ABCMdb

ABCB3 p.Val379Ile

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 11829140 [PubMed] Saito S et al: "Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population."

No. Sentence Comment

50 Among the 37 SNPs detected in exons, 23 were present in coding regions; 10 of those would cause amino acid substitutions: Ala893Ser/Thr in the ABCB1 gene, (rs2032582); Ile393Val in TAP1 (rs1057141); Val379Ile (rs1800454), Cys651Arg, Thr665Ala (rs241447), and stop687Gln (rs241448) in TAP2; Val135Ile in ABCB8; Val121Met in ABCB9; Ala150Ser in ABCB10; and Val444Ala in ABCB11. Login to comment
34 Table 1A. Summary of genetic variations detected in the ABCB1 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5Ј Flanking -196 T/C 2 5Ј Flanking -16 T/C 3 Intron 1 71660 A/C 4 Intron 1 80091 A/C 5 Intron 1 103126 T/C 6 Intron 1 103148 C/T 7 Intron 1 108428 A/G 8 Intron 1 112042 A/Gd 9 Exon 2 202 T/C(5ЈUTR)b,d 10 Intron 2 491 G/del 11 Intron 4 36 C/T 12 Intron 5 1596 T/C 13 Intron 7 139 T/Cb,c rs1202168 14 Intron 7 251 G/A rs1202169 15 Intron 8 1789 C/T 16 Intron 9 7225 A/G rs1922240 17 Exon 13 12 T/C(Gly412Gly)b,c,d rs2032588 18 Intron 14 24 T/C 19 Intron 14 81 C/T 20 Intron 15 38 A/G 21 Intron 17 73 A/G 22 Intron 17 472 T/Ab,c 23 Intron 18 564 G/A 24 Intron 18 2062 C/T 25 Intron 18 2293 A/G 26 Intron 20 557 G/A 27 Intron 21 24 G/A 28 Intron 21 2725 A/G 29 Intron 21 4725 A/G 30 Exon 22 196 G/T/A(893Ala/Ser/Thr)c,d rs2032582 31 Intron 22 49 T/C rs2032583 32 Intron 22 8507 T/C 33 Intron 22 8537 T/A 34 Intron 22 8565 T/C 35 Intron 22 8952 G/A 36 Intron 22 9520 A/G 37 Intron 22 9836 C/T 38 Intron 24 377 C/A 39 Intron 24 1493 A/del 40 Intron 24 1495 A/T 41 Intron 25 342 C/T 42 Intron 26 134 C/G 43 Intron 26 1043 G/A rs1922243 44 Intron 26 1272 A/G 45 Intron 26 1394 A/G 46 Intron 26 1987-1988 AAAG/ins 47 Exon 27 153 C/T(Ile1145Ile)b,c,d rs1045642 48 Intron 27 59 G/T 49 Intron 27 80 T/C 50 Intron 28 1220 A/G rs1186746 51 Intron 28 1266 G/T rs1186745 52 Exon 29 400 A/G(3ЈUTR)d rs3842 53 3Ј Flanking 264 G/A rs1055302 ABCB1, ATP-binding cassette, subfamily B, member 1; NCBI, National Center for Biotechnology Information; SNP, single-nucleotide polymorphism; UTR, untranslated region; del, deletion; ins, insertion a For SNPs in the 5Јflanking region, intron region, or 3Јflanking region, nucleotide positions are counted from the first intronic nucleotide at the exon/intron junction (for SNPs in the exon region, nucleotide positions are counted