ABCMdb

ABCG2 p.Gln166Glu

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 12544509 [PubMed] Zamber CP et al: "Natural allelic variants of breast cancer resistance protein (BCRP) and their relationship to BCRP expression in human intestine."

No. Sentence Comment

125 Unauthorized reproduction of this article is prohibited. G34A V12M Exon 2 C71T1 A24V Exon 2 623C1 F208S Exon 6 A616C I206L Exon 6 C496G1 Q166E Exon 5 C421A Q141K Exon 5 A1444G2 R482G Exon 12 G1445C3 R482T Exon 12 A1768T N590Y Exon 15 Walker A motif: amino acids 80-89 Walker B motif: amino acids 206-210 SNPs found in human samples in this study Reported in ABCP1 Drug selected variants, MXR2 and BCRP3 MXR BCRP Fig. 1 BCRP protein topology and the positions of the identified SNPs resulting in missense mutations. Login to comment

PMID: 15553238 [PubMed] Kondo C et al: "Functional analysis of SNPs variants of BCRP/ABCG2."

No. Sentence Comment

3 The cellular localization was identified using the wild type and seven different SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) after transfection of their cDNAs in plasmid vector to LLC-PK1 cells. Login to comment
8 Furthermore, the transport activity of E1S, DHEAS, MTX, and PAH normalized by the expression level of BCRP protein was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP. Login to comment
29 We constructed expression systems for the wild type and SNPs variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, S441N BCRP) and examined whether these SNPs variants of BCRP alter its localization, expression level, and transport activity. Login to comment
42 Using site-directed mutagenesis, SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S and S441N BCRP) were constructed on pcDNA3.1 vector (SNPs type BCRP/pcDNA3.1). Login to comment
47 Q166E BCRP was amplified with 5Ј-GATTAACAGGGTCATT- GAAGAGTTAGGTCT-3Ј and 5Ј-CCAGACCTA- ACTCTTCAATGACCCTGTTAA-3Ј. Login to comment
52 For SNPs type BCRPs, viruses were prepared in the same way, resulting in the production of pAd-SNPs BCRP (pAd-V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
110 Except for two SNP variants of BCRP (Q141K and S441N BCRP), the ATP-dependent uptakes per mg membrane protein of SNP variants (V12M, A149P, R163K, Q166E, P269S BCRP) were similar to that of the wild-type BCRP (Fig. 3a). Login to comment
114 As shown in Fig. 3b, the transport activity of other SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP) was almost identical to that of the wild-type BCRP. Login to comment
120 Figure 5a shows the ATP-dependent uptake of DHEAS, PAH, and MTX per mg membrane protein for the wild-type and SNPs BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
162 For these compounds, our results indicated that the transport activity per BCRP molecule for 6 kinds of SNP variants (V12M, A149P, R163K, Q166E, P269S, and also Q141K BCRP) is almost the same as that of the wild type BCRP (Figs. Login to comment

PMID: 15743976 [PubMed] Vethanayagam RR et al: "Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N."

No. Sentence Comment

220 Several other BCRP variants occurring at much lower allele frequencies (0.5-1%) such as A149P, R163K, Q166E, P269S, and S441N have also been characterized (Kondo et al., 2004). Login to comment

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."

No. Sentence Comment

157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region. Login to comment

PMID: 16160819 [PubMed] Ishikawa T et al: "Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design."

No. Sentence Comment

118 For this purpose, we have created variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) by site-directed mutagenesis. Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."

No. Sentence Comment

250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment
255 For this purpose, variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G and R482T) were created by site-directed mutagenesis (Figure 3). Login to comment

PMID: 16303243 [PubMed] Yanase K et al: "Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development."

No. Sentence Comment

92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

PMID: 16337740 [PubMed] Cervenak J et al: "The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology."

No. Sentence Comment

97 According to the first cloning studies, the ABCG2 cDNA obtained from normal human placenta [8] showed the following sequence alterations, as compared to the database reference sequence: c.71COT (A24V), c.496COG (Q166E) and c.623TOC (F208S). Login to comment
147 In a recent study, similarly LLC-PKI cells where used to express the V12M and Q141K variants and additionally five other polymorphisms (A149P, R163K, Q166E, P269S and S441N [55]). Login to comment

PMID: 16399366 [PubMed] Ishikawa T et al: "High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics."

