ABCG2 p.Phe208Ser

[switch to full view]
Comments [show]
Publications
PMID: 12544509 [PubMed] Zamber CP et al: "Natural allelic variants of breast cancer resistance protein (BCRP) and their relationship to BCRP expression in human intestine."
No. Sentence Comment
125 Unauthorized reproduction of this article is prohibited. G34A V12M Exon 2 C71T1 A24V Exon 2 623C1 F208S Exon 6 A616C I206L Exon 6 C496G1 Q166E Exon 5 C421A Q141K Exon 5 A1444G2 R482G Exon 12 G1445C3 R482T Exon 12 A1768T N590Y Exon 15 Walker A motif: amino acids 80-89 Walker B motif: amino acids 206-210 SNPs found in human samples in this study Reported in ABCP1 Drug selected variants, MXR2 and BCRP3 MXR BCRP Fig. 1 BCRP protein topology and the positions of the identified SNPs resulting in missense mutations.
X
ABCG2 p.Phe208Ser 12544509:125:98
status: VERIFIED
Login to comment

PMID: 12960109 [PubMed] Mathijssen RH et al: "Irinotecan pathway genotype analysis to predict pharmacokinetics."
No. Sentence Comment
132 Table 4 Genotype and Allele frequencies for the studied genes Polymorphisma Nomenclature Descriptionb Genotype frequenciesc Allele frequencies (95% CI)d Wt Het Var p q r ABCB1 1236 CϾT n/ae G411G 23 15 8 0.66 (0.52-0.78) 0.34 (0.22-0.48) ABCB1 3435 CϾT n/a E1143E 16 35 8 0.57 (0.44-0.69) 0.43 (0.31-0.56) ABCB1 2677 GϾT/A n/a A893S or T 12 23/4 13/1 0.48 (0.35-0.61) 0.47 (0.34-0.60) 0.05 (0.02-0.14) ABCC1 14008 GϾA n/a intron 27 32 27 5 0.71 (0.59-0.81) 0.29 (0.19-0.41) ABCC1 462 CϾT n/a P154P 65 0 0 1.00 0.00 ABCC1 34215 CϾG n/a intron 18 0 20 40 0.17 (0.1-0.28) 0.83 (0.72-0.90) ABCC2 156231 AϾG n/a intron 3 65 0 0 1.00 0.00 ABCG2 623TϾC n/a F208S 63 0 0 1.00 0.00 CES1 1440 AϾT n/a L480F 64 0 0 1.00 0.00 CES1 1525 AϾC n/a N509H 60 1 0 0.99 (0.92-1) 0.01 (0-0.08) CES2 1647 CϾT n/a L549L 56 1 0 0.99 (0.92-1) 0.01 (0-0.08) CYP3A4 -392 AϾG CYP3A4*1B Promoter 46 3 0 0.97 (0.88-0.99) 0.03 (0.01-0.12) CYP3A4 15713 TϾC CYP3A4*2 S222P 39 0 0 1.00 0.00 CYP3A4 23172 TϾC CYP3A4*3 M445T 62 2 0 0.98 (0.91-1) 0.02 (0-0.09) CYP3A5 22893 GϾA CYP3A5*3C Splice variant 56 8 0 0.94 (0.85-0.98) 0.06 (0.02-0.15) CYP3A5 30597 GϾA CYP3A5*6 Splice variant 63 0 0 1.00 0.00 UGT1A1 (TA)n f UGT1A1*28 Promoter 34 22 2 0.78 (0.66-0.87) 0.22 (0.13-0.34) UGT1A1 1456 TϾG UGT1A1*7 Y486D 62 0 0 1.00 0.00 XRCC1 26304 CϾT n/a R194W 35 8 0 0.91 (0.79-0.96) 0.09 (0.04-0.21) XRCC1 27466 GϾA n/a R280H 60 2 0 0.98 (0.91-1) 0.02 (0-0.09) XRCC1 28152 GϾA n/a R399Q 25 27 5 0.68 (0.55-0.79) 0.32 (0.21-0.45) a Number represents position in nucleotide sequence.
X
ABCG2 p.Phe208Ser 12960109:132:698
status: VERIFIED
Login to comment

136 Table 4 Genotype and Allele frequencies for the studied genes Polymorphisma Nomenclature Descriptionb Genotype frequenciesc Allele frequencies (95% CI)d Wt Het Var p q r ABCB1 1236 CϾT n/ae G411G 23 15 8 0.66 (0.52-0.78) 0.34 (0.22-0.48) ABCB1 3435 CϾT n/a E1143E 16 35 8 0.57 (0.44-0.69) 0.43 (0.31-0.56) ABCB1 2677 GϾT/A n/a A893S or T 12 23/4 13/1 0.48 (0.35-0.61) 0.47 (0.34-0.60) 0.05 (0.02-0.14) ABCC1 14008 GϾA n/a intron 27 32 27 5 0.71 (0.59-0.81) 0.29 (0.19-0.41) ABCC1 462 CϾT n/a P154P 65 0 0 1.00 0.00 ABCC1 34215 CϾG n/a intron 18 0 20 40 0.17 (0.1-0.28) 0.83 (0.72-0.90) ABCC2 156231 AϾG n/a intron 3 65 0 0 1.00 0.00 ABCG2 623TϾC n/a F208S 63 0 0 1.00 0.00 CES1 1440 AϾT n/a L480F 64 0 0 1.00 0.00 CES1 1525 AϾC n/a N509H 60 1 0 0.99 (0.92-1) 0.01 (0-0.08) CES2 1647 CϾT n/a L549L 56 1 0 0.99 (0.92-1) 0.01 (0-0.08) CYP3A4 -392 AϾG CYP3A4*1B Promoter 46 3 0 0.97 (0.88-0.99) 0.03 (0.01-0.12) CYP3A4 15713 TϾC CYP3A4*2 S222P 39 0 0 1.00 0.00 CYP3A4 23172 TϾC CYP3A4*3 M445T 62 2 0 0.98 (0.91-1) 0.02 (0-0.09) CYP3A5 22893 GϾA CYP3A5*3C Splice variant 56 8 0 0.94 (0.85-0.98) 0.06 (0.02-0.15) CYP3A5 30597 GϾA CYP3A5*6 Splice variant 63 0 0 1.00 0.00 UGT1A1 (TA)n f UGT1A1*28 Promoter 34 22 2 0.78 (0.66-0.87) 0.22 (0.13-0.34) UGT1A1 1456 TϾG UGT1A1*7 Y486D 62 0 0 1.00 0.00 XRCC1 26304 CϾT n/a R194W 35 8 0 0.91 (0.79-0.96) 0.09 (0.04-0.21) XRCC1 27466 GϾA n/a R280H 60 2 0 0.98 (0.91-1) 0.02 (0-0.09) XRCC1 28152 GϾA n/a R399Q 25 27 5 0.68 (0.55-0.79) 0.32 (0.21-0.45) a Number represents position in nucleotide sequence.
X
ABCG2 p.Phe208Ser 12960109:136:698
status: NEW
Login to comment

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."
No. Sentence Comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region.
X
ABCG2 p.Phe208Ser 15882131:157:744
status: NEW
Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."
No. Sentence Comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins.
X
ABCG2 p.Phe208Ser 16259577:250:58
status: NEW
Login to comment

PMID: 16303243 [PubMed] Yanase K et al: "Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development."
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Phe208Ser 16303243:92:598
status: NEW
Login to comment

PMID: 16337740 [PubMed] Cervenak J et al: "The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology."
No. Sentence Comment
97 According to the first cloning studies, the ABCG2 cDNA obtained from normal human placenta [8] showed the following sequence alterations, as compared to the database reference sequence: c.71COT (A24V), c.496COG (Q166E) and c.623TOC (F208S).
X
ABCG2 p.Phe208Ser 16337740:97:233
status: VERIFIED
Login to comment

PMID: 16608919 [PubMed] Tamura A et al: "Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport."
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Phe208Ser 16608919:2:196
status: NEW
Login to comment

4 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type.
X
ABCG2 p.Phe208Ser 16608919:4:55
status: NEW
Login to comment

36 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins, suggesting that those genetic polymorphisms in the ABCG2 gene may be related to the risk of certain diseases resulting from disruption of porphyrin homeostasis.
X
ABCG2 p.Phe208Ser 16608919:36:55
status: NEW
Login to comment

82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan).
X
ABCG2 p.Phe208Ser 16608919:82:999
status: NEW
Login to comment

144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis.
X
ABCG2 p.Phe208Ser 16608919:144:172
status: NEW
Login to comment

149 In addition, the expression level of F208S was found to be extremely low.
X
ABCG2 p.Phe208Ser 16608919:149:37
status: NEW
Login to comment

164 It is important to note that the variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both hematoporphyrin and methotrexate.
X
ABCG2 p.Phe208Ser 16608919:164:52
status: NEW
Login to comment

177 as the variants F208S, S248P, S441N, F431L, and F489L were expressed in Flp-In 293 cells.
X
ABCG2 p.Phe208Ser 16608919:177:16
status: NEW
Login to comment

180 Similar results were observed with the variants of F208S and S248P (data not shown).
X
ABCG2 p.Phe208Ser 16608919:180:51
status: NEW
Login to comment

214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Phe208Ser 16608919:214:196
status: NEW
Login to comment

215 We provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Fig. 5).
X
ABCG2 p.Phe208Ser 16608919:215:48
status: NEW
Login to comment

217 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity.
X
ABCG2 p.Phe208Ser 16608919:217:32
status: NEW
Login to comment

224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein.
X
ABCG2 p.Phe208Ser 16608919:224:559
status: NEW
Login to comment

235 In contrast, F208S, S248P and E334stop alleles are registered in the National Center for Biotechnology Information dbSNP database, but their allele frequencies are not available.
X
ABCG2 p.Phe208Ser 16608919:235:13
status: NEW
Login to comment

236 The most recent version of National Center for Biotechnology Information dbSNP does not seem to have validation for Q166E, F208S, S248P, and E334stop (Table 2) as bona fide SNPs.
X
ABCG2 p.Phe208Ser 16608919:236:123
status: NEW
Login to comment

237 Thus, the clinical significance of F208S, S248P and E334stop alleles in porphyrin-induced phototoxicity remains to be elucidated.
X
ABCG2 p.Phe208Ser 16608919:237:35
status: NEW
Login to comment

PMID: 16877258 [PubMed] Wakabayashi K et al: "Human ABC transporter ABCG2 in xenobiotic protection and redox biology."
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells.
X
ABCG2 p.Phe208Ser 16877258:176:174
status: NEW
Login to comment

177 The variants Q126stop, F208S, S248P, E334stop, and S441N were found to be defective in the transport of hematoporphyrin (Tamura et al., 2006) (Table 2).
X
ABCG2 p.Phe208Ser 16877258:177:23
status: NEW
Login to comment

179 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al., 2006).
X
ABCG2 p.Phe208Ser 16877258:179:32
status: NEW
Login to comment

PMID: 17015488 [PubMed] Sarkadi B et al: "Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system."
No. Sentence Comment
827 In the first cloning of the ABCG2 cDNA from human placenta (8), several sequence alterations causing amino acid changes, including A24V, Q166E, and F208S, were recorded, compared with the database reference sequence.
X
ABCG2 p.Phe208Ser 17015488:827:148
status: VERIFIED
Login to comment

PMID: 17228519 [PubMed] Tamura A et al: "Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system."
No. Sentence Comment
4 While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low.
X
ABCG2 p.Phe208Ser 17228519:4:137
status: VERIFIED
Login to comment

48 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 3 Plasma Membrane inside outside S S S homodimer A B CH2N COOH V12M Q141K F208S S248P F431L S441N F489L R482G R482T Acquired mutation Figure 1.
X
ABCG2 p.Phe208Ser 17228519:48:192
status: VERIFIED
Login to comment

67 PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2 Variant Forward/Reverse Primer sequence (5` →→ 3`) Primer length % GC Tm (ºC) (F/R) primers (bases) V12M F CGAAGTTTTTATCCCAATGTCACAAGGAAACAC 33 39 55 R GTGTTTCCTTGTGACATTGGGATAAAAACTTCG Q141K F CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT 35 42 55 R AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG F208S F TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA 35 45 55 R TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P F TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT 35 40 55 R AAACAACTTGAAGATGGGATATCGAGGCTGATGAA F431L F AGCTGGGGTTCTCCTCTTCCTGACGACC 28 60 62 R GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N F AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC 34 47 59 R GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L F GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG 46 34 62 R CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC Sites of mutagenesis are indicated by underbars.
X
ABCG2 p.Phe208Ser 17228519:67:381
status: VERIFIED
Login to comment