from the first exonic nucleotide at the exon/intron junction) b SNPs previously reported by Hoffmeyer et al. (2000) c SNPs previously reported by Cascorbi et al. (2001) d SNPs previously reported by Tanabe et al. (2001) Table 1B. Summary of SNPs detected in the TAP1 gene No. Location Positiona SNP NCBI SNP ID 1 5Ј Flanking -673 G/C rs1351382 2 5Ј Flanking -646 T/G rs1351383 3 5Ј Flanking -563 A/C 4 5Ј Flanking -236 G/T 5 Intron 3 408 C/T 6 Exon 4 153 A/G(Ile393Val)b,c rs1057141 7 Intron 4 289 G/T 8 Intron 4 291 C/G rs2071539 9 Intron 5 1139 C/T 10 Intron 7 375 C/T rs735883 11 Exon 11 284 G/T(3ЈUTR)b rs1057373 12 3Ј Flanking 71 G/A rs2071540 13 3Ј Flanking 129 T/C rs2071541 14 3Ј Flanking 459 G/A rs2071463 TAP1, transporter associated with antigen processing 1 b SNPs previously reported by Colonna et al. (1992) c SNP previously reported by Jackson and Capra (1993) Table 1C. Summary of genetic variations detected in the TAP2 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5Ј Flanking -63 C/Tb 2 5Ј Flanking -55 G/Ab 3 Exon 1 61 T/C(5ЈUTR)b 4 Intron 1 39 G/Ab 5 Intron 1 311 A/Gb 6 Intron 2 48 G/Cb 7 Intron 3 7 G/Ab 8 Intron 3 8 G/A 9 Intron 3 265 A/Gb 10 Intron 3 1474 T/Cb rs241429 11 Intron 4 104 C/T 12 Intron 5 111 G/Ab rs241430 13 Intron 5 124 G/Ab 14 Exon 6 190 G/A(Val379Ile)b,c rs1800454 15 Exon 7 15 G/T(Gly386Gly)b 16 Intron 7 1379 G/A rs1015166 17 Intron 7 1399 G/A rs117821 18 Intron 9 168 C/T rs241436 19 Intron 10 23 C/T rs241437 20 Intron 10 87 G/A rs241438 21 Intron 10 170 A/C rs241439 22 Intron 10 219 A/G 23 Intron 10 346 G/A rs241440 24 Exon 11 17 G/A(Gly604Gly) rs241441 25 Intron 11 9 C/T rs241442 26 Intron 11 62 C/A rs241443 27 Intron 11 68 C/T rs241444 28 Intron 11 105 G/A rs241445 29 Intron 11 210 C/T rs241446 30 Intron 11 317-319 GTG/del 31 Exon 12 19 T/C(Cys651Arg) 32 Exon 12 61 A/G(Thr665Ala)c,d rs241447 33 Exon 12 127 T/C(stop687Gln)c,d rs241448 34 Exon 12 159 G/T(3ЈUTR)c,d rs241449 35 Exon 12 291 G/A(3ЈUTR) rs1871666 36 Exon 12 332 A/G(3ЈUTR) rs241451 37 Exon 12 356-357 GG/TGGTGGGGTGGA(3ЈUTR) TAP2, transporter associated with antigen processing 2 b SNPs previously reported by Jeffreys et al. (2000) c SNPs previously reported by Colonna et al. (1992) d SNPs previously reported by Powis et al. (1992) Materials and methods Exon-intron boundaries of the ABCB1, TAP1, TAP2, ABCB4, ABCB7, ABCB8, ABCB9, ABCB10, and ABCB11 genes were defined by comparing genomic sequences with mRNA sequences. Login to comment