No. Sentence Comment

115 For this purpose, variant forms (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) have been created by site‐ directed mutagenesis with the QuikChange site‐directed mutagensis kit (Stratagene, La Jolla, CA). Login to comment

PMID: 16608919 [PubMed] Tamura A et al: "Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport."

No. Sentence Comment

2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
236 The most recent version of National Center for Biotechnology Information dbSNP does not seem to have validation for Q166E, F208S, S248P, and E334stop (Table 2) as bona fide SNPs. Login to comment

PMID: 16877258 [PubMed] Wakabayashi K et al: "Human ABC transporter ABCG2 in xenobiotic protection and redox biology."

No. Sentence Comment

176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment

PMID: 17015488 [PubMed] Sarkadi B et al: "Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system."

No. Sentence Comment

827 In the first cloning of the ABCG2 cDNA from human placenta (8), several sequence alterations causing amino acid changes, including A24V, Q166E, and F208S, were recorded, compared with the database reference sequence. Login to comment

PMID: 17228519 [PubMed] Tamura A et al: "Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system."

No. Sentence Comment

142 Finally, the acquired mutants R482G and R482T form another group, which is characteristic Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 9 Table 3 Remarks mRNA Protein Author Ref Host cell Vector Expression SNP expression expression Imai et al. (15) PA317 pHaL-IRES-DHFR bicistronic Stable V12M Similar to WT Similar to WT - - retrovirus vector plasmid - Q141K Similar to WT Lower than WT Mizuarai et al. (18) LLC-PK1 pcDNA3.1(+) Stable V12M Similar to WT N.D. - - - - Q141K Similar to WT N.D. Morisaki et al. (25) HEK293 pcDNA3.1 Stable V12M Vary among clones Vary among clones - - - - Q141K Vary among clones Vary among clones - - - - D620N Vary among clones Vary among clones Kondo et al. (26) LLC-PK1/ pcDNA3.1/ Stable/ V12M N.D. Similar to WT - HEK293 Adenovirus Transient Q141K N.D. 30 - 40% of WT - - - - A149P N.D. Similar to WT - - - - R163K N.D. Similar to WT - - - - Q166E N.D. Similar to WT - - - - P269S N.D. Similar to WT - - - - S441N N.D. Lower than WT Vethanayagam (27) HEK293 pcDNA3.1/myc-His(-) Stable I206L N.D. Vary among clones et al. - - - - N590Y N.D. Vary among clones - - - - D620N N.D. Vary among clones N.D.: No data Table 2. Login to comment

PMID: 17237154 [PubMed] Lee SS et al: "Identification and functional assessment of BCRP polymorphisms in a Korean population."

No. Sentence Comment

155 Recently, Kondo et al. (2004) reported the identification of several BCRP variants, which include A149P, R163K, Q166E, P269S, and S441N, in human cell lines. Login to comment

PMID: 17373578 [PubMed] Yoshioka S et al: "The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein."

No. Sentence Comment

43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study. Login to comment
45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1. Login to comment
75 SN-38 Resistance Levels of PA317 Transfectantsa Cell type IC50 (nmol/L) Degree of resistance PA317 11 T 0.2 1 PA/WT 550 T 16 50 PA/V12M 490 T 13 45 PA/Q141K 110 T 5.9 10 PA/T153M 260 T 15 24 PA/Q166E 680 T 40 62 PA/F208S 10 T 0.7 1 PA/F431L 34 T 0.9 3 PA/D620N 190 T 5.7 17 a Cells were cultured for 5 days with various concentrations of SN-38. Login to comment
80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N). Login to comment
81 G51C, T153M, Q166E, I206L, F208S and S248P are located in the intracellular domain of the protein (Fig. 1 and Table I). Login to comment
89 PA/Q166E cells expressed higher amounts of BCRP (70-kDa) than PA/WT cells (Fig. 2a). Login to comment
96 The cell surface expression of BCRP in PA/Q166E cells was slightly higher compared with PA/WT cells (Fig. 2d). Login to comment
104 Additional transfectants (PA/G51C, PA/Q166E, PA/I206L, PA/S248P, and PA/N590Y cells) showed no change in their drug resistance profiles to SN-38 compared with PA/WT cells (Table II). Login to comment
128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function. Login to comment
143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain. Login to comment

PMID: 17504223 [PubMed] Xia CQ et al: "Evaluation of drug-transporter interactions using in vitro and in vivo models."