104 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 0 1 2 RelativemRNAlevel Mock WT V12M Q141K mRNA A ABCG2 GAPDH Mock WT F208S S248P F431L S441N F489L ABCG2 GAPDH 0 1 2 RelativemRNAlevel mRNA B GAPDH ABCG2 Mock WT F208S S248P F431L S441N F489L Protein 0 1 2 Relativeproteinlevel * * * C DProtein GAPDH ABCG2 0 1 2 Relativeproteinlevel * * Mock WT V12M Q141K Figure 3. mRNA and protein expression levels of ABCG2 WT and variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 17228519:104:189
status: VERIFIED
X
ABCG2 p.Phe208Ser 17228519:104:282
status: VERIFIED
Login to comment

114 Characterization of V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells The mRNA levels of ABCG2 and GAPDH were measured by quantitative PCR, and the ratios of ABCG2 variants vs. GAPDH were plotted.
X
ABCG2 p.Phe208Ser 17228519:114:33
status: VERIFIED
Login to comment

119 Figure 3 demonstrates mRNA and protein levels of ABCG2 WT and V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 17228519:119:75
status: VERIFIED
Login to comment

122 Interestingly, expression levels of the F208S and S441N variants were markedly low (Fig. 3D).
X
ABCG2 p.Phe208Ser 17228519:122:40
status: VERIFIED
Login to comment

123 The immunofluorescence images of Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells revealed that those variant proteins were not expressed in the plasma membrane (data not shown).
X
ABCG2 p.Phe208Ser 17228519:123:51
status: VERIFIED
Login to comment

126 In fact, when Flp-In-293/ABCG2 (F208S) cells were treated with MG132, a proteasome inhibitor, the protein level recovered up to about 50% of the WT level, suggesting the involvement of proteasomes in degradation of the F208S variant (data not shown).
X
ABCG2 p.Phe208Ser 17228519:126:32
status: VERIFIED
X
ABCG2 p.Phe208Ser 17228519:126:219
status: VERIFIED
Login to comment

132 Figure 4 summarizes the characteristics of those Tamura et al. 8 Journal of Experimental Therapeutics and Oncology Vol. 6 2006 Class Class Class Class WT V12M Q141K F431L S248P F489L F208S S441N R482G R482T Protein expression + + + + + + - - + + SN-38 resistance + + + + + / - - - - + + MX resistance + + + + / - - - - - + + Doxorubicin resistance - - - - - - - - + + Daunorubicin resistance - - - - - - - - + + Figure 4.
X
ABCG2 p.Phe208Ser 17228519:132:183
status: VERIFIED
Login to comment

140 Both F208S and S441N belong to the third class where protein expression levels were extremely low (Fig. 3D).
X
ABCG2 p.Phe208Ser 17228519:140:5
status: VERIFIED
Login to comment

143 Resistance profile (IC50 ) of ABCG2 Compounds IC50 (nM) Mock WT V12M Q141K F208S S248P F431L S441N F489L SN-38 1.0 ± 0.2 49.9 ± 6.0 51.1 ± 13.8 17.7 ± 0.9 0.7 ± 0.0 3.6 ± 0.4 12.1 ± 1.5 0.8 ± 0.0 3.9 ± 0.4 (49.9)* (51.1)* (17.7)* (0.7) (3.6) (12.1)* (0.8) (3.9) Mitoxantorone 7.0 ± 1.1 108.0 ± 4.9 94.0 ± 18.6 46.7 ± 12.7 5.1 ± 1.0 13.4 ± 1.3 15.2 ± 1.4 5.7 ± 0.8 12.1 ± 6.2 (15.4)* (13.4)* (6.7)* (0.7) (1.9) (2.2)* (0.8) (1.7) Doxorubicin 38.8 ± 3.8 105.2 ± 24.9 123.6 ± 35.3 156.8 ± 27.5 19.9 ± 8.7 23.7 ± 6.7 43.5 ± 6.1 39.4 ± 4.1 47.6 ± 3.1 (2.7) (3.2) (4.0) (0.5) (0.6) (1.1) (1.0) (1.2) Daounorubicin 13.0 ± 0.6 32.3 ± 6.5 58.2 ± 5.0 57.7 ± 4.1 14.1 ± 2.3 22.1 ± 4.2 15.9 ± 1.2 13.3 ± 1.1 23.6 ± 1.6 (2.5) (4.5) (4.4) (1.1) (1.7) (1.2) (1.0) (1.8) Etoposide 117.1 ± 16.0 210.2 ± 18.4 297.3 ± 58.5 233.9 ± 54.2 122.9 ± 17.6 137.7 ± 14.8 139.1 ± 12.3 154.3 ± 8.5 186.9 ± 10.1 (1.8) (2.5) (2.0) (1.0) (1.2) (1.2) (1.3) (1.6) Vincristine 1.8 ± 0.2 4.3 ± 0.3 7.1 ± 1.4 5.6 ± 1.6 0.6 ± 0.0 4.3 ± 0.9 1.8 ± 0.3 0.9 ± 0.1 3.0 ± 0.7 (2.4) (3.0) (3.1) (0.3) (2.4) (1.0) (0.5) (1.7) The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, V12M, Q141K, F208S, S248P, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, daunorubicin, etoposide, or vincristine at different concentrations as described in Materials and Methods.
X
ABCG2 p.Phe208Ser 17228519:143:75
status: VERIFIED
X
ABCG2 p.Phe208Ser 17228519:143:1465
status: VERIFIED
Login to comment

PMID: 17297656 [PubMed] Tamura A et al: "Re-evaluation and functional classification of non-synonymous single nucleotide polymorphisms of the human ATP-binding cassette transporter ABCG2."
No. Sentence Comment
3 To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system.
X
ABCG2 p.Phe208Ser 17297656:3:142
status: VERIFIED
Login to comment

6 In particular, expression of the F208S and S441N variants was markedly low, suggesting the instability of these variant proteins.
X
ABCG2 p.Phe208Ser 17297656:6:33
status: VERIFIED
Login to comment

8 The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type.
X
ABCG2 p.Phe208Ser 17297656:8:45
status: VERIFIED
Login to comment

137 Characterization of the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 17297656:137:24
status: VERIFIED
Login to comment

138 Figure 2C demonstrates the mRNA and protein levels of WT ABCG2 and the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 17297656:138:71
status: VERIFIED
Login to comment

139 Whereas mRNA levels were almost the same in WT and those variants, the protein levels of the F208S and S441N variants were markedly low.
X
ABCG2 p.Phe208Ser 17297656:139:93
status: VERIFIED
Login to comment

140 The immunofluorescence images of Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells revealed that those variant proteins were not expressed in the plasma membrane (Fig. 2D).
X
ABCG2 p.Phe208Ser 17297656:140:51
status: VERIFIED
Login to comment

176 Resistance profile (IC50) of ABCG2 Compound IC50 (nM) Mock Wild type V12M Q141K F208S S248P F431L S441N F489L SN-38 0.9 40.0 (44.4) 40.0 (44.4) 17.0 (18.9) 0.6 (0.7) 3.0 (3.3) 10.0 (11.1) 0.7 (0.8) 3.1 (3.4) Mitoxantorone 5.2 >100 (>19) 92.0 (17.7) 45.0 (8.7) 4.5 (0.9) 11.0 (2.1) 21.0 (4.0) 4.6 (0.9) 11.0 (2.1) Doxorubicin 32.0 78.0 (2.4) 100.0 (3.1) 110.0 (3.4) 20.0 (0.6) 20.0 (0.6) 40.0 (1.3) 21.0 (0.7) 45.0 (1.4) Daunorubicin 12.0 30.0 (2.5) 50.0 (4.2) 50.0 (4.2) 12.0 (1.0) 21.0 (1.8) 14.0 (1.2) 12.0 (1.0) 19.0 (1.6) Etoposide 110.0 200.0 (1.8) 220.0 (2.0) 200.0 (1.8) 110.0 (1.0) 120.0 (1.1) 120.0 (1.1) 130.0 (1.2) 170.0 (1.5) Vincristine 1.4 4.0 (2.9) 5.0 (3.6) 4.5 (3.2) 0.6 (0.4) 4.0 (2.9) 1.4 (1.0) 0.8 (0.6) 2.8 (2.0) Relative resistances to mock cells are described in parentheses.
X
ABCG2 p.Phe208Ser 17297656:176:80
status: VERIFIED
Login to comment

192 As clearly demonstrated in this study, the F208S, S248P, F431L, S441N and F489L variants exhibited greatly altered protein expression levels (Fig. 2C) or drug resistance profiles (Fig. 4 and Table 1).
X
ABCG2 p.Phe208Ser 17297656:192:43
status: VERIFIED
Login to comment

193 In particular, expression levels of the F208S and S441N variants were markedly low (Fig. 2C).
X
ABCG2 p.Phe208Ser 17297656:193:40
status: VERIFIED
Login to comment

195 In fact, when Flp-In-293/ ABCG2 (F208S) cells were treated with MG132, a proteasome inhibitor, the protein level recovered up to approximately 50% of the WT level, suggesting the involvement of proteasomes in degradation of the F208S variant (data not shown).
X
ABCG2 p.Phe208Ser 17297656:195:33
status: VERIFIED
X
ABCG2 p.Phe208Ser 17297656:195:228
status: VERIFIED
Login to comment

199 The most recent version of NCBI dbSNP does not appear to contain validation for F208S and S248P as bona fide SNP.
X
ABCG2 p.Phe208Ser 17297656:199:80
status: VERIFIED
Login to comment

202 As one of the specific aims of the present study, we functionally classified the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity.
X
ABCG2 p.Phe208Ser 17297656:202:124
status: VERIFIED
Login to comment

207 Drug resistance profiles of Flp-In-293 cells expressing the wild-type (WT) BCRP/MXR1/ABCP (ABCG2), F208S, S248P, F431L, S441N or F489L variants toward (A) SN-38 and (B) mitoxantrone.
X
ABCG2 p.Phe208Ser 17297656:207:99
status: VERIFIED
Login to comment

214 (16) Both F208S and S441N belong to the third group where protein expression levels were extremely low (Fig. 2C).
X
ABCG2 p.Phe208Ser 17297656:214:10
status: VERIFIED
Login to comment

PMID: 17373578 [PubMed] Yoshioka S et al: "The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein."
No. Sentence Comment
5 PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65 kDa), which is slightly smaller than wild-type (70 kDa), but this mutant did not appear on the cell surface or confer drug resistance.
X
ABCG2 p.Phe208Ser 17373578:5:3
status: VERIFIED
Login to comment

42 The cells were selected with 120 ng/mL of methotrexate, and the resulting mixed populations of resistant cells were designated as PA/WT, PA/V12M, PA/ G51C, PA/Q141K, PA/T153M, PA/I206L, PA/F208S, PA/ S248P, PA/F431L, PA/N590Y and PA/D620N, respectively. The PA/F208S clones and PA/F431L clones were obtained by limiting dilution.
X
ABCG2 p.Phe208Ser 17373578:42:189
status: VERIFIED
X
ABCG2 p.Phe208Ser 17373578:42:261
status: VERIFIED
Login to comment

43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study.
X
ABCG2 p.Phe208Ser 17373578:43:507
status: VERIFIED
Login to comment

45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1.
X
ABCG2 p.Phe208Ser 17373578:45:35
status: VERIFIED
Login to comment

70 The BCRP (824 bp) and GAPDH (551 bp) transcripts were amplified by RT-PCR from 0.3 mg of total RNA. c, Western blot analysis of BCRP in PA317, PA/WT, PA/F431L, and PA/F208S cells as described above.
X
ABCG2 p.Phe208Ser 17373578:70:167
status: VERIFIED
Login to comment

75 SN-38 Resistance Levels of PA317 Transfectantsa Cell type IC50 (nmol/L) Degree of resistance PA317 11 T 0.2 1 PA/WT 550 T 16 50 PA/V12M 490 T 13 45 PA/Q141K 110 T 5.9 10 PA/T153M 260 T 15 24 PA/Q166E 680 T 40 62 PA/F208S 10 T 0.7 1 PA/F431L 34 T 0.9 3 PA/D620N 190 T 5.7 17 a Cells were cultured for 5 days with various concentrations of SN-38.
X
ABCG2 p.Phe208Ser 17373578:75:215
status: VERIFIED
Login to comment