PMID: 21796142 [PubMed] Kim JH et al: "Genetic association analysis of TAP1 and TAP2 polymorphisms with aspirin exacerbated respiratory disease and its FEV1 decline."

No. Sentence Comment

12 Value significant at Po0.05 is shown in bold. Table 2 Polymorphisms of TAP1 and TAP2 investigated in this study Gene SNP ID Polymorphism Position Amino-acid change Genotype (n) MAF HWE* TAP1 rs2071481 A/G Intron AA (109) AG (60) GG (10) 0.223 0.648 rs2284190 T/C Intron TT (132) TC (50) CC (3) 0.151 0.479 rs4148880 A/G Exon Ile393Val AA (124) AG (55) GG (8) 0.190 0.549 rs2395269 T/G Intron TT (125) TG (52) GG (8) 0.184 0.391 rs12529313 A/G Intron AA (124) AG (55) GG (8) 0.190 0.549 rs2071482 G/T Intron GG (125) GT (53) TT (7) 0.181 0.643 rs735883 C/T Intron CC (78) CT (85) TT (22) 0.349 0.875 rs1800453 A/G Exon Asp697Gly AA (130) AG (48) GG (7) 0.168 0.341 rs4711312 A/G Intron AA (130) AG (48) GG (7) 0.168 0.341 rs1057373 G/T 3'UTR GG (132) GT (46) TT (7) 0.162 0.248 rs2071540 G/A 3'near GG (61) GA (94) AA (30) 0.416 0.535 rs2071541 T/C 3'near TT (127) TC (50) CC (8) 0.178 0.289 TAP2 rs3763366 C/G 5'near CC (51) CG (94) GG (44) 0.481 0.957 rs4148870 G/A Intron GG (55) GA (89) AA (43) 0.468 0.546 rs2071544 G/A Intron GG (50) GA (95) AA (44) 0.484 0.931 rs2071465 G/C Intron GG (89) GC (78) CC (19) 0.312 0.755 rs2239701 A/G Intron AA (44) GA (101) GG (42) 0.495 0.272 rs241424 C/T Intron CC (49) CT (94) TT (44) 0.487 0.934 rs3819721 G/A Intron GG (101) GA (72) AA (14) 0.267 0.814 rs241426 T/A Intron TT (74) TA (91) AA (22) 0.361 0.453 rs3819714 G/A Intron GG (63) GA (98) AA (26) 0.401 0.214 rs241429 C/T Intron CC (74) CT (86) TT (27) 0.374 0.804 rs4148871 C/T Intron CC (122) CT (62) TT (3) 0.182 0.118 rs241430 G/A Intron GG (68) GA (95) AA (25) 0.386 0.362 rs241432 A/C Intron AA (66) AC (95) CC (28) 0.399 0.512 rs4148873 G/A Exon Val379Ile GG (141) GA (43) AA (3) 0.131 0.893 rs2228397 G/T Exon Synonymous (Gly386Gly) GG (90) GT (78) TT (19) 0.310 0.730 rs241433 T/G Intron TT (63) TG (96) GG (28) 0.406 0.381 rs1015166 C/T Intron CC (99) CT (75) TT (13) 0.270 0.813 rs4576294 G/A Exon Synonymous (Asn436Asn) GG (177) GA (10) AA (0) 0.027 0.707 rs241436 C/T Intron CC (57) CT (82) TT (48) 0.476 0.098 rs241437 C/T Intron CC (52) CT (92) TT (43) 0.476 0.851 rs241438 G/A Intron GG (49) GA (91) AA (48) 0.497 0.662 rs241439 C/A Intron CC (52) CA (91) AA (44) 0.479 0.733 rs4148876 C/T Exon/intron Arg651Cys CC (132) CT (52) TT (3) 0.155 0.403 rs241454 T/C 3'UTR/intron TT (71) TC (92) CC (24) 0.374 0.492 rs10484565 G/A 3'UTR/intron GG (146) GA (38) AA (3) 0.118 0.772 rs2857101 A/G 3'UTR/intron AA (71) AG (94) GG (24) 0.376 0.407 rs13501 G/A 3'UTR/intron GG (56) GA (96) AA (35) 0.444 0.586 rs1894411 A/G 3'near/intron AA (141) AG (42) GG (5) 0.138 0.390 rs2856993 C/G 3'near/intron CC (89) CG (83) GG (15) 0.302 0.473 rs2857103 G/T 3'near/intron GG (56) GT (96) TT (35) 0.444 0.586 rs2621321 T/C 3'near TT (81) TC (88) CC (18) 0.332 0.399 Abbreviations: HWE, Hardy-Weinberg equilibrium; MAF, minor allele frequency; SNP, single-nucleotide polymorphism; UTR, untranslated region. Login to comment
54 Four non-synonymous SNPs in coding regions (Ile393Val and Asp697Gly in TAP1; Val379Ile and Arg651Cys in TAP2) were included. Login to comment

PMID: 19387463 [PubMed] Ramos PS et al: "Variation in the ATP-binding cassette transporter 2 gene is a separate risk factor for systemic lupus erythematosus within the MHC."