No. Sentence Comment

119 The function of seven single nucleotide polymorphisms (SNPs) in BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) was determined using membrane vesicles from HEK293 cells infected with the recombinant adenoviruses containing the corresponding BCRP cDNAs [45]. Login to comment
121 Furthermore, the transport rate of estrone sulfate, dehydroepiandrosterone sulfate (DHEAS), methotrexate, and p-aminohippurate was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP variants when it is normalized by the expression levels of BCRP protein. Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

PMID: 18363541 [PubMed] Tamura A et al: "Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems."

No. Sentence Comment

230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult. Login to comment

PMID: 18668433 [PubMed] Koshiba S et al: "Human ABC transporters ABCG2 (BCRP) and ABCG4."

No. Sentence Comment

225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."

No. Sentence Comment

85 Exon Polymorphism Effect dbSNP Cell Expression Function Reference mRNA ( ) Protein (n.s.) Membrane localization (n.s.) Drug sensitivity (n.s.) Mitoxantrone efflux (n.s.) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity (n.s.) Mizuarai et al. [88] Sf9 Protein ( ) ATPase activity (n.s.) Hoechst 33342 efflux ( ) Morisaki et al. [92] Exon 2 114T>C synonymous rs12721640 Exon 4 369C>T synonymous rs2231139 PA317 mRNA (n.s.) Protein ( ) Drug sensitivity ( ) Intracellular uptake ( ) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (n.s.) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] LLC-PK1 Apical localization (n.s.) Kondo et al. [94] mRNA ( ) Protein (n.s.) Membrane localization (impaired) Drug sensitivity ( ) Mitoxantrone efflux ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein ( ) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity ( ) Mizuarai et al. [88] 421C>A Gln141Lys rs2231142 Sf9 Protein (n.s.) ATPase activity ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] LLC-PK1 Apical localization (n.s.) Exon 5 496C>G Gln166Glu rs1061017 HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 HEK293 Protein ( or n.s.) Membrane localization (n.s.) Efflux activity ( ) Drug sensitivity ( ) ATPase activity (n.s.) Vethanayagam et al. [95] 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334stop rs3201997 Exon 14 2204T>A Phe571Ile rs9282571 SLC15A1 CHO Cephalexin uptake (n.s.)61G>A Val21Ile rs8187818 Cos7 Cephalexin uptake (n.s.) Substrate selectivity (n.s.) CHO Cephalexin uptake ( ) Cos7 Cephalexin uptake ( ) Substrate selectivity (VAC inhibition?) Login to comment
94 Exon Polymorphism Effect dbSNP Subject Expression Function Reference 114T>C synonymous rs12721640 369C>T synonymous rs2231139 421C>A Gln141Lys rs2231142 Patient (Caucasian) 9-nitrocamptotecin PK (CC CA) 9-aminocamptotecin PK [AUC/Dose] (CC<CA) Zamboni et al. [55] Nasopharyngeal cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CA AA) Colombo et al. [58] Cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) de Jong et al. [90] Patient (Japanese) Placental mRNA (CC CA AA) Placental protein (CC>CA>AA) Kobayashi et al. [91] Cancer patient Diflomotecan PK [AUC, Cmax] (CC<CA), [F] (CC>CA) Sparreboom et al. [96] Healthy (Chinese) Rosuvastatin PK [AUC, Cmax] (CC<CA+AA), [CL/F] (CC>CA+AA), [T1/2, Tmax] (CC CA+AA) Zhang et al. [97] Exon 4 496C>G Gln166Glu rs1061017 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334Stop rs3201997 Exon 14 1711T>A Phe571Ile rs9282571 SLC15A1 61G>A Val21Ile rs8187818Exon 3 83T>A Phe28Tyr rs8187817 258G>A synonymous rs8187823 330C>T synonymous rs8187822 350G>A Ser117Asn rs2297322 351C>A Ser117Arg rs8187821 Exon 5 364G>A Val122Met rs8187820 Exon 7 501C>T synonymous rs3737087 Exon 11 843G>A synonymous r8187812 Exon 15 1147G>A Asp383Asn rs1782674 1179C>T synonymous rs8187836Exon 16 1256G>C Gly419Ara rs4646227 1347T>C synonymous rs1339067 Allelic mRNA imbalance (2030%) Anderle et al. [101] 1348G>A Val450Ile rs2274828 1352C>A Thr451Asn rs8187838 Exon 17 1375C>T Arg459Cys rs2274827 Exon 18 1446A>G synonymous rs8187828 (Table 3) contd…. Login to comment

PMID: 18855611 [PubMed] Zhou SF et al: "Clinical pharmacogenetics and potential application in personalized medicine."