80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N).
X
ABCG2 p.Phe208Ser 17373578:80:219
status: VERIFIED
Login to comment

81 G51C, T153M, Q166E, I206L, F208S and S248P are located in the intracellular domain of the protein (Fig. 1 and Table I).
X
ABCG2 p.Phe208Ser 17373578:81:27
status: VERIFIED
Login to comment

86 Among the 11 mutant BCRP transfectants under study, PA/F208S cells were found to express the lowest levels of BCRP, corresponding to a 65-kDa protein (Fig. 2a and c).
X
ABCG2 p.Phe208Ser 17373578:86:55
status: VERIFIED
Login to comment

93 Cell Surface BCRP Expression in the Mutant BCRP Transfectants The expression levels of BCRP on the cell surfaces of each of the transfectants were examined by FACS and were undetectable in either the PA/F208S or parental PA317 cells (Fig. 2d).
X
ABCG2 p.Phe208Ser 17373578:93:203
status: VERIFIED
Login to comment

100 PA/F208S cells showed a similar level of SN-38 sensitivity to PA317 cells (Table II).
X
ABCG2 p.Phe208Ser 17373578:100:3
status: VERIFIED
Login to comment

105 Analyses of PA/F208S Subclones We isolated two independent clones from the population of PA/F208S cells, (PA/F208S-cl.1 and -cl.4) that expressed higher levels of 65-kDa BCRP protein than PA/F208S cells by western blot (Fig. 3a), but the cell surface expression of BCRP were not detectable in these clones by FACS analysis (Fig. 3c).
X
ABCG2 p.Phe208Ser 17373578:105:15
status: VERIFIED
X
ABCG2 p.Phe208Ser 17373578:105:92
status: VERIFIED
X
ABCG2 p.Phe208Ser 17373578:105:109
status: VERIFIED
X
ABCG2 p.Phe208Ser 17373578:105:191
status: VERIFIED
Login to comment

113 BCRP protein and mRNA expression in PA/F208S clones.
X
ABCG2 p.Phe208Ser 17373578:113:39
status: VERIFIED
Login to comment

116 b, Semi-quantitative RT-PCR analysis of BCRP mRNA in the indicated PA/F208S clones.
X
ABCG2 p.Phe208Ser 17373578:116:70
status: VERIFIED
Login to comment

117 The BCRP (824 bp) and GAPDH (551 bp) transcripts were amplified by RT-PCR from 0.3 mg of total RNA. c, BCRP cell surface expression analysis of PA/F208S clones by FACS as described for Fig. 2d.
X
ABCG2 p.Phe208Ser 17373578:117:147
status: VERIFIED
Login to comment

118 d, Drug resistance levels for the PA/F208S clones. PA317 (open circle), PA/WT (closed circle), PA/F208S (closed triangle), PA/F208S clone 1 (closed lozenge), and clone 4 (closed square) cells were cultured for 5 days with various concentrations of SN-38.
X
ABCG2 p.Phe208Ser 17373578:118:37
status: VERIFIED
X
ABCG2 p.Phe208Ser 17373578:118:98
status: VERIFIED
X
ABCG2 p.Phe208Ser 17373578:118:126
status: VERIFIED
Login to comment

128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function.
X
ABCG2 p.Phe208Ser 17373578:128:237
status: VERIFIED
Login to comment

130 The resulting mixed populations of cells were designated a PA/WT, PA/V12M, PA/G51C, PA/Q141K, PA/ T153M, PA/I206L, PA/F208S, PA/S248P, PA/F431L, PA/ N590Y and PA/D620N.
X
ABCG2 p.Phe208Ser 17373578:130:118
status: VERIFIED
Login to comment

131 PA/F208S cells were found to express marginal levels of BCRP (65-kDa) (Figs. 2a and 3a), which were slightly lower than wild-type BCRP, but did not appear on the cell surface (Figs. 2d and 3c).
X
ABCG2 p.Phe208Ser 17373578:131:3
status: VERIFIED
Login to comment

132 Moreover, PA/ F208S cells did not show any drug resistance (Fig. 3c and Table II).
X
ABCG2 p.Phe208Ser 17373578:132:14
status: VERIFIED
Login to comment

143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain.
X
ABCG2 p.Phe208Ser 17373578:143:27
status: VERIFIED
Login to comment

145 The I206L BCRP and F208S BCRP mutants harbor amino acid substitutions within the Walker B region, which is likely to have a significant impact upon the functioning of the ATP binding site.
X
ABCG2 p.Phe208Ser 17373578:145:19
status: VERIFIED
Login to comment

146 PA/F208S cells express a marginal amount of a smaller BCRP protein species(65 kDa), which is not expressed on the cell surface (Figs. 2a, c, d, 3a and c).
X
ABCG2 p.Phe208Ser 17373578:146:3
status: VERIFIED
Login to comment

147 Moreover, PA/F208S cells do not show any drug resistant properties.
X
ABCG2 p.Phe208Ser 17373578:147:13
status: VERIFIED
Login to comment

148 Considering no expression of F208S BCRP mutant on the cell surface of PA/F208S, the lack of drug resistance property in the transfectant is probably due to the absence of cell surface transporter.
X
ABCG2 p.Phe208Ser 17373578:148:29
status: VERIFIED
X
ABCG2 p.Phe208Ser 17373578:148:73
status: VERIFIED
Login to comment

150 Further studies are ongoing to evaluate the ATP-binding and -hydrolyzing activity of I206L BCRP and F208S BCRP mutants.
X
ABCG2 p.Phe208Ser 17373578:150:100
status: VERIFIED
Login to comment

153 These results are very similar to our current data for the T623C (F208S) BCRP germ-line mutation.
X
ABCG2 p.Phe208Ser 17373578:153:66
status: VERIFIED
Login to comment

154 Surprisingly, both the Ile residue of I1196Y P-gp and the Phe of F208S BCRP occupy the amino acid positions in the Walker B motifs of P-gp and BCRP, respectively. A number of ongoing studies in our laboratory are therefore currently focused on the mechanisms underlying the maturation and stability of mutant ABC transporters as this may have a significant impact upon the effectiveness of cancer chemotherapy regimens.
X
ABCG2 p.Phe208Ser 17373578:154:65
status: VERIFIED
Login to comment

165 The 65-kDa F431L BCRP product has the same molecular weight as F208S BCRP by SDS-PAGE (Fig. 2a and c).
X
ABCG2 p.Phe208Ser 17373578:165:63
status: VERIFIED
Login to comment

178 CONCLUSION We have characterized two important BCRP germ-line mutations, T623C (F208S) and T1291C (F431L).
X
ABCG2 p.Phe208Ser 17373578:178:80
status: VERIFIED
Login to comment

PMID: 18154452 [PubMed] Sharom FJ et al: "ABC multidrug transporters: structure, function and role in chemoresistance."
No. Sentence Comment
368 A recent study characterized the activity of 18 ABCG2 variants, and concluded that Q126stop, F208S, S248P, E334stop, S441N and F489L are defective in hematoporphyrin transport [170], which may increase the risk of disease in individuals carrying these polymorphisms.
X
ABCG2 p.Phe208Ser 18154452:368:93
status: NEW
Login to comment

PMID: 18159130 [PubMed] Tamura A et al: "In vitro evaluation of photosensitivity risk related to genetic polymorphisms of human ABC transporter ABCG2 and inhibition by drugs."
No. Sentence Comment
22 By using plasma membrane vesicles and a high-speed screening system, we precisely evaluated functional changes associated with genetic polymorphisms in vitro.24) Since porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the transport of porphyrins with a total of 18 variant forms of human ABCG2 in the plasma membrane vesicle system.4) As a result, we found that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins.
X
ABCG2 p.Phe208Ser 18159130:22:421
status: NEW
Login to comment

199 Indeed, we reported that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin.4) The F489L variant showed impaired transport activity.
X
ABCG2 p.Phe208Ser 18159130:199:48
status: NEW
Login to comment

200 As demonstrated in the present study, as well as in our previous one,4) Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity.
X
ABCG2 p.Phe208Ser 18159130:200:104
status: NEW
Login to comment

PMID: 18237272 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2."
No. Sentence Comment
2 Of these, ABCG2 F208S and S441N variants were found to be expressed at markedly low levels, whereas their mRNA levels were equal to those of the other SNP variants and ABCG2 WT (wild-type).
X
ABCG2 p.Phe208Ser 18237272:2:16
status: VERIFIED
Login to comment

3 Interestingly, protein expression levels of the ABCG2 F208S and S441N variants increased 6to 12-fold when Flp-In-293 cells were treated with MG132, a proteasome inhibitor.
X
ABCG2 p.Phe208Ser 18237272:3:54
status: VERIFIED
Login to comment

4 Immunoprecipitation followed by immunoblot analysis showed that the ABCG2 F208S and S441N variant proteins were endogenously ubiquitinated in Flp-In-293 cells, and treatment with MG132 significantly enhanced the level of these ubiquitinated variants.
X
ABCG2 p.Phe208Ser 18237272:4:74
status: VERIFIED
Login to comment

5 Immunofluorescence microscopy demonstrated that MG132 greatly affected the ABCG2 F208S and S441N variants in terms of both protein levels and intracellular distribution.
X
ABCG2 p.Phe208Ser 18237272:5:81
status: VERIFIED
Login to comment

7 The ABCG2 F208S and S441N variant proteins do not appear to be processed in the Golgi apparatus, but undergo ubiquitin-mediated protein degradation in proteasomes, whereas ABCG2 WT is sorted to the plasma membrane and then degraded via the lysosomal pathway.
X
ABCG2 p.Phe208Ser 18237272:7:10
status: VERIFIED
Login to comment

26 The ABCG2 non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N and F489L were defective in the active transport of methotrexate and haematoporphyrin [18].
X
ABCG2 p.Phe208Ser 18237272:26:48
status: VERIFIED
Login to comment

27 Furthermore, the F208S, S248P, F431L, S441N, and F489L ABCG2 variants exhibited greatly altered protein expression levels and drug Abbreviations used: ABC, ATP-binding cassette; ABCG2, ABC subfamily G, member 2; BMA, bafilomycin A1; CPT, camptothecin; DMEM, Dulbecco`s modified Eagle`s medium; endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated degradation; FCS, fetal calf serum; Flp, flippase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HRP, horseradish peroxidase; ME, 2-mercaptoethanol; PNGase F, peptide N-glycosidase F; RT-PCR, reverse transcription-PCR; SN-38, 7-ethyl-10-hydroxycamptothecin; SNP, single nucleotide polymorphism; TBS, Tris-buffered saline; WT, wild-type.
X
ABCG2 p.Phe208Ser 18237272:27:17
status: VERIFIED
Login to comment

30 In particular, the expression levels of the F208S and S441N ABCG2 variant proteins were markedly low.
X
ABCG2 p.Phe208Ser 18237272:30:44
status: VERIFIED
Login to comment

32 Nevertheless, the mechanism underlying the low expression levels of those ABCG2 variants (i.e. F208S and S441N) has not yet been elucidated.
X
ABCG2 p.Phe208Ser 18237272:32:95
status: VERIFIED
Login to comment

39 We provide direct evidence that ABCG2 non-synonymous SNP variants, i.e., F208S and S441N, undergo ubiquitin-mediated protein degradation in proteasomes.
X
ABCG2 p.Phe208Ser 18237272:39:73
status: VERIFIED
Login to comment

45 Flp-In-293 cells expressing ABCG2 WT (wild-type), F208S or S441N Flp-In-293 cells expressing ABCG2 WT, F208S or S441N, named Flp-In-293/ABCG2 (WT), Flp-In-293/ABCG2 (F208S) or Flp-In-293/ABCG2 (S441N) respectively, were prepared as described previously [8,33].
X
ABCG2 p.Phe208Ser 18237272:45:50
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:45:103
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:45:166
status: VERIFIED
Login to comment

88 To analyse quantitatively the distribution of the ABCG2 protein localized on the plasma membrane or in the cytosol, the immunofluorescence images captured by the confocal fluorescence microscopy system were processed by means of originally-developed computer software, Figure 1 Schematic illustration of human ABCG2 and expression of ABCG2 WT, F208S and S441N in Flp-In-293 cells at the transcription and protein levels (A) Arrows indicate the positions of amino acid substitutions in the non-synonymous SNP variants of ABCG2 F208S and S441N.
X
ABCG2 p.Phe208Ser 18237272:88:344
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:88:526
status: VERIFIED
Login to comment