No. Sentence Comment

66 Past studies of TAP2 association with SLE have focused on three specific amino acids (V379I (rs1800454), A565 T (rs2228396) and T665A (rs241447)), had modest sample sizes (B100-200 cases) in ethnically diverse populations and were collectively inconclusive.7-11 Of these three SNPs, only rs241447 was included in our analyses, and it yielded a modest association. Login to comment

PMID: 18650831 [PubMed] Ivansson EL et al: "MHC loci affecting cervical cancer risk: distinguishing the effects of HLA-DQB1 and non-HLA genes TNF, LTA, TAP1 and TAP2."

No. Sentence Comment

138 Genomic location on chr6 Minor allele frequency in controls Genotyping method LTA IntronA A/G rs909253 31648292 0.376 Inflastripa TNF À857 C/T rs1799724 31650461 0.067 TaqMan TNF À572 A/C rs4248161 31650746 0.014 TaqMan TNF À308 G/A rs1800629 31651010 0.167 Inflastripa TNF À238 G/A rs361525 31651080 0.047 Inflastripa TAP2 T665A T/C rs241447 32904729 0.244 TaqMan TAP2 R651C G/A rs4148876 32904771 0.070 TaqMan TAP2 A565T C/T rs2228396 32905787 0.112 TaqMan TAP2 V379I C/T rs1800454 32908390 0.164 TaqMan TAP1 D697G T/C rs1135216 32922953 0.167 TaqMan TAP1 I393V T/C rs1057141 32926752 0.190 TaqMan Abbreviations: HLA, human leukocyte antigen; LTA, lymphotoxin-alpha; TAP, transporter associated with antigen processing; TNF, tumor necrosis factor. Login to comment

PMID: 14551602 [PubMed] Casp CB et al: "Genes of the LMP/TAP cluster are associated with the human autoimmune disease vitiligo."