No. Sentence Comment

618 Only a small portion of them are non-synonymous (V12M, Q141K, Q166E, I206L, F208S, S248P, D296H, L525R, A528T, F571I, and Y590N) and there is one frameshift (1515delC) mutation observed in the coding region of ABCG2. Login to comment
636 The localization of other variants including V12M, A149P, R163K, Q166E, P269S and S441N was also examined. Login to comment

PMID: 19111841 [PubMed] Noguchi K et al: "Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy."

No. Sentence Comment

874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

PMID: 19200005 [PubMed] Porcelli L et al: "Intracellular trafficking of MDR transporters and relevance of SNPs."

No. Sentence Comment

201 Along with the above mentioned G34A, C421A and G1322A ABCG2 variants, the authors also studied the G445C (A149P), G488A (R163K), C496G (Q166E) and C805T (P269S) polymorphisms. Login to comment

PMID: 19633067 [PubMed] Deeken JF et al: "Identification of compounds that correlate with ABCG2 transporter function in the National Cancer Institute Anticancer Drug Screen."

No. Sentence Comment

165 Nucleotide Change Amino Acid Reference Sequence Cell Lines Heterozygote Variants Homozygote Variants Intron 1 rs2622604 MOLT4, HOP-92, HCC2998, SF539, SNB19, SNB75, U251, SKMEL5, OVCAR3, OVCAR8, RXF393, TK10, NCI ADR-RES, MDA-MB-231, HS578T, 786-0 SW620, OVCAR 5, BT549, T47D 914CϾA Q141K rs2231142 A549, COLO205, HCT116, SF295, MALME-3M, SKOV-3, CAKI-1, HOP62, HOP92, MDA-MB-231 LOX IMVI, A498 862CϾT Y123Y rs2231139 None None 989CϾG Q166E rs1061017 None None 1057AϾG G188G rs3116439 None None 1116TϾC F208S rs1061018 None None 1235TϾC S248P rs3116448 None None 1493GϾT E334* rs3201997 None None levels of P-gp or MRP1 did not improve PCCs (data not shown). Login to comment

PMID: 19827267 [PubMed] Ishikawa T et al: "Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics."

No. Sentence Comment

222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004). Login to comment
232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7. Login to comment

PMID: 21103975 [PubMed] Meyer zu Schwabedissen HE et al: "In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2)."

No. Sentence Comment

257 No effect on the in vitro transport activity was seen for the missense mutations c.445G>C (p.A149P; AF 0.01), c.458C>T (p.T153M; AF 0.033) c.496C>G (p.Q166E, AF not determined) c.616A>C (I206L AF not determined), c.488G>A (p.R163K AF 0.006), c.805C>T (p.P269S AF 0.006), and c.1711T>A (p.F571L, AF 0.005) (Kondo et al. 2004; Tamura et al. 2006). Login to comment

PMID: 21188243 [PubMed] Ishikawa T et al: "Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis."

No. Sentence Comment

167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90]. Login to comment
177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms. Login to comment

PMID: 16041239 [PubMed] Colombo S et al: "Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo."

No. Sentence Comment

78 - 19346T > A 50 upstream Epidauros bc-v-081 c.19 delG exon 2 p.K7fsX28 Epidauros bc-v-007 c.34G > A exon 2 p.V12M Honjo et al., 2001 bc-v-008 rs2231137 c.71C > T exon 2 p.A24V Epidauros bc-v-009 c.114T > C exon 2 synonymous (p.S38S) Zamber et al., 2003 bc-v-071 rs12721644 IVS 2 + 35 A > G intron 2 Honjo et al., 2001 bc-v-058 rs4148152 IVS 2-12 A > G intron 4 Epidauros bc-v-014 rs2231141 c.421C > A exon 5 p.Q141K Imai et al., 2002 bc-v-015 rs2231142 c.496C > G exon 5 p.Q166E Epidauros bc-v-016 rs1061017 IVS 5 + 14 A > T intron 5 Epidauros bc-v-017 rs2231143 Statistics Association between AUC values and genotypes at single SNP loci was evaluated using a Kruskal-Wallis rank test complemented by a Spearman rank test for trend. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined. Login to comment

PMID: 16180115 [PubMed] Ito K et al: "Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport."