93 (B) The mRNA level was analysed by RT-PCR with total RNA extracted from Flp-In-293 cells expressing ABCG2 WT (WT), F208S or S441N.
X
ABCG2 p.Phe208Ser 18237272:93:115
status: VERIFIED
Login to comment

94 For comparison of the protein levels, the cell lysates of Flp-In-209 cells expressing ABCG2 WT (WT), F208S or S441N were analysed by immunoblotting with the ABCG2-specific monoclonal antibody (BXP-21, top panel) or the GAPDH-specific antibody after PNGase F treatment.
X
ABCG2 p.Phe208Ser 18237272:94:101
status: VERIFIED
Login to comment

102 RESULTS Protein expression levels of ABCG2 WT, F208S, and S441N in Flp-In-293 cells Figure 1(A) depicts a schematic illustration of the human ABCG2 protein in order to show the sites of amino acid alteration in the ABCG2 SNP variants F208S and S441N.
X
ABCG2 p.Phe208Ser 18237272:102:47
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:102:236
status: VERIFIED
Login to comment

103 WT, F208S and S441N ABCG2 were individually expressed in Flp-In-293 cells by using the Flp (flippase) recombinase system [8,33].
X
ABCG2 p.Phe208Ser 18237272:103:4
status: VERIFIED
Login to comment

104 As shown in Figure 1(B), mRNA levels of ABCG2 WT, as well as F208S and S441N variants, were evenly represented in Flp-In-293 cells, where the mRNA levels of ABCG2 and GAPDH were determined by RT-PCR.
X
ABCG2 p.Phe208Ser 18237272:104:61
status: VERIFIED
Login to comment

105 WT, F208S and S441N ABCG2, as well as GAPDH, were also detected by immunoblotting, and their expression levels were quantified.
X
ABCG2 p.Phe208Ser 18237272:105:4
status: VERIFIED
Login to comment

109 Although mRNA levels were almost identical in ABCG2 WT and the SNP variants (F208S and S441N), the protein levels of those SNP variants were markedly low (Figure 1B).
X
ABCG2 p.Phe208Ser 18237272:109:77
status: VERIFIED
Login to comment

111 Characterization of F208S and S441N variants expressed in Flp-In-293 cells To gain insight into the molecular nature of ABCG2 WT and the two SNP variants (F208S and S441N), we performed immunoblot analysis experiments with cell lysate samples under reduced or non-reduced conditions.
X
ABCG2 p.Phe208Ser 18237272:111:20
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:111:155
status: VERIFIED
Login to comment

112 Figure 2(A) shows the effect of ME treatment on the migration of ABCG2 WT, F208S and S441N proteins on SDS/PAGE.
X
ABCG2 p.Phe208Ser 18237272:112:75
status: VERIFIED
Login to comment

115 These results suggest that the ABCG2 F208S and S441N proteins form homodimers through a cysteinyl disulfide bond, as observed for the WT ABCG2 protein.
X
ABCG2 p.Phe208Ser 18237272:115:37
status: VERIFIED
Login to comment

119 In the case of the ABCG2 F208S variant, one faint band was detected at an apparent molecular mass of 74 kDa by the same sample processing and immunoblotting experiment.
X
ABCG2 p.Phe208Ser 18237272:119:25
status: VERIFIED
Login to comment

122 Although the 81 kDa major band of ABCG2 WT was not at all affected by endo H treatment, the apparent molecular masses of the smaller protein bands of ABCG2 F208S (74 kDa) and S441N (78 kDa) decreased after endo H treatment.
X
ABCG2 p.Phe208Ser 18237272:122:156
status: VERIFIED
Login to comment

124 Among ABCG2 WT and the SNP variants Figure 2 Immunoblot detection of ABCG2 WT, F208S and S441N proteins expressed in Flp-In-293 cells (A) Effect of ME on the homodimer or monomer form of ABCG2 WT and the SNP variants.
X
ABCG2 p.Phe208Ser 18237272:124:79
status: VERIFIED
Login to comment

125 Cell lysate samples (20 µg of protein) were subjected to SDS/PAGE after treatment with [ME (+)] or without [ME(-)] ME. ABCG2 WT, F208S and S441N proteins were then detected by immunoblotting with the BXP-21 antibody as described in the Materials and methods section.
X
ABCG2 p.Phe208Ser 18237272:125:134
status: VERIFIED
Login to comment

126 After ME treatment ABCG2 WT, F208S and S441N proteins were converted from homodimers into monomers.
X
ABCG2 p.Phe208Ser 18237272:126:29
status: VERIFIED
Login to comment

131 ABCG2 WT, F208S and S441N proteins in the resulting samples were analysed by immunoblotting with the BXP-21 antibody.
X
ABCG2 p.Phe208Ser 18237272:131:10
status: VERIFIED
Login to comment

136 F208S and S441N, their N-linked oligosaccharide structures appear to be different.
X
ABCG2 p.Phe208Ser 18237272:136:0
status: VERIFIED
Login to comment

137 The mature N-linked oligosaccharide of ABCG2 WT may have a structure which is resistant to endo H, whereas the immature N-linked oligosaccharides of the F208S and S441N variant proteins are susceptible to this endoglycosidase.
X
ABCG2 p.Phe208Ser 18237272:137:153
status: VERIFIED
Login to comment

138 Effect of MG132 and BMA on the protein expression levels of F208S and S441N variants We hypothesize that the low protein expression levels of the F208S and S441N variants are due to rapid degradation of those proteins through ubiquitin-mediated proteasomal proteolysis.
X
ABCG2 p.Phe208Ser 18237272:138:60
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:138:146
status: VERIFIED
Login to comment

140 Flp-In-293 cells expressing ABCG2 F208S or S441N were incubated in the presence of 0, 0.4 or 2.0 µM MG132 for 24 h, and then cell lysate samples were immediately prepared.
X
ABCG2 p.Phe208Ser 18237272:140:34
status: VERIFIED
Login to comment

141 Protein expression levels of the F208S and S441N variants were determined by immunoblotting after PNGase F treatment as described above.
X
ABCG2 p.Phe208Ser 18237272:141:33
status: VERIFIED
Login to comment

144 After 24 h treatment with 2 µM MG132, ABCG2 F208S and S441N Figure 3 Effects of MG132 on the glycosylation status and protein levels of ABCG2 F208S and S441N variants expressed in Flp-In-293 cells (A) Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4 and 2 µM for 24 h at 37◦C. Cell lysate samples (20 µg of protein) were prepared in the presence of ME. ABCG2 F208S and S441N variant proteins were either analysed directly or treated with PNGase F for 10 min at 37◦C before immunoblotting with the ABCG2-specific monoclonal antibody (BXP-21).
X
ABCG2 p.Phe208Ser 18237272:144:49
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:144:150
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:144:227
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:144:449
status: VERIFIED
Login to comment

145 The signal intensity of the non-glycosylated form of the ABCG2 F208S or S441N variant was measured after PNGase F treatment.
X
ABCG2 p.Phe208Ser 18237272:145:63
status: VERIFIED
Login to comment

150 (B) Detection of aggregated forms (>200 kDa) of ABCG2 F208S and S441N variants.
X
ABCG2 p.Phe208Ser 18237272:150:54
status: VERIFIED
Login to comment

151 Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4 and 2 µM for 24 h at 37◦C. Cell lysate samples (20 µg of protein) were prepared in the presence of ME. ABCG2 F208S and S441N variant proteins were prepared from MG132-treated cells as described above and analysed by immunoblotting with the BXP-21 antibody in the absence of PNGase F treatment.
X
ABCG2 p.Phe208Ser 18237272:151:18
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:151:240
status: VERIFIED
Login to comment

152 The aggregated forms of ABCG2 F208S and S441N are indicated (arrowheads).
X
ABCG2 p.Phe208Ser 18237272:152:30
status: VERIFIED
Login to comment

160 It is of interest to note that MG132 treatments enhanced the levels of the non-glycosylated form (72 kDa) for both the F208S and S441N variants when those cell lysate samples were not treated with PNGase F (Figure 3A).
X
ABCG2 p.Phe208Ser 18237272:160:119
status: VERIFIED
Login to comment

161 More importantly, on immunoblot analysis without PNGase F treatment, aggregated forms (arrowheads in Figure 3B) of both the ABCG2 F208S and S441N variants were detected in the high-molecular-mass range (over 200 kDa).
X
ABCG2 p.Phe208Ser 18237272:161:130
status: VERIFIED
Login to comment

163 The protein level of ABCG2 WT increased more than 2.5-fold when cells were treated with BMA, which inhibits lysosomal degradation, whereas the ABCG2 F208S and S441N variant proteins were minimally affected by the same treatment.
X
ABCG2 p.Phe208Ser 18237272:163:149
status: VERIFIED
Login to comment

166 Effect of MG132 on the ubiquitination states of F208S and S441N variants To investigate the effect of MG132 on the ubiquitination states of the ABCG2 F208S and S441N variant proteins, Flp-In-293 cells expressing those SNP variants were incubated in the presence or absence of 2 µM MG132 for 24 h.
X
ABCG2 p.Phe208Ser 18237272:166:48
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:166:150
status: VERIFIED
Login to comment

167 As shown in Figure 4, significant increases in the ubiquitinated forms of the F208S and S441N variant proteins were detected by immunoblotting with mouse monoclonal anti-ubiquitin antibody after immunoprecipitation with anti-ABCG2 antibody (BXP-21).
X
ABCG2 p.Phe208Ser 18237272:167:78
status: VERIFIED
Login to comment

170 The corresponding results are presented in Figures 4(B) and 4(D), where ubiquitinated forms (arrowheads) appeared to be more prominent than with the monoclonal anti-ubiquitin antibody Figure 4 Effect of MG132 on ubiquitination of ABCG2 F208S and S441N Afterincubationinthepresenceorabsenceof2 µMMG132for24 hat37◦C,celllysatesamples were prepared from Flp-In-293/ABCG2 (F208S) (A, B) and Flp-In-293/ABCG2 (S441N) (C, D) cells.
X
ABCG2 p.Phe208Ser 18237272:170:238
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:170:383
status: VERIFIED
Login to comment

177 Effect of MG132 on the cellular localization of F208S and S441N variants It is of interest to know how inhibition of proteasomal protein degradation by MG132 affects the cellular localization of the ABCG2 F208S and S441N variant proteins.
X
ABCG2 p.Phe208Ser 18237272:177:48
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:177:205
status: VERIFIED
Login to comment

178 Figure 5 shows immunofluorescence images of Flp-In-293 cells expressing ABCG2 WT, F208S or S441N proteins that has been incubated in the presence or absence of 2 µM MG132 for 24 h.
X
ABCG2 p.Phe208Ser 18237272:178:82
status: VERIFIED
Login to comment

185 On the other hand, immunofluorescence of the ABCG2 F208S variant was extremely weak at the plasma membrane as well as within intracellular compartments (Figures 5e and 5g).
X
ABCG2 p.Phe208Ser 18237272:185:51
status: VERIFIED
Login to comment

186 After Figure 5 Immunocytochemical staining of Flp-In-293 cells expressing ABCG2 WT, F208S or S441N proteins Cells were incubated in the presence (+MG132) or absence (none) of 2 µM MG132 for 24 h at 37◦C. ABCG2 proteins were detected by using a mouse monoclonal ABCG2 antibody (either BXP-21 or 5D3) and Alexa Fluor® 488 (green fluorescence).
X
ABCG2 p.Phe208Ser 18237272:186:84
status: VERIFIED
Login to comment

195 Remarkable differences were observed after MG132 treatment in terms of the cellular localization and/or the quantity of the F208S or S441N variant ABCG2 proteins as shown in Figure 6(A).
X
ABCG2 p.Phe208Ser 18237272:195:124
status: VERIFIED
Login to comment

196 It is noteworthy that protein levels of the F208S and S441N variants were clearly enhanced in intracellular compartments after MG132 treatment, as observed with the BXP-21 antibody.
X
ABCG2 p.Phe208Ser 18237272:196:44
status: VERIFIED
Login to comment

198 However, no plasma membrane localization was detected in the case of the F208S variant ABCG2 protein (Figure 6A).
X
ABCG2 p.Phe208Ser 18237272:198:73
status: VERIFIED
Login to comment

201 Figure 6 Analysis of the effects of MG132 on the cellular localization of ABCG2 WT, F208S or S441N proteins in Flp-In-293 cells (A) Cells were incubated in the presence or the absence (None) of 2 µM MG132 for 24 h at 37◦C. ABCG2 proteins in cells were detected using an ABCG2-specific monoclonal antibody [either BXP-21 (BXP21) or 5D3] as described in the Materials and methods section.
X
ABCG2 p.Phe208Ser 18237272:201:84
status: VERIFIED
Login to comment