No. Sentence Comment

27 Restriction enzyme Fragment sizes (bp) Gene Polymorphism Name Sequences (50 to 30 ) Uncut Cut SNP ID LMP2 G/A exon 3 (R60H) LMP2-2 GTGAACCGAGTGTTTGACAAGC 581C HhaI 252 212,40 rs17587 LMP2-1 GCCAGCAAGAGCCGAAACAAG TAP1 C/T intron 7 TAP1-15 GTGCTCTCACGTTCCAAGGA 551C MspI 183 161,22 rs735883 TAP1-16 AGGAGTAGAGATAGAAGAACCa TAP1 G/A exon 10 (D637G) TAP1-10 CTCATCTTGGCCCTTTGCTC 601C AccI 165 136,29 rs1800453 TAP1-11 CACCTGTAACTGGCTGTTTG LMP7 A/C exon 2 (Q49K) LMP7-Z TCGCTTTACCCCGGGGACTGb 631C PstI 212 194,18 rs2071543 LMP7-BR AACTTGCACTTCCTCCTCTCAGG LMP7 G/T intron 6 LMP7-7 TTGATTGGCTTCCCGGTACTG 581C HhaI 583,180 428,180,155 Ref. 1 LMP7-4 TCTACTACGTGGATGAACATGG TAP2 G/A exon 5 (V379I) TAP2-3 GAACGTGCCTTGTACCTGCGCc 571C BstUI 212 192,20 rs1800454 TAP2-4 ACCCCCAAGTGCAGCAC TAP2 A/G exon 11 (T665A) TAP2-5 GGTGATTGCTCACAGGCTGCCGd 611C MspI 225 205,20 rs241447 TAP2-6 CACAGCTCTAGGGAAACTC MECL1 T/C exon 4 (L107L) MECL1-1 TCGACTTGGGTTGCAGGCTTAC 651C MluI 973,131 535,438,131 rs20549 MECL1-2 ATCTGAAGTAACCGCTGCGAC a Underlined nucleotide in primer TAP1-16 was changed from the germline G to a C to create the MspI RFLP. Login to comment
43 Table 3 Allele frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients (age of onset 0-29 years) and control subjects Vitiligo patients Controls Gene Polymorphism Allele Count Percentage Count Percentage P-value LMP2 G/A exon 3 (R60H) G 62 32.6 95 26.2 0.11 A 128 67.4 267 73.8 TAP1 C/T intron 7 C 80 44.4 121 38.8 0.22 T 100 55.6 191 61.2 TAP1 G/A exon 10 (D637G) A 29 14.8 89 25.6 0.0034 G 167 85.2 259 74.4 LMP7 A/C exon 2 (Q49K) A 165 87.8 296 88.1 0.91 C 23 12.2 40 11.9 LMP7 G/T intron 6 G 95 52.2 142 42.8 0.040 T 87 47.8 190 57.2 TAP2 A/G exon 5 (V379I) A 40 21.7 74 21.0 0.85 G 144 78.3 278 79.0 TAP2 A/G exon 11 (T665A) A 139 71.6 257 69.8 0.65 G 55 28.4 111 30.2 MECL1 T/C exon 4 (L107L) T 146 80.2 259 80.9 0.84 C 36 19.8 61 19.1 Family-based association Further evidence for genetic association between LMP/ TAP genes and vitiligo susceptibility was sought using the transmission disequilibrium test (TDT), a family-based (intrafamilial) study design that considers heterozygous parents and evaluates the frequency with which alleles are transmitted to affected offspring.27 A w2 test was used to evaluate the deviation of the rates of transmission and nontransmission from the random expectation (Table 5). Login to comment
54 Using a whole genome scan of a large family cluster with both vitiligo and Hashimoto thyroiditis, a general autoimmune susceptibility locus (AIS1) was mapped to human chromosome 1, and evidence was reported for a Hashimoto disease susceptibility locus within a chromosome 6 region spanning both the MHC and AIDT1, a non-MHC locus associated with susceptibility to both Hashimoto thyroiditis and Graves` disease.24 A linkage disequilibrium analysis of 56 multigeneration