No. Sentence Comment

212 Kondo et al. (119) also examined the cellular localization of a total of seven SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N) in LLC-PK1. Login to comment

PMID: 16815813 [PubMed] Choudhuri S et al: "Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters."

No. Sentence Comment

573 Recently, Kondo et al. (2004) reported the effect of single nucleotide polymorphisms (SNPs) in ABCG2 gene on its localization, expression level, and transport activity of the BCRP protein. The cellular localization was identified using the wild-type and seven different SNP variants of BCRP protein (Val12Met, Gln141Lys, Ala149Pro, Arg163Lys, Gln166Glu, Pro269Ser, and Ser441Asn), following their expression in LLC-PK1 cells. Login to comment

PMID: 24777822 [PubMed] Jani M et al: "Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics."

No. Sentence Comment

95 Histone deacetylase inhibitors rescue newly synthesized transporter proteins and prevent aggresome targeting by disturbing TableÊf;1ߒߙMajor non-synonymous single-nucleotide polymorphisms found in the ABCG2 coding region Allele frequencies presented in this table do not reflect interethnic differences Mutation Position in BCRP Cellular effects of SNP Allele frequency % References 34G>A, V12M (rs2231137) N-terminus Lower expression, no impact on function 0-29.8 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 151G>T, G51C N-terminus Slightly overexpressed, decreased transport activity 0.1 Tamura et al. (2006), Yoshioka et al. (2007) 376C>T, Q126X (rs7255271) NBD No expression, no activity 0-1.7 Tamura et al. (2006), Mizuarai et al. (2004), Itoda et al. (2003), Imai et al. (2002), Kobayashi et al. (2005), Kondo et al. (2004) 421C>A, Q141K (rs2231142) NBD Lower expression, decreased transport activity, substrate specificity altered 0-35.7 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 458C>T, T153 M NBD Slightly lower expression, no impact on function 3.3 Tamura et al. (2006), Mizuarai et al. (2004) 479G>A, R160Q NBD Not determined 0.5 Bosch et al. (2005), Tamura et al. (2006) 496C>G, Q166E (rs1061017) NBD Slightly lower expression, no impact on function 0-1.1 Tamura et al. (2006), Kondo et al. (2004), Yoshioka et al. (2007) 616A>C, I206L (rs12721643) NBD Well expressed, decreased transport activity 0-10.0 Tamura et al. (2006), Zamber et al. (2003), Vethanayagam et al. (2005), Ieiri (2012a) 623T>C, F208 (rs1061018) NBD No expression, no transport activity 0.9-3.9 Tamura et al. (2006) 742T>C, S248P (rs3116448) NBD Well expressed, no transport activity 0.5 Tamura et al. (2006), Yoshioka et al. (2007) 1000G>T, E334X (rs3201997) NBD No expression, no transport activity Not determined Tamura et al. (2006), Ishikawa et al. (2005) 1291T>C F431L ECL1 Lower expression, substrate specificity altered 0.6-0.8 Tamura et al. (2006), Itoda et al. (2003), Yoshioka et al. (2007) 1322G>A, S441 N ECL1 Slightly lower expression, no transport activity 0.5 Tamura et al. (2006), Kobayashi et al. (2005), Kondo et al. (2004) 1465T>C, F489L TM3 Slightly lower expression, no transport activity 0.5-0.8 Tamura et al. (2006), Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F506S TM4 Not determined 0.5 Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F507L 1515delC, V508L 1515delC, M509X 1711T>A, F571I (rs9282571) TM5 Well expressed, substrate specificity altered 0.5 Tamura et al. (2006) 1723C>T, R575X TM5 Not determined 0.5 Tamura et al. (2006) 1768A>T, N590Y (rs34264773) ECL3 Slightly overexpressed, substrate specificity altered 0-9.7 Tamura et al. (2006), Mizuarai et al. (2004), Zamber et al. (2003), Vethanayagam et al. (2005) 1858G>A, D620 N (rs34783571) ECL3 Slightly overexpressed, substrate specificity altered 0-11.1 Tamura et al. (2006), Bosch et al. (2005), Honjo et al. (2002), Vethanayagam et al. (2005) the trafficking along microtubules (Basseville et al. 2012). Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells. Login to comment