208 In a previous study using the Flp recombinase system [33], we functionally characterized the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity.
X
ABCG2 p.Phe208Ser 18237272:208:136
status: VERIFIED
Login to comment

210 In particular, the expression levels of the F208S and S441N variant proteins were markedly low (Figure 1), consistent with the recent report of Yoshioka et al. [37].
X
ABCG2 p.Phe208Ser 18237272:210:44
status: VERIFIED
Login to comment

212 Ubiquitin-mediated proteasomal degradation of F208S and S441N variants In the present study, we undertook the biochemical analysis of the molecular mechanisms underlying the low expression levels of the ABCG2 F208S and S441N variants.
X
ABCG2 p.Phe208Ser 18237272:212:46
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:212:209
status: VERIFIED
Login to comment

216 On the basis of those recent findings, we have examined the contribution of ubiquitin-mediated proteasomal degradation to the low-level expression of F208S and S441N ABCG2 variants by testing the effect of MG132.
X
ABCG2 p.Phe208Ser 18237272:216:150
status: VERIFIED
Login to comment

217 The presence of MG132 increased both the protein levels (Figure 3) and the ubiquitinated forms (Figure 4) of the F208S and S441N variant proteins.
X
ABCG2 p.Phe208Ser 18237272:217:113
status: VERIFIED
Login to comment

219 Misfolded proteins (e.g. ABCG2 F208S and S441N variants) are considered to be removed from the ER by retrotranslocation to the cytosol and then degraded by the ubiquitin-proteasome system by a process known as ERAD [38,39].
X
ABCG2 p.Phe208Ser 18237272:219:31
status: VERIFIED
Login to comment

223 N-linked oligosaccharides of ABCG2 F208S and S441N variants During de novo synthesis in the ER, oligosaccharides are added to asparagine (N-glycosylation) or serine residues (O-glycosylation) of glycoproteins.
X
ABCG2 p.Phe208Ser 18237272:223:35
status: VERIFIED
Login to comment

231 Their findings were confirmed by recent experiments in which Asn596 of the ABCG2 protein was changed to glutamine and expressed in Flp-In-293 cells by using the Flp recombinase system (H. Nakagawa, Scheme 1 Schematic illustration of plausible pathways for protein processing and degradation of ABCG2 WT and SNP variants (F208S and S441N) We have provided evidence that ABCG2 WT and the variants undergo degradation by different pathways.
X
ABCG2 p.Phe208Ser 18237272:231:323
status: VERIFIED
Login to comment

236 It is important to note that N-linked oligosaccharide processing was greatly impaired in the ABCG2 F208S and S441N SNP variants.
X
ABCG2 p.Phe208Ser 18237272:236:99
status: VERIFIED
Login to comment

240 It is likely, however, that the ABCG2 F208S and S441N variant proteins did not undergo Golgi-apparatus-mediated glycoprocessing, but were passed through the so-called ERAD pathway.
X
ABCG2 p.Phe208Ser 18237272:240:38
status: VERIFIED
Login to comment

241 The immature and non-glycosylated forms of ABCG2 F208S and S441N were detected when Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h (Figure 3A), suggesting that those variant proteins were ubiquitinated in both pre-and post-N-glycosylation reactions and then readily degraded in proteasomes.
X
ABCG2 p.Phe208Ser 18237272:241:49
status: VERIFIED
X
ABCG2 p.Phe208Ser 18237272:241:102
status: VERIFIED
Login to comment

244 While we have demonstrated here the ubiquitination and proteasomal degradation of the ABCG2 F208S or S441N variant homodimers, it will be important to study the fate of heterodimers (WT/SNP variant) in the future.
X
ABCG2 p.Phe208Ser 18237272:244:92
status: VERIFIED
Login to comment

251 As exemplified by the ABCG2 F208S and S441N variants, it is likely that several other SNP variants may undergo degradation via the ERAD pathway.
X
ABCG2 p.Phe208Ser 18237272:251:28
status: VERIFIED
Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand.
X
ABCG2 p.Phe208Ser 18249138:245:865
status: NEW
Login to comment

PMID: 18363541 [PubMed] Tamura A et al: "Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems."
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A.
X
ABCG2 p.Phe208Ser 18363541:230:111
status: NEW
Login to comment

231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids.
X
ABCG2 p.Phe208Ser 18363541:231:75
status: NEW
Login to comment

245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Phe208Ser 18363541:245:174
status: NEW
Login to comment

246 The variants Q126stop, F208S, S248P, E334stop, and S441N were defective in the transport of hematoporphyrin (Figure 9).
X
ABCG2 p.Phe208Ser 18363541:246:23
status: NEW
Login to comment

248 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a [87,88].
X
ABCG2 p.Phe208Ser 18363541:248:32
status: NEW
Login to comment

252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative).
X
ABCG2 p.Phe208Ser 18363541:252:307
status: NEW
Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult.
X
ABCG2 p.Phe208Ser 18464048:250:499
status: VERIFIED
Login to comment

315 22.Itoda,M.,etal.EightnovelsinglenucleotidepolymorphismsinABCG2/BCRPinJapanesecancerpatientsadministeredirinotacan.DrugMetabPharmacokinet.2003; 18(3):212-217. decreased MTX and porphyrin transport in cells transfected with variant cDNA in comparison to wild-type cDNA has also been reported for the following variants Phe208Ser, Ser248Pro, and Phe431Leu (Tamura et al., 2006).
X
ABCG2 p.Phe208Ser 18464048:315:321
status: VERIFIED
Login to comment

316 But only in the case of Phe208Ser could the altered function be attributed to lower protein expression levels (Tamura et al., 2006) or impaired membrane localization (Tamura et al., 2007).
X
ABCG2 p.Phe208Ser 18464048:316:24
status: VERIFIED
Login to comment

PMID: 18668433 [PubMed] Koshiba S et al: "Human ABC transporters ABCG2 (BCRP) and ABCG4."
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007).
X
ABCG2 p.Phe208Ser 18668433:225:158
status: NEW
Login to comment

232 S. Koshiba et al. variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both haematoporphyrin and methotrexate.
X
ABCG2 p.Phe208Ser 18668433:232:38
status: NEW
Login to comment

235 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al. 2007).
X
ABCG2 p.Phe208Ser 18668433:235:32
status: NEW
Login to comment

237 It has most recently revealed that F208S and S441N variant proteins were ubiquitinated and readily degraded in proteasomes in Flp-In-293 cells (Nakagawa et al. 2008).
X
ABCG2 p.Phe208Ser 18668433:237:35
status: NEW
Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."
No. Sentence Comment
85 Exon Polymorphism Effect dbSNP Cell Expression Function Reference mRNA ( ) Protein (n.s.) Membrane localization (n.s.) Drug sensitivity (n.s.) Mitoxantrone efflux (n.s.) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity (n.s.) Mizuarai et al. [88] Sf9 Protein ( ) ATPase activity (n.s.) Hoechst 33342 efflux ( ) Morisaki et al. [92] Exon 2 114T>C synonymous rs12721640 Exon 4 369C>T synonymous rs2231139 PA317 mRNA (n.s.) Protein ( ) Drug sensitivity ( ) Intracellular uptake ( ) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (n.s.) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] LLC-PK1 Apical localization (n.s.) Kondo et al. [94] mRNA ( ) Protein (n.s.) Membrane localization (impaired) Drug sensitivity ( ) Mitoxantrone efflux ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein ( ) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity ( ) Mizuarai et al. [88] 421C>A Gln141Lys rs2231142 Sf9 Protein (n.s.) ATPase activity ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] LLC-PK1 Apical localization (n.s.) Exon 5 496C>G Gln166Glu rs1061017 HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 HEK293 Protein ( or n.s.) Membrane localization (n.s.) Efflux activity ( ) Drug sensitivity ( ) ATPase activity (n.s.) Vethanayagam et al. [95] 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334stop rs3201997 Exon 14 2204T>A Phe571Ile rs9282571 SLC15A1 CHO Cephalexin uptake (n.s.)61G>A Val21Ile rs8187818 Cos7 Cephalexin uptake (n.s.) Substrate selectivity (n.s.) CHO Cephalexin uptake ( ) Cos7 Cephalexin uptake ( ) Substrate selectivity (VAC inhibition?)
X
ABCG2 p.Phe208Ser 18673259:85:1592
status: VERIFIED
Login to comment

94 Exon Polymorphism Effect dbSNP Subject Expression Function Reference 114T>C synonymous rs12721640 369C>T synonymous rs2231139 421C>A Gln141Lys rs2231142 Patient (Caucasian) 9-nitrocamptotecin PK (CC CA) 9-aminocamptotecin PK [AUC/Dose] (CC<CA) Zamboni et al. [55] Nasopharyngeal cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CA AA) Colombo et al. [58] Cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) de Jong et al. [90] Patient (Japanese) Placental mRNA (CC CA AA) Placental protein (CC>CA>AA) Kobayashi et al. [91] Cancer patient Diflomotecan PK [AUC, Cmax] (CC<CA), [F] (CC>CA) Sparreboom et al. [96] Healthy (Chinese) Rosuvastatin PK [AUC, Cmax] (CC<CA+AA), [CL/F] (CC>CA+AA), [T1/2, Tmax] (CC CA+AA) Zhang et al. [97] Exon 4 496C>G Gln166Glu rs1061017 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334Stop rs3201997 Exon 14 1711T>A Phe571Ile rs9282571 SLC15A1 61G>A Val21Ile rs8187818Exon 3 83T>A Phe28Tyr rs8187817 258G>A synonymous rs8187823 330C>T synonymous rs8187822 350G>A Ser117Asn rs2297322 351C>A Ser117Arg rs8187821 Exon 5 364G>A Val122Met rs8187820 Exon 7 501C>T synonymous rs3737087 Exon 11 843G>A synonymous r8187812 Exon 15 1147G>A Asp383Asn rs1782674 1179C>T synonymous rs8187836Exon 16 1256G>C Gly419Ara rs4646227 1347T>C synonymous rs1339067 Allelic mRNA imbalance (2030%) Anderle et al. [101] 1348G>A Val450Ile rs2274828 1352C>A Thr451Asn rs8187838 Exon 17 1375C>T Arg459Cys rs2274827 Exon 18 1446A>G synonymous rs8187828 (Table 3) contd….
X
ABCG2 p.Phe208Ser 18673259:94:1030
status: VERIFIED
Login to comment

PMID: 18855611 [PubMed] Zhou SF et al: "Clinical pharmacogenetics and potential application in personalized medicine."
No. Sentence Comment
618 Only a small portion of them are non-synonymous (V12M, Q141K, Q166E, I206L, F208S, S248P, D296H, L525R, A528T, F571I, and Y590N) and there is one frameshift (1515delC) mutation observed in the coding region of ABCG2.
X
ABCG2 p.Phe208Ser 18855611:618:76
status: VERIFIED
Login to comment

PMID: 18958403 [PubMed] Furukawa T et al: "Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations."
No. Sentence Comment
30 Furthermore, the Q141K SNP was reportedly associated with a higher incidence of diarrhea in non-small cell lung cancer patients treated with gefitinib (22).
X
ABCG2 p.Phe208Ser 18958403:30:35
status: NEW
Login to comment

35 Furthermore, certain SNPs, such as F208S and S441N, were found to greatly affect the stability of ABCG2 in the endoplasmic reticulum (ER) and to enhance the protein degradation rate via ubiquitination and proteasomal proteolysis (32).
X
ABCG2 p.Phe208Ser 18958403:35:35
status: VERIFIED
Login to comment

60 The sites of three non-synonymous SNPs, Q141K, F208S and S441N, are indicated.
X
ABCG2 p.Phe208Ser 18958403:60:47
status: VERIFIED
Login to comment

129 Protein expression levels of the WT and the Q141K variant were determined by immunoblotting after PNGase F treatment in the same way as described above.
X
ABCG2 p.Phe208Ser 18958403:129:44
status: NEW
Login to comment

130 As shown in Fig. 3A, the protein level of the Q141K variant was approximately two-fold enhanced by treatment with the proteasome inhibitor MG132.
X
ABCG2 p.Phe208Ser 18958403:130:17
status: NEW
Login to comment

174 The nonsynonymous SNP variants of Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (42).
X
ABCG2 p.Phe208Ser 18958403:174:44
status: VERIFIED
Login to comment