Columbian families with vitiligo using microsatellite markers spanning the entire human MHC region revealed a major genetic factor within the MHC at 6p21.3-21.4, with a dominant mode of inheritance in vitiligo patients with an early age of onset and a recessive mode of inheritance influenced by environmental effects in vitiligo patients with an age of onset after 30 years of age.10 Comparisons of a variety of inheritance models suggested that the most parsimonious genetic model was that of a major Table 4 Genotype frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients and (age of onset 0-29 years) control subjects Vitiligo patients Controls Gene Polymorphism Genotype Count Percentage Count Percentage P-value LMP2 G/A exon 3 (R60H) GG 6 6.3 12 6.6 0.095 GA 50 52.6 71 39.2 AA 39 41.1 98 54.1 TAP1 C/T intron 7 CC 21 23.3 27 17.3 0.47 CT 38 42.2 67 43.0 TT 31 34.5 62 39.7 TAP1 G/A exon 10 (D637G) AA 1 1.0 8 4.6 0.0094 AG 27 27.6 73 42.0 GG 70 71.4 93 53.4 LMP7 A/C exon 2 (Q49K) AA 73 77.7 131 78.0 0.98 CA 19 20.2 34 20.2 CC 2 2.1 3 1.8 LMP7 G/T intron 6 GG 26 28.6 28 16.9 0.077 GT 43 47.3 86 51.8 TT 22 24.2 52 31.3 TAP2 A/G exon 5 (V379I) AA 9 9.8 14 8.0 0.84 AG 22 23.9 46 26.1 GG 61 66.3 116 65.9 TAP2 A/G exon 11 (T665A) AA 51 52.6 90 48.9 0.83 AG 37 38.1 77 41.9 GG 9 9.3 17 9.2 MECL1 T/C exon4(L107L) TT 60 65.9 107 66.9 0.98 TC 26 28.6 45 28.1 CC 5 5.5 8 5.0 dominant gene plus environmental effects, although multifactorial models could not be rejected.10 Many other HLA associations have been reported between specific alleles of complement, class I and class II MHC genes with vitiligo in various ethnic and racial subpopulations (reviewed in Friedmann9 ), but no common HLA association is observed. Login to comment
67 Immunoproteasomes are constitutively expressed in the thymus and Table 5 Family-based association (transmission disequilibrium test) results for LMP/TAP and MECL1 candidate genes and vitiligo susceptibility Gene Marker Number of informative parents Transmitted Not transmitted % Transmitted P-value LMP2 G/A exon 3 (R60H) 38 26 12 68 0.023 TAP1 C/T intron 7 50 34 16 68 0.011 TAP1 G/A exon 10 (D637G) 35 24 11 69 0.028 LMP7 A/C exon 2 (Q49K) 26 16 10 62 0.24 LMP7 G/T intron 6 45 36 9 80 0.000057 TAP2 A/G exon 5 (V379I) 22 12 10 55 0.67 TAP2 A/G exon 11 (T665A) 56 31 25 55 0.42 MECL1 T/C exon 4 (L107L) 47 24 23 51 0.88 by mature dendritic cells under conditions in which most T-cell activation occurs, whereas elsewhere in the periphery constitutive proteasomes are expressed in the absence of inflammation. Login to comment
92 This SNP marker was genotyped using a modified PCR primer to create a PstI RFLP, such that the C allele is cleaved, whereas the A allele remains uncut. The first of two TAP2 polymorphisms studied was a G/A substitution resulting in an amino-acid change in exon 5 (V379I). Login to comment

