G) Miwa et al. [56] 100 hypercholesterolaemic Japanese subjects M429V variant associated with higher cholesterol absorption ABCG8 rs4131229 (T > C), rs3806471 (A > C) Junyent et al. [47] 845 self-identified Puerto Ricans Lower HDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and LDL-C ABCG8 rs6709904 (A > G) Junyent et al. [47] 845 self-identified Puerto Ricans Lower LDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and HDL-C NPC1L1 g.-113A > Gg.-18C > A-g.1679C > G (L272L, rs2072183) Simon et al. [66] 1208 hypercholesterolemic individuals participating in the ezetimibe + statin treatment arm of the EASE trial [104] and 1132 hypercholesterolemic individuals participating in Vytorin vs.
X
                                    ABCG8 p.Met429Val 19932478:1865:160
                                        status: NEWX
                                    ABCG8 p.Met429Val 19932478:1865:235
                                        status: NEW
                    
                        PMID: 18641716
                    
                    
                        [PubMed]
                    
                    Rudkowska I et al: "Association between non-responsiveness to plant sterol intervention and polymorphisms in cholesterol metabolism genes: a case-control study."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        124
                        
                            Also, the M429V SNP in ABCG8 was reported to participate in cholesterol absorption efficiency in the Japanese population (Miwa et al. Fig. 3.
                                
                                X
                                    ABCG8 p.Met429Val 18641716:124:10
                                        status: NEW
                    
                        PMID: 22548731
                    
                    
                        [PubMed]
                    
                    Li Q et al: "Association of ATP binding cassette transporter G8 rs4148217 SNP and serum lipid levels in Mulao and Han nationalities."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        262
                        
                            Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, Katsuda S, Takata M, Koizumi J, Mabuchi H: ATP-binding cassette transporter G8 M429V polymorphismas a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
                                
                                X
                                    ABCG8 p.Met429Val 22548731:262:147
                                        status: NEW
                    No.
                    Sentence
                    Comment
                
                    
                        748
                        
                            In hypercholesterolemic Japanese subjects, serum sitosterol levels and the sitosterol/cholesterol ratio are higher in carriers of the ABCG8 M429V variant than non-carriers [30].
                                
                                X
                                    ABCG8 p.Met429Val 24252657:748:140
                                        status: NEW
                    
                        PMID: 25804128
                    
                    
                        [PubMed]
                    
                    Nicolas A et al: "ABCG8 polymorphisms and renal disease in type 2 diabetic patients."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        194
                        
                            [18] Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, et al. ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
                                
                                X
                                    ABCG8 p.Met429Val 25804128:194:116
                                        status: NEW