175 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles (18).
X
ABCG2 p.Phe208Ser 18958403:175:17
status: VERIFIED
Login to comment

176 In particular, expression levels of the F208S and S441N variant proteins were markedly low.
X
ABCG2 p.Phe208Ser 18958403:176:40
status: VERIFIED
Login to comment

131 In particular, expression levels of the F208S and S441N variant proteins were markedly low.
X
ABCG2 p.Phe208Ser 18958403:131:40
status: NEW
Login to comment

344 The sites of three nonsynonymous SNPs, Q141K, F208S and S441N, are indicated.
X
ABCG2 p.Phe208Ser 18958403:344:46
status: NEW
Login to comment

PMID: 19111841 [PubMed] Noguchi K et al: "Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy."
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Phe208Ser 19111841:874:453
status: NEW
Login to comment

PMID: 19111842 [PubMed] Wakabayashi-Nakao K et al: "Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation."
No. Sentence Comment
813 Furthermore, certain non-synonymous single nucleotide polymorphisms (SNPs), such as Q141K, F208S, and S441N, were also found to greatly affect the stability of ABCG2 in the endoplasmic reticulum (ER) and to enhance the protein degradation rate via ubiquitination and proteasomal proteolysis [9a,b].
X
ABCG2 p.Phe208Ser 19111842:813:91
status: NEW
Login to comment

950 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin [54].
X
ABCG2 p.Phe208Ser 19111842:950:42
status: NEW
Login to comment

951 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles [34].
X
ABCG2 p.Phe208Ser 19111842:951:17
status: NEW
Login to comment

952 In particular, expression levels of the F208S and S441N variant proteins were markedly low [9a,34].
X
ABCG2 p.Phe208Ser 19111842:952:40
status: NEW
Login to comment

953 5.2. Impact of SNPs on protein stability and function of ABCG2 Our recent study provided evidence that F208S and S441N variant proteins did not undergo Golgi apparatus-mediated glycoprocessing but were passed through the so-called "ERAD" pathway.
X
ABCG2 p.Phe208Ser 19111842:953:103
status: NEW
Login to comment

954 The immature and non-glycosylated forms of F208S and S441N were detected when Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h, suggesting that those variant proteins were ubiquitinated in both pre and post N-glycosylation reactions and then readily degraded in proteasomes.
X
ABCG2 p.Phe208Ser 19111842:954:43
status: NEW
X
ABCG2 p.Phe208Ser 19111842:954:96
status: NEW
Login to comment

PMID: 19200005 [PubMed] Porcelli L et al: "Intracellular trafficking of MDR transporters and relevance of SNPs."
No. Sentence Comment
206 The polymorphisms T623C (F208S), T742C (S248P), T1291C (F431L) and T1465C (F489L) were studied by Tamura et al.
X
ABCG2 p.Phe208Ser 19200005:206:25
status: NEW
Login to comment

207 [98], who showed that, with the exception of the F208S variant, all SNPs exhibited similar levels of protein expression and similar cellular localization as the wild-type ABCG2, on the plasma membrane of Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 19200005:207:49
status: NEW
Login to comment

209 The F208S variant exhibited markedly lower levels of protein expression and drug resistance compared with the wild-type ABCG2 and it was not expressed in the plasma membrane of the Flp-In-293 cells [98].
X
ABCG2 p.Phe208Ser 19200005:209:4
status: NEW
Login to comment

PMID: 19827267 [PubMed] Ishikawa T et al: "Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics."
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004).
X
ABCG2 p.Phe208Ser 19827267:222:58
status: NEW
Login to comment

227 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (Tamura et al., 2006) (Fig. 7C).
X
ABCG2 p.Phe208Ser 19827267:227:42
status: NEW
Login to comment

228 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles Figure 7. Continued WT V12M Q141K F208S S248P F431L S441N F489L R482G R482T Protein expression + + + - + + - + + + MTX transport + + + - - - - +/ - - Porphyrin transport + + + - - + - +/ + + SN-38 resistance + + + - +/ + - - + + MX resistance + + + - - - - - -- - - - - - - - +/ - - - - - - - - + + Doxorubicin resistance + + Daunorubicin resistance + + ATPase activity (Prazosin) + + WTV12M Q141K F431L F489L S248P F208S S441L R482G R482T ∆1.5 ∆3 ∆3.5 ∆5 ∆4 - - - - - - -- - - B 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:51 20     Journal of Experimental Therapeutics and Oncology  Vol. 8  2009 (Tamura et al., 2007b).
X
ABCG2 p.Phe208Ser 19827267:228:17
status: NEW
X
ABCG2 p.Phe208Ser 19827267:228:179
status: NEW
X
ABCG2 p.Phe208Ser 19827267:228:561
status: NEW
Login to comment

229 In particular, expression levels of the F208S and S441N variant proteins were markedly low (Tamura et al., 2007b).
X
ABCG2 p.Phe208Ser 19827267:229:40
status: NEW
Login to comment

230 We have recently shown that F208S and S441N variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the so-called "ERAD" pathway.
X
ABCG2 p.Phe208Ser 19827267:230:28
status: NEW
Login to comment

231 The immature and non-glycosylated forms of F208S and S441N were detected when Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h, suggesting that those variant proteins were ubiquitinated in both pre and post N-glycosylation reactions and then readily degraded in proteasomes.
X
ABCG2 p.Phe208Ser 19827267:231:43
status: NEW
X
ABCG2 p.Phe208Ser 19827267:231:96
status: NEW
Login to comment

232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7.
X
ABCG2 p.Phe208Ser 19827267:232:153
status: NEW
X
ABCG2 p.Phe208Ser 19827267:232:361
status: NEW
Login to comment

PMID: 19909340 [PubMed] Nakagawa H et al: "Disruption of N-linked glycosylation enhances ubiquitin-mediated proteasomal degradation of the human ATP-binding cassette transporter ABCG2."
No. Sentence Comment
22 In fact, the protein expression levels of ABCG2 SNP variants (Q141K, F208S and S441N) were significantly lower than that of the wild-type (WT) ABCG2 [23].
X
ABCG2 p.Phe208Ser 19909340:22:69
status: VERIFIED
Login to comment

PMID: 19949928 [PubMed] Ross DD et al: "Impact of breast cancer resistance protein on cancer treatment outcomes."
No. Sentence Comment
93 Tamura et al. used multicolor fluorescence in situ hybridization to assure uniform mRNA expression of cDNAs of seven BCRP SNPs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) transduced into Flp-In-293 cells (87, 88).
X
ABCG2 p.Phe208Ser 19949928:93:141
status: VERIFIED
Login to comment

94 Protein expression from the F208S and S441N variants was found to be low; the V12M and Q141K alleles had IC50 s for SN-38 that were approximately half that of the wild-type; all the other alleles examined had significantly lower IC50 values for SN-38, mitoxantrone, doxorubicin, daunorubicin and etoposide when compared with wild type alleles (88).
X
ABCG2 p.Phe208Ser 19949928:94:28
status: VERIFIED
Login to comment

PMID: 20518788 [PubMed] Shigeta J et al: "BCRP/ABCG2 confers anticancer drug resistance without covalent dimerization."
No. Sentence Comment
260 We have also reported that two germ line mutations of BCRP in our laboratory, namely 623T>C (F208S) and 1291T>C (F431L), also resulted in the loss of function or severely reduced the function of BCRP.
X
ABCG2 p.Phe208Ser 20518788:260:93
status: VERIFIED
Login to comment

PMID: 20700710 [PubMed] Wakabayashi-Nakao K et al: "Production of cells with targeted integration of gene variants of human ABC transporter for stable and regulated expression using the Flp recombinase system."
No. Sentence Comment
34 Furthermore, certain non-synonymous single nucleotide polymorphisms (SNPs), such as Q141K, F208S, and S441N, were also found to greatly affect the stability of ABCG2 in the ER and to enhance the protein degradation rate via ubiquitination and proteasomal proteolysis in Flp-In-293 cells (22-27) (Fig. 1).
X
ABCG2 p.Phe208Ser 20700710:34:91
status: VERIFIED
Login to comment

226 It was of great interest to know how the inhibition of proteasomal protein degradation by MG132 affects the cellular localization of the F208S and S441N variant proteins (see Notes 5 and 6).
X
ABCG2 p.Phe208Ser 20700710:226:137
status: VERIFIED
Login to comment

245 Figure 3a depicts a schematic illustration of the human ABCG2 protein to indicate the sites of amino acid alteration in the SNP variants of F208S and S441N.
X
ABCG2 p.Phe208Ser 20700710:245:141
status: VERIFIED
Login to comment

247 Notes F208S, and S441N were individually expressed in Flp-In-293 cells by using the Flp recombinase system.
X
ABCG2 p.Phe208Ser 20700710:247:8
status: VERIFIED
Login to comment

248 As shown in Fig. 3b, mRNA levels of ABCG2 WT as well as F208S and S441N were evenly represented in Flp-In-293 cells, where the mRNA levels of ABCG2 and GAPDH were measured by RT-PCR.
X
ABCG2 p.Phe208Ser 20700710:248:56
status: VERIFIED
Login to comment

249 On the other hand, ABCG2 WT, F208S, and S441N as well as GAPDH proteins were detected by immunoblotting, and their expression levels were quantified.
X
ABCG2 p.Phe208Ser 20700710:249:29
status: VERIFIED
Login to comment

253 Schematic illustration of human ABCG2 as well as the expression of ABCG2 WT, F208S, and S441N in Flp-In-293 cells at the mRNA and protein levels.
X
ABCG2 p.Phe208Ser 20700710:253:77
status: VERIFIED
Login to comment

254 (a) Arrows indicate the positions of amino acid substitutions (Phe208Ser and Ser441Asn) in the non-synonymous SNP variants of F208S and S441N.
X
ABCG2 p.Phe208Ser 20700710:254:63
status: VERIFIED
X
ABCG2 p.Phe208Ser 20700710:254:126
status: VERIFIED
Login to comment

259 (b) The mRNA level was analyzed by RT-PCR with total RNA extracted from Flp-In-293 cells expressing ABCG2 WT, F208S, or S441N.
X
ABCG2 p.Phe208Ser 20700710:259:110
status: VERIFIED
Login to comment

265 Although mRNA levels were almost the same in the WT and SNP variants (F208S and S441N), protein levels of those variants were markedly decreased (Fig. 3d).
X
ABCG2 p.Phe208Ser 20700710:265:70
status: VERIFIED
Login to comment

268 Figure 4a shows the effect of ME treatments on the SDS-PAGE migration of ABCG2 WT, F208S, and S441N proteins.
X
ABCG2 p.Phe208Ser 20700710:268:83
status: VERIFIED
Login to comment

270 Immunoblot detection of ABCG2 WT, F208S, and S441N proteins expressed in Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 20700710:270:34
status: VERIFIED
Login to comment

271 (a) Effect of mercaptoethanol (ME) on the status (homodimer or monomer) of ABCG2 WT and the SNP variants. Cell lysate samples (20 mg of protein) were subjected to SDS-PAGE after treatments with or without ME; and, thereafter, ABCG2 WT, F208S, and S441N proteins were detected by immunoblotting with the BXP-21 antibody, as described in Subheading 3.3.3.
X
ABCG2 p.Phe208Ser 20700710:271:236
status: VERIFIED
Login to comment

272 By ME treatments, ABCG2 WT, F208S, and S441N proteins were changed from homodimers to monomers.
X
ABCG2 p.Phe208Ser 20700710:272:28
status: VERIFIED
Login to comment

273 (b) Effect of Endo H or PNGase F treatments on the glycosylated status of ABCG2 WT and the SNP variants. Cell lysate samples (20 mg of protein) were treated with Endo H or PNGase F, as described in Subheading 3.3.3.ABCG2 WT, F208S, and S441N proteins in the resulting samples were analyzed by immunoblotting with the BXP-21 antibody.The apparent molecular weights of mature and non-glycosylated ABCG2 WT were 81,000 and 72,000, respectively.
X
ABCG2 p.Phe208Ser 20700710:273:225
status: VERIFIED
Login to comment

280 These results provide evidence that F208S and S441N proteins form homodimers through a cysteinyl disulfide bond as does the ABCG2 WT protein.
X
ABCG2 p.Phe208Ser 20700710:280:36
status: VERIFIED
Login to comment

285 In the case of the F208S variant, one faint band was detected at the apparent molecular weight of 74,000 by the same sample processing and immunoblotting experiment.
X
ABCG2 p.Phe208Ser 20700710:285:19
status: VERIFIED
Login to comment