PMID: 10471632 [PubMed] Foley PJ et al: "Analysis of MHC encoded antigen-processing genes TAP1 and TAP2 polymorphisms in sarcoidosis."

No. Sentence Comment

67 Statistical Analysis Statistical analysis was performed on the individual polymorphism results for the two populations studied using chi-square contingency ta- TABLE 2 COMPARISON OF TAP1 AND TAP2 POLYMORPHISM IN UK PATIENTS WITH SARCOIDOSIS AND CONTROL SUBJECTS STUDIED TAP Polymorphism Frequencies UK Control Subjects (%) (n ϭ 290) UK Patients with Sarcoidosis (%) (n ϭ 117) ␹2 * p Value Odds Ratio (95% CI)† TAP1 P333 Phenotypes Ile-333 97.9 97.4 NS NS - Val-333 33.4 35.0 NS NS - Genotypes Ile-333/Ile-333 66.6 65.0 Ile-333/Val-333 31.4 32.5 NS NS - Val-333/Val-333 2.1 2.5 TAP1 position 637 Phenotypes Asp-637 99.3 100 NS NS - Gly-637 31.4 27.4 NS NS - Genotypes Asp-637/Asp-637 68.6 72.6 Asp-637/Gly-637 30.7 27.4 NS NS - Gly-637/Gly-637 0.7 0 TAP2 position 379 Phenotypes Val-379 99.7 99.1 NS NS - Ile-379 25.2 25.6 NS NS - Genotypes Val-379/Val-379 74.8 74.4 Val-379/Ile-379 24.8 24.8 NS NS - Ile-379/Ile-379 0.3 0.9 TAP2 position 565 Phenotypes Ala-565 99.7 100 NS NS - Thr-565 19.0 8.5 6.74 0.009 0.4 (0.18-0.85) Genotypes Ala-565/Ala-565 81.0 91.5 2.5 (1.18-5.45) Ala-565/Thr-565 18.6 8.5 6.86 0.03 0.41 (0.19-0.87) Thr-565/Thr-565 0.3 0 TAP2 position 665 Phenotypes Thr-665 95.5 97.4 NS NS - Ala-665 51.4 35.0 8.93 0.003 0.51 (0.32-0.81) Genotypes Thr-665/Thr-665 48.6 65.0 1.96 (1.23-3.13) Thr-665/Ala-665 46.9 32.5 9.01 0.01 0.54 (0.34-0.87) Ala-665/Ala-665 4.5 2.6 0.56 (0.12-2.16) * The chi-square test with 1 df was performed for the comparison of overall phenotype frequencies. Login to comment
91 When we examined the HLA-DPB1 allele and phenotype frequencies in the UK control and patient groups, no difference was seen in the frequency of participants carrying HLA- TABLE 3 COMPARISON OF TAP1 AND TAP2 POLYMORPHISM IN THE POLISH PATIENTS WITH SARCOIDOSIS AND THE CONTROL SUBJECTS STUDIED TAP Polymorphism Frequencies Polish Control Subjects (%) (n ϭ 158) Polish Patients with Sarcoidosis (%) (n ϭ 87) ␹2 p Value TAP1 position 333 Phenotypes Ile-333 98.7 96.6 NS NS Val-333 31.0 29.5 NS NS Genotypes Ile-333/Ile-333 69.0 70.1 Ile-333/Val-333 29.7 26.4 NS NS Val-333/Val-333 1.3 3.4 TAP1 position 637 Phenotypes Asp-637 98.7 95.4 NS NS Gly-637 22.5 32.2 NS NS Genotypes Asp-637/Asp-637 77.5 67.8 Asp-637/Gly-637 21.2 27.6 NS NS Gly-637/Gly-637 1.3 5 TAP2 position 379 Phenotypes Val-379* 97.5 93.1 5.63 0.02 Ile-379 25.0 31.0 NS NS Genotypes Val-379/Val-379 75.0 69.0 Val-379/Ile-379 22.5 24.1 NS NS Ile-379/Ile-379 2.5 6.9 TAP2 position 565 Phenotypes Ala-565 100 100 NS NS Thr-565 23.1 20.5 NS NS Genotypes Ala-565/Ala-565 76.9 79.3 Ala-565/Thr-565 23.1 20.7 NS NS Thr-565/Thr-565 0.0 0 TAP2 position 665 Phenotypes Thr-665 96.2 97.7 NS NS Ala-665 46.9 38.6 NS NS Genotypes Thr-665/Thr-665 53.1 62.1 Thr-665/Ala-665 43.1 35.6 NS NS Ala-665/Ala-665 3.8 2.3 * Odds ratio ϭ 0.17; 95% CI ϭ 0.02-1.0. Login to comment

PMID: 8477801 [PubMed] Ronningen KS et al: "Linkage disequilibrium between TAP2 variants and HLA class II alleles; no primary association between TAP2 variants and insulin-dependent diabetes mellitus."

No. Sentence Comment

13 An A to G transition at nucleotide (NT) 1231results in substitution of isoleucine for valine at residue 379. Login to comment

PMID: 8428770 [PubMed] Powis SH et al: "Alleles and haplotypes of the MHC-encoded ABC transporters TAP1 and TAP2."

No. Sentence Comment

52 A third variable site within the protein sequence of TAP2 was inferred from the cDNA sequence published by Bahrain and co-workers (1991), which contained the substitution Ile for Val at position 379. Login to comment

PMID: 8344720 [PubMed] Powis SH et al: "TAP1 and TAP2 polymorphism in coeliac disease."

No. Sentence Comment

37 TAP polymorphism Controls CD (n = 69) (n = 81) n % n % TAP2 position 379: Phenotype frequencies Val-379/Val-379 43 62.3 Val-379/Ile-379 25 36.2 Ile-379/Ile-379 1 1.4 Val-379 68 98.6 Ile-379 26 37.7 Gene frequencies Val-379 111 80.4 Ile-379 27 19.6 TAP2 position 565: Phenotype frequencies Ala-565/Ala-565 49 71 Ala-565/Thr-565 20 29 Thr-565/Thr-565 0 0 Ala-565 69 100 Thr-565 20 29 Gene frequencies Ala-565 118 85.5 Thr-565 20 14.5 TAP2 position 665: Phenotype frequencies Thr-665/Thr-665 39 56.5 Thr-665/Ala-665 27 39.1 Ala-665/Ala-665 3 4.3 Thr-665 66 95.7 Ala-665 30 43.5 Gene frequencies Thr-665 105 76.1 Ala-665 33 23.9 TAP1 position 333: Phenotype frequencies Ile-333/Ile-333 51 73.9 Ile-333/Val-333 16 23.2 Val-333/Val-333 2 2.9 Iie-333 67 97.1 Val-333 18 26.1 Gene frequencies Ile-333 118 85.5 Val-333 20 14.5 TAP1 position 637: Phenotype frequencies Asp-637/Asp-637 54 78.3 Asp-637/Gly-637 13 18.8 Gly-637/Gly-637 2 2.9 Asp-637 67 97.1 Gly-637 15 21.7 Gene frequencies Asp-637 121 87.7 Gly-637 17 12.3 74 91.4 * 7 8.6 * 0 0 81 100 7 8.6 * 155 95.7 * 7 4.3 * 75 92.6 * 6 7.4 * 0 0 81 100 6 7.4 * 156 96.3 * 6 3.7 * 69 85.2 * 10 12.3 * 2 2.5 79 97.5 12 14.8 * 148 91.4 * 14 8.6 * 68 84 12 14.8 1 1.2 80 98.8 13 16 148 91.4 14 8.6 71 87.7 9 11.1 1 1.2 80 98.8 10 12.3 151 93.2 11 6.8 Chi-square or Fisher's exact test: *p <0.001. Login to comment

PMID: 1360671 [PubMed] van Endert PM et al: "Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes."

No. Sentence Comment

80 In the TAP2 gene, the predominant valine at position 379 was replaced by isoleucine in 3 out of 24 typed lines. Login to comment

PMID: 12826376 [PubMed] Lajoie J et al: "New transporter associated with antigen processing (TAP-2) polymorphisms in the Shona people of Zimbabwe."

No. Sentence Comment

101 It is interesting to note that 565Thr and 651Cys variants in Rwandans do not follow TABLE 4 Allelic frequencies of TAP 2 single nucleotide polymorphisms in different populations Population Number of alleles T257I R313H A374T V379I A565T A609V R651C T665A Zimbabwean 384 3.4% 4.7% 9.1% 19.3% 13.5% 3.9% 0% 20.3% Caucasiansa 152 - - 0% 18.4% 0.7% - 5.3% 15.1% Braziliansa 296 - - 2.0% 13.2% 10.1% - 4.0% 32.4% Rwandansa 570 - - 6.7% 11.8% 0% - 10.0% 30.2% Zambiansa 234 - - 6.8% 10.2% 18.3% - 0% 23.5% a From [41]. Login to comment

PMID: 10749979 [PubMed] Jeffreys AJ et al: "High resolution analysis of haplotype diversity and meiotic crossover in the human TAP2 recombination hotspot."

No. Sentence Comment

33 Only two SNPs were in coding sequence: T41G→A in TAP2 exon 5 resulted in the replacement V379I reported previously (20), whereas T42G→T in exon 6 was a silent substitution. Login to comment
32 Only two SNPs were in coding sequence: T41G࢐A in TAP2 exon 5 resulted in the replacement V379I reported previously (20), whereas T42G࢐T in exon 6 was a silent substitution. Login to comment

PMID: 23892057 [PubMed] Gojanovich GS et al: "Characterization and allelic variation of the transporters associated with antigen processing (TAP) genes in the domestic dog (Canis lupus familiaris)."

No. Sentence Comment

198 However, there was no overlap between canine (G127R, R373C, I425T and R695H) and human (V379I, A565T, R651C and Q665A) polymorphisms (http://hla.alleles.org/data/txt/tap2_prot.txt). Login to comment
197 However, there was no overlap between canine (G127R, R373C, I425T and R695H) and human (V379I, A565T, R651C and Q665A) polymorphisms (http://hla.alleles.org/data/txt/tap2_prot.txt). Login to comment