289 Although the major band (M.W. = 81,000) of ABCG2 WT was not at all affected by the Endo H treatment, the apparent molecular weights of the smaller protein bands of F208S (M.W. = 74,000) and S441N (M.W. = 78,000) decreased after the Endo H treatment.
X
ABCG2 p.Phe208Ser 20700710:289:178
status: VERIFIED
Login to comment

292 The matured N-linked oligosaccharide of ABCG2 WT may have a structure resistant to Endo H, whereas the immature N-linked oligosaccharides of the F208S and S441N variant proteins are susceptible to this endoglycosidase.
X
ABCG2 p.Phe208Ser 20700710:292:145
status: VERIFIED
Login to comment

295 Flp-In-293 cells expressing F208S or S441N were incubated in the presence of MG132 at different concentrations (0, 0.4, 2.0 mM) for 24 h, and then cell lysate samples were immediately prepared.
X
ABCG2 p.Phe208Ser 20700710:295:28
status: VERIFIED
Login to comment

296 Protein expression levels of the F208S and S441N variants were determined by immunoblotting after PNGase F treatments in the same way as described above.
X
ABCG2 p.Phe208Ser 20700710:296:33
status: VERIFIED
Login to comment

299 After the 24-h treatment with 2 mM MG132, F208S and S441N protein levels were increased 12-and 6-fold, respectively.
X
ABCG2 p.Phe208Ser 20700710:299:42
status: VERIFIED
Login to comment

301 Effects of MG132 on the glycosylation status and protein levels of ABCG2 F208S and S441N variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 20700710:301:73
status: VERIFIED
Login to comment

302 (a) Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4, 2 mM for 24 h.
X
ABCG2 p.Phe208Ser 20700710:302:22
status: VERIFIED
Login to comment

304 ABCG2 F208S and S441N variant proteins were analyzed by immunoblotting with the ABCG2-specific monoclonal antibody (BXP-21) either directly or after PNGase F treatment.The signal intensity of the non-glycosylated form of the ABCG2 F208S or S441N variant was measured after PNGase F treatment.The intensities are represented as ratios relative to the ABCG2 level in MG132-untreated cells.
X
ABCG2 p.Phe208Ser 20700710:304:6
status: VERIFIED
X
ABCG2 p.Phe208Ser 20700710:304:231
status: VERIFIED
Login to comment

308 (b) Detection of aggregated forms (M.W. > 200,000) of ABCG2 F208S and S441N variants.
X
ABCG2 p.Phe208Ser 20700710:308:74
status: VERIFIED
Login to comment

309 Flp-In-293/ABCG2 (F208S) and Flp-In-293/ ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4, 2 mM for 24 h.
X
ABCG2 p.Phe208Ser 20700710:309:18
status: VERIFIED
Login to comment

310 Cell lysate samples (20 mg of protein) were prepared in the presence of ME.ABCG2 F208S and S441N variant proteins were prepared from MG132-treated cells as described above and analyzed by immunoblotting with the BXP-21 antibody without PNGase F treatment.
X
ABCG2 p.Phe208Ser 20700710:310:81
status: VERIFIED
Login to comment

311 The aggregated forms of ABCG2 F208S and S441N are indicated by arrowheads.
X
ABCG2 p.Phe208Ser 20700710:311:30
status: VERIFIED
Login to comment

315 non-glycosylated form (M.W. = 72,000) for both F208S and S441N variants, where those cell lysate samples were not treated with PNGase F (Fig. 5a).
X
ABCG2 p.Phe208Ser 20700710:315:61
status: VERIFIED
Login to comment

316 More importantly, upon the immunoblot analysis without PNGase F treatments, aggregated forms (indicated by arrowheads in Fig. 5b) of both F208S and S441N variants were detected in the high molecular weight range of over 200,000.
X
ABCG2 p.Phe208Ser 20700710:316:139
status: VERIFIED
Login to comment

318 It was of great interest to know how the inhibition of proteasomal protein degradation by MG132 affects the cellular localization of the F208S and S441N variant proteins.
X
ABCG2 p.Phe208Ser 20700710:318:137
status: VERIFIED
Login to comment

323 Immunocytochemical staining of Flp-In-293 cells expressing ABCG2 S441N protein (a) and immunoelectron microscopic image of Flp-In-293 cells expressing ABCG2 F208S protein (b).
X
ABCG2 p.Phe208Ser 20700710:323:157
status: VERIFIED
Login to comment

PMID: 20812902 [PubMed] Ni Z et al: "Structure and function of the human breast cancer resistance protein (BCRP/ABCG2)."
No. Sentence Comment
249 A systematic study of 18 natural variants of BCRP expressed in insect cells showed that the variants Q126stop, F208S, S248P, E334stop, and S441N were defective in porphyrin transport, whereas F489L displayed approximately 10% of the transport activity of wild-type BCRP [120].
X
ABCG2 p.Phe208Ser 20812902:249:111
status: VERIFIED
Login to comment

PMID: 21103975 [PubMed] Meyer zu Schwabedissen HE et al: "In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2)."
No. Sentence Comment
256 Similar results were obtained for the c.623T>C (p.F208S, AF not determined) variant (Nakagawa et al. 2008; Tamura et al. 2006).
X
ABCG2 p.Phe208Ser 21103975:256:50
status: VERIFIED
Login to comment

PMID: 21184741 [PubMed] Sugiyama T et al: "Posttranslational negative regulation of glycosylated and non-glycosylated BCRP expression by Derlin-1."
No. Sentence Comment
29 Moreover, the certain single nucleotide polymorphism (SNP) variants of BCRP (Q141K, F208S and S441N), which protein expression was markedly low despite the functional expression of mRNA, were also degraded by ERAD [10,11].
X
ABCG2 p.Phe208Ser 21184741:29:84
status: VERIFIED
Login to comment

162 These include naturally occurring SNPs variants of BCRP such as Q141K, F208S and S441N [10,11].
X
ABCG2 p.Phe208Ser 21184741:162:71
status: VERIFIED
Login to comment

PMID: 21188243 [PubMed] Ishikawa T et al: "Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis."
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90].
X
ABCG2 p.Phe208Ser 21188243:167:174
status: NEW
Login to comment

168 The variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Figure 4(b)).
X
ABCG2 p.Phe208Ser 21188243:168:23
status: NEW
Login to comment

170 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a.
X
ABCG2 p.Phe208Ser 21188243:170:32
status: NEW
Login to comment

177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms.
X
ABCG2 p.Phe208Ser 21188243:177:139
status: NEW
X
ABCG2 p.Phe208Ser 21188243:177:339
status: NEW
Login to comment

PMID: 21203549 [PubMed] Taghizadeh R et al: "CXCR6, a newly defined biomarker of tissue-specific stem cell asymmetric self-renewal, identifies more aggressive human melanoma cancer stem cells."
No. Sentence Comment
80 First, as shown in Table 1, we analyzed three polymorphisms C/A (421 C.A), C/T (S248T) and C/T (F208S) in the unsorted populations and in the ABCG2+ and ABCG2- sorted subpopulations revealing a heterozygous status of ABCG2 for all the three polymorphisms.
X
ABCG2 p.Phe208Ser 21203549:80:96
status: VERIFIED
Login to comment

83 Moreover, F208S and S248P polymorphisms were associated with defective active transport of methotrexate and haematoporphyrin [24]; and, in particular, F208S variant proteins (both-glycosylated and immature forms) are recognized as misfolded proteins by putative ''check point`` systems and readily undergo ubiquination and protein degradation in proteasomes [25].
X
ABCG2 p.Phe208Ser 21203549:83:10
status: VERIFIED
X
ABCG2 p.Phe208Ser 21203549:83:151
status: VERIFIED
Login to comment

103 Cells 421 C.A (C/A) S248P (C/T) F208S (C/T) IGR37 CA CT CT IGR39 CA CT CT ABCG2+ IGR37 CA CT CT ABCG2- IGR37 CA CT CT ABCG2+ IGR39 CA CT CT ABCG2- IGR39 CA CT CT doi:10.1371/journal.pone.0015183.t001 unsorted IGR37 cells (0.13 grams vs. 1.4 grams, respectively; p,0.01) 2 months after the injection of the cells (Table 1).
X
ABCG2 p.Phe208Ser 21203549:103:32
status: VERIFIED
Login to comment

297 SNP analysis DNA was extracted from cells using a salting-out method [28] Genotyping for ABCG2 421 C.A (assay ID: C__15854163_70), S248P (assay ID: C__27458615_40) and F208S (assay ID: C__8826940_10) single nucleotide polymorphisms (SNPs) were performed using Validated TaqMan Genotyping Assay (Applied Biosystems).
X
ABCG2 p.Phe208Ser 21203549:297:168
status: VERIFIED
Login to comment

PMID: 21567408 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts."
No. Sentence Comment
155 Effect of Mutations and Nonsynonymous SNPs on Protein Trafficking, Maturation, or ERAD of ABC Transporters Protein AA Mutation/SNP Effect on Protein Reference ABCA1 W590S Mutation Functional defect 115 R587W Mutation Impaired glycol processing 115 Q597R Mutation Impaired glycol processing, ERAD 115,116 Y1532C Mutation Altered protein trafficking 117 R1925Q Mutation Altered protein trafficking 118 ABCA3 R43L Mutation Altered protein trafficking 119 L101P Mutation Altered protein trafficking 119 R280C Mutation Altered protein trafficking 119 ABCA4 L541P Mutation Mislocalization 120 R602W Mutation Mislocalization 120 A1038V Mutation Mislocalization 120 C1490Y Mutation Mislocalization 120 ABCB1a G268V Mutation ERAD 121 G341C Mutation ERAD 121 I1196S Mutation Reduced glycosylation 122 ABCB4 I541F Mutation Accumulation in ER 123 ABCB11a E135K Mutation Reduced level of mature protein 124 L198P Mutation Reduced level of mature protein 124 E297G Mutation Reduced level of mature protein 124 L413W Mutation Reduced level of mature protein 124 R432T Mutation Reduced level of mature protein 124 D482G Mutation Immature protein in ER 124,125 N490D Mutation Reduced level of mature protein 124 A570T Mutation Reduced level of mature protein 124 T655I Mutation Reduced level of mature protein 124 Y818F SNP Moderate reduction of protein 124 G982R Mutation Retention in ER 125 R1153C Mutation ERAD 125 R1286Q Mutation Retention in ER 125 ABCC2a R768W Mutation Impaired protein trafficking 126 I1173F Mutation Impaired protein maturation 127 R1392 Mutation Impaired protein maturation 128 M1393 Mutation Impaired protein maturation 129 ABCC4a E757K SNP Altered protein trafficking 23 ABCC7 F508 Mutation Misfolding, ERAD 36-39,130 G85E Mutation Impaired protein maturation 130-132 G91R Mutation Impaired protein maturation 130-132 N1303K Mutation Impaired protein maturation 130-132 ABCC8 WT Wild type Ubiquitin-proteasome degradation 133 A116P Mutation Ubiquitin-proteasome degradation 133 V187D Mutation Ubiquitin-proteasome degradation 133 F1388 Mutation Impaired protein trafficking 134 L1544P Mutation Impaired protein trafficking 135,136 ABCC11a G180R SNP Ubiquitin-proteasome degradation 50 27 Mutation Ubiquitin-proteasome degradation 50 ABCG2a V12M SNP Altered protein localization 96 Q141K SNP Ubiquitin-proteasome degradation 102 F208S SNP Ubiquitin-proteasome degradation 78,99 S441N SNP Ubiquitin-proteasome degradation 78,99 Mutations of ABCA1, ABCA3, ABCA4, ABCB4, ABCB11, ABCC2, ABCC7 (CFTR), and ABCC8 are associated with Tangier disease, fatal surfactant deficiency, Stargardt disease, progressive familial intrahepatic cholestasis type 3 (PFIC-3), progressive familial intrahepatic cholestasis type 2 (PFIC-2), Dubin-Johnson syndrome, cystic fibrosis, and familial hyperinsulinism, respectively.
X
ABCG2 p.Phe208Ser 21567408:155:2339
status: NEW
Login to comment

76 Furthermore, the nonsynonymous SNPs of Q141K, F208S, and S441N (Fig. 4) have been found to greatly affect APCG2 protein levels in the plasma membrane.
X
ABCG2 p.Phe208Ser 21567408:76:46
status: NEW
Login to comment

78 Q141K (Gln141Lys), F208S (Phe208Ser), and S441N (Ser441Asn) are nonsynonymous SNPs that cause the reduced expression of ABCG2 protein.
X
ABCG2 p.Phe208Ser 21567408:78:19
status: NEW
X
ABCG2 p.Phe208Ser 21567408:78:26
status: NEW
Login to comment

118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected.
X
ABCG2 p.Phe208Ser 21567408:118:226
status: NEW
X
ABCG2 p.Phe208Ser 21567408:118:350
status: NEW
X
ABCG2 p.Phe208Ser 21567408:118:539
status: NEW
X
ABCG2 p.Phe208Ser 21567408:118:757
status: NEW
Login to comment

119 When Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells were treated with MG132 for 24 h, the protein levels of F208S and S441N variants were greatly enhanced (Fig. 6a).
X
ABCG2 p.Phe208Ser 21567408:119:23
status: NEW
X
ABCG2 p.Phe208Ser 21567408:119:121
status: NEW
Login to comment

121 Immunoelectron microscopy has clearly demonstrated that aggresomes were formed in Flp-In-293/ABCG2 (F208S) cells treated with MG132 (Fig. 6c).
X
ABCG2 p.Phe208Ser 21567408:121:100
status: NEW
Login to comment

128 Effects of MG132 on the glycosylation status and protein levels of ABCG2 F208S, and S441N variants expressed in Flp-In-293 cells.
X
ABCG2 p.Phe208Ser 21567408:128:73
status: NEW
Login to comment

129 (a) Flp-In-293 cells expressing ABCG2 F208S or S441N variants were incubated with MG132 at concentrations of 0, 0.4, and 2 :M for 24 h. Cell lysate samples (20 :g of protein) were prepared in the presence of 2-mercaptethanol (ME).
X
ABCG2 p.Phe208Ser 21567408:129:38
status: NEW
Login to comment

130 ABCG2 F208S, and S441N variant proteins were analyzed by immunoblotting with the ABCG2- specific monoclonal antibody (BXP-21) either directly or after PNGase F treatment. The signal intensity of the nonglycosylated form of the ABCG2 F208S or S441N variant was measured after PNGase F treatment. The intensities are represented as ratios relative to the ABCG2 level in MG132-untreated cells. Data are expressed as mean values ± SD in triplicate experiments (* p < 0.05).
X
ABCG2 p.Phe208Ser 21567408:130:6
status: NEW
X
ABCG2 p.Phe208Ser 21567408:130:233
status: NEW
Login to comment

133 (b) Detection of aggregated forms (MW > 200,000) of ABCG2 F208S and S441N variants.
X
ABCG2 p.Phe208Ser 21567408:133:58
status: NEW
Login to comment

134 Flp-In-293/ABCG2 (F208S) and Flp-In-293/ ABCG2 (S441N) cells were incubated with MG132 at concentrations of 0, 0.4, and 2 :M for 24 h. Cell lysate samples (20 :g of protein) were prepared in the presence of ME.
X
ABCG2 p.Phe208Ser 21567408:134:18
status: NEW
Login to comment

135 ABCG2 F208S and S441N variant proteins were prepared from MG132-treated cells and analyzed by immunoblotting with the BXP-21 antibody without PNGase F treatment. The aggregated forms of ABCG2 F208S and S441N are indicated by arrowheads.
X
ABCG2 p.Phe208Ser 21567408:135:6
status: NEW
X
ABCG2 p.Phe208Ser 21567408:135:192
status: NEW
Login to comment

136 (c) Immunoelectron microscopic image of Flp-In-293 cells expressing ABCG2 F208S protein.
X
ABCG2 p.Phe208Ser 21567408:136:74
status: NEW
Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined.
X
ABCG2 p.Phe208Ser 20103563:6589:163
status: NEW
Login to comment

PMID: 22248732 [PubMed] Natarajan K et al: "Role of breast cancer resistance protein (BCRP/ABCG2) in cancer drug resistance."
No. Sentence Comment
3488 Recently, evidence was presented that polymorphisms resulting in the variants F208S and S441N cause diminished BCRP protein levels by virtue of ubiquitin-mediated proteasomal degradation [100].
X
ABCG2 p.Phe208Ser 22248732:3488:78
status: NEW
Login to comment

PMID: 22081364 [PubMed] Plante I et al: "Rosuvastatin blocks hERG current and prolongs cardiac repolarization."
No. Sentence Comment
24 Transfection Procedure In order to evaluate the effects of different transporters on the block of hERG by rosuvastatin, the hERG-stably transfected HEK 293 cells were transiently transfected with 10 :g of a recombinant pIRES2 vector expressing the green fluorescent protein (GFP) and one or the other of the following transporters: efflux transporter BCRP (strong affinity for rosuvastatin), loss of function variants of BCRP (BCRP-F208S, BCRP-S441N, and BCRP-Q141K), the influx transporters OATP2B1 (strong affinity for rosuvastatin), and multidrug resistance gene (MDR1) (an efflux transporter showing weak affinity for rosuvastatin).
X
ABCG2 p.Phe208Ser 22081364:24:432
status: NEW
Login to comment

28 Site-Directed Mutagenesis The three loss-of-function variants of BCRP (BCRP-F208S, BCRP-S441N, and BCRP-Q141K) were Figure 1.
X
ABCG2 p.Phe208Ser 22081364:28:76
status: NEW
Login to comment

88 Then, we performed site-directed mutagenesis on BCRP and produced three variants associated with a loss of function of the protein: C421A (Q141K), T623C (F208S), and G1322A (S441N).34-36 The coexpression of hERG with one or the other of these variants blunted the effects observed with the native efflux transporter BCRP, that is, the block was in the order of 40%.
X
ABCG2 p.Phe208Ser 22081364:88:154
status: NEW
Login to comment

89 Indeed, inhibition of hERG was 40 ± 4 (n = 5), 41 ± 7 (n = 7), and 41 ± 4 (n = 7) for Q141K, F208S, and S441N, respectively (all not different from control, but different from HEK 293-hERG cells with functional transporters; p < 0.05).
X
ABCG2 p.Phe208Ser 22081364:89:108
status: NEW
Login to comment

111 Inhibition of current activity was also determined in cells expressing transporters with a loss of function in BCRP activity due to mutations (BCRP-F208S, BCRP-S441N, and BCRP-Q141K).
X
ABCG2 p.Phe208Ser 22081364:111:148
status: NEW
Login to comment

138 We also tested the effects of rosuvastatin on hERG in the presence of three loss-of-function polymorphisms of BCRP (Q141K, F208S, and S441N) and observed a block comparable to the one found in the control cells (≈42%).
X
ABCG2 p.Phe208Ser 22081364:138:123
status: NEW
Login to comment

PMID: 19414346 [PubMed] Katayama K et al: "Pharmacological interplay between breast cancer resistance protein and gefitinib in epidermal growth factor receptor signaling."
No. Sentence Comment
150 Cells containing a T623C (F208S) BCRP cDNA express only marginal levels of BCRP protein, and resistance to SN-38 is not observed (27).
X
ABCG2 p.Phe208Ser 19414346:150:26
status: NEW
Login to comment

148 Cells containing a T623C (F208S) BCRP cDNA express only marginal levels of BCRP protein, and resistance to SN-38 is not observed (27).
X
ABCG2 p.Phe208Ser 19414346:148:26
status: NEW
Login to comment

PMID: 24777822 [PubMed] Jani M et al: "Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics."
No. Sentence Comment
87 Four variants are found with allele frequencies above 3 % in at least one of the studied population (African American, Asian, and Caucasian): Val12Met (V12M), Gln141Lys (Q141K), Phe208Ser (F208S), and Asp590Tyr (N590Y).
X
ABCG2 p.Phe208Ser 24777822:87:178
status: NEW
X
ABCG2 p.Phe208Ser 24777822:87:189
status: NEW
Login to comment

89 Mutation F208S, on the other hand, evokes a total loss of transporter activity with no detectable protein expression.
X
ABCG2 p.Phe208Ser 24777822:89:9
status: NEW
Login to comment

90 Allele frequency of F208S is below 4 % in Asian and below 1 % in African populations (Ieiri 2012b; Tamura et al. 2006).
X
ABCG2 p.Phe208Ser 24777822:90:20
status: NEW
Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells.
X
ABCG2 p.Phe208Ser 25036722:201:189
status: NEW
Login to comment

203 A model study on plasma membrane vesicles showed that mutations the Glu126 stop, Phe208 Ser, Ser248 Phe, Glu334 stop and Ser441 Asn lead to an inability to transport hematoporphyrin.
X
ABCG2 p.Phe208Ser 25036722:203:81
status: NEW
Login to comment

206 Moreover, Flp-In-293 cells expressing the variants Phe208 Ser, Ser248 Phe, Ser441 Asn and Phe489 Leu were light sensitive when treated with Pheide.
X
ABCG2 p.Phe208Ser 25036722:206:51
status: NEW
Login to comment

209 Position Type of mutation Effect on the transporter References NBD Lys 86 Met (i) No stimulation of the ATPase activity by prazosin; (ii) no influence on the transport of mitoxantrone Henriksen et al. (2005b) Glu 126 stop, Phe 208 Ser, Ser 248 Phe, Glu 334 stop Inability to transport hematoporphyrin Tamura et al. (2006) Glu 211 Gln Complete abolishment of the ATPase activity and methotrexate transport Hou et al. (2009) Pro 392 Ala Significant reduction in the efflux activity of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Ni et al. (2011) TM1 Gly 406 Ala Gly 410 Ala No influence on the activity of the transporter Polgar et al. (2004) Gly 406 Leu Gly 410 Leu (i) Loss of the ability to transport rhodamine123; (ii) impaired transport of mitoxantrone, Pheide and BODIPY-prazosin Polgar et al. (2004) Extracellular loop 1 Phe 431 Leu (i) Loss of the ability to transport methotrexate; (ii) 10% level of hematoporphyrin transport compared to the WT protein Tamura et al. (2006) Ser 441 Asn Inability to transport hematoporphyrin Tamura et al. (2006) Ser 441 Asn Loss of the ability to transport methotrexate Tamura et al. (2006) TM2 Lys 452 Ala His 457 Ala Increase in transport of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Cai et al. (2010) Lys 453 Ala Arg 465 Ala Decrease in transport of mitoxantrone, BODIPY-prazosin, Hoechst 33342, doxorubicin, SN-38 and rhodamine 123 Cai et al. (2010) TM3 Arg 482 Gly Arg 482 Thr (i) No change in the inhibitory activity of lapatinib; (ii) about two times greater inhibition by ritonavir, saquinavir and nalfinavir than in the WT variant; (iii) gaining the ability to transport rhodamine123 and doxorubicin; (iv) no influence on the transport of mitoxantrone; (v) loss of the ability to transport methotrexate Dai et al. (2008), Gupta et al. (2004), Honjo et al. (2001), Mitomo et al. (2003) Arg 482 Thr (i) Lower IC 50 of cyclosporine A for mutant than for WT variant; (ii) lower elacridar inhibition potency Xia et al. (2007) Arg 482 Lys Complete loss of transport activity Ejendal et al. (2006) Phe 489 Leu Impaired transport of porphyrins, no transport of methotrexate Tamura et al. (2006) Extracellular loop 3 Asn 590 Tyr Over twice reduced transport of mitoxantrone, topotecan, daunorubicin and rhodamine 123 Vethanayagam et al. (2005) Cys 592 Ala/Cys 608 Ala (i) Transport of mitoxantrone almost unchanged; (ii) transport of BODIPY-prazosin significantly impaired Henriksen et al. (2005a) Extracellular loop 3 Cys 603 Ser Cys 592 Ser/Cys 608 Ser Cys 592 Ser/Cys 603 Ser/Cys 608 Ser Diminished susceptibility to the inhibitory activity of fumitremorgin C Shigeta et al. (2010) Cys-less Arg 482 Gly-BCRP Complete loss of the ability to efflux mitoxantrone Liu et al. (2008b) The positions of the amino acid residues refer to the topological model of BCRP proposed by Wang et al. (2009).
X
ABCG2 p.Phe208Ser 25036722:209:223
status: NEW
Login to comment

PMID: 25236865 [PubMed] Mao Q et al: "Role of the breast cancer resistance protein (BCRP/ABCG2) in drug transport--an update."
No. Sentence Comment
218 V12M resulting from the 34G>A SNP and other variants (e.g., I206L, F208S, N590Y, and D620N) display expression levels and drug resistance profiles comparable to wild-type BCRP (100,101).
X
ABCG2 p.Phe208Ser 25236865:218:67
status: NEW
Login to comment