ABCA4 p.Pro1380Leu

[switch to full view]
Comments [show]
Publications
PMID: 22247458 [PubMed] Cideciyan AV et al: "Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials."
No. Sentence Comment
42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18‡ 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy.
X
ABCA4 p.Pro1380Leu 22247458:42:729
status: NEW
Login to comment

PMID: 22328824 [PubMed] Roberts LJ et al: "Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients."
No. Sentence Comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9].
X
ABCA4 p.Pro1380Leu 22328824:139:936
status: NEW
Login to comment

PMID: 22076985 [PubMed] Lazow MA et al: "Transition zones between healthy and diseased retina in choroideremia (CHM) and Stargardt disease (STGD) as compared to retinitis pigmentosa (RP)."
No. Sentence Comment
59 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20ϩ5 GϾA, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing.
X
ABCA4 p.Pro1380Leu 22076985:59:274
status: NEW
Login to comment

31 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20af9;5 Gb0e;A, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing.
X
ABCA4 p.Pro1380Leu 22076985:31:274
status: NEW
Login to comment

PMID: 21873672 [PubMed] Burke TR et al: "Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1)."
No. Sentence Comment
112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel.
X
ABCA4 p.Pro1380Leu 21873672:112:899
status: NEW
X
ABCA4 p.Pro1380Leu 21873672:112:981
status: NEW
X
ABCA4 p.Pro1380Leu 21873672:112:1531
status: NEW
X
ABCA4 p.Pro1380Leu 21873672:112:1538
status: NEW
Login to comment

PMID: 20696155 [PubMed] Burke TR et al: "Loss of peripapillary sparing in non-group I Stargardt disease."
No. Sentence Comment
135 Patient 15 had 3 changes of the ABCA4 gene detected: M1 V, R2030Q and P1380L.
X
ABCA4 p.Pro1380Leu 20696155:135:70
status: NEW
Login to comment

184 Also, the type of involvement of the peripapillary area Table 1 Summary of clinical and genetic information for patients with ERG Group I Stargardt Disease. Case Mutation Mutation OA Duration Age at AF Visual Acuity Flecks Atrophy GA (mm2 ) PPA # Sex Allele 1 Allele 2 PPA (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 1 Male G1961E G1961E e 19 13 32 20/70 20/70 M M M M 1.6 0.2 None 2 Female G1961E *IVS43 þ 1 G > T e 8 21 27 20/200 20/200 M M M M na na None 3.1 Male L541P/A1038V G1961E e 28 3 31 20/50 20/30 M M M M na na None 3.2 Male L541P/A1038V G1961E e 28 5 33 20/60 20/50 M M M M na na None 4.1 Female L541P/A1038V G1961E e 14 3 17 20/30 20/25 None None None None na na None 4.2 Female L541P/A1038V G1961E e 14 10 24 20/150 20/200 M M M M na na None 5 Female G1961E R2077W e 25 5 30 20/60 20/50 None None M M na na None 6.1 Female G1961E L541P/A1038V e 18 3 21 20/150 20/150 None None M M na na None 6.2 Female G1961E L541P/A1038V e 15 3 18 20/150 20/150 None None M M na na None 7 Female R602Q R602Q e 31 5 36 20/20 20/60 M,EM M,EM M M 0.7 0.3 None 8 Male L541P/A1038V ND e 22 24 46 20/200 20/200 M M M M 13.2 4.1 None 9 Femlae A1038V ND e 27 10 37 20/100 20/60 M,EM M,EM M M na na None 10 Female G1961E ND e 27 6 33 20/150 20/150 M M M M na na None 11 Female G1961E ND e 43 24 67 20/40 20/200 M M M M 4.8 na None 12 Male R212C ND OU 5 23 28 20/200 20/200 M,EM M,EM M M 1.6 4.2 Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array e suggesting the presence of a currently unknown mutant allele; and *newly described mutation.
X
ABCA4 p.Pro1380Leu 20696155:184:309
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:184:489
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:184:567
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:184:574
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:184:1222
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:184:1628
status: NEW
Login to comment

185 Table 2 Summary of clinical and genetic information for patients with ERG Groups II or III Stargardt Disease. Case Mutation Mutation ERG OA Duration Age at AF Visual Acuity Flecks GA position GA (mm2) PPA # Sex Allele 1 Allele 2 PPA Group (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 13 Female P1380L R1640Q OU II 11 24 35 HM HM EM EM M,EM M,EM na na Scalloped - 14 Male IVS38-10 T>C IVS40+5 G>A OU II 7 6 13 20/150 20/150 M,EM M,EM M M na na Flecks N 15 Female M1 V/R2030Q P1380L OU II 8 10 18 20/150 20/150 M,EM M,EM M M 3.52 na Patchy N,T 16 Female P1380L P1380L OU II 18 8 26 20/400 20/400 M,EM M,EM M M 0.25 na Patchy N,T 17 Female L541P/A1038 V L2027F OU II 10 22 32 CF CF M,EM M,EM M M 11.7 5.1 Patchy N,T 18 Male A1773 V ND OU II 35 6 41 CF 20/30 M,EM M,EM M M 4.2 3.7 Patchy N,T 19 Female L2027F ND OU I/II 10 17 27 20/400 20/400 M,EM M,EM M M 1.6 0.1 Patchy N,T 20 Male R602 W R1300X OU III 8 18 26 CF CF None None M,EM M,EM na na Scalloped N,T 21 Female C54Y IVS14+1 G>C OU III 8 55 63 CF HM EM None M,EM M,EM na na Complete - 22.1 Male 4537delC *R107X OU III 5 8 13 20/200 20/200 EM EM M M 2.3 1.7 Patchy N,T 22.2 Female 4537delC *R107X - III 6 2 8 20/200 20/200 M,EM M,EM M M na na - - 23 Male P1380L IVS40+5 G>A OU III 29 26 55 20/400 20/400 EM EM M,EM M,EM na na Complete - 24 Male A1598D A1598D OU III 13 40 53 20/400 20/400 NA NA M,EM M,EM na na Scalloped N,T 25 Male G172S ND OU III 25 7 32 CF CF None None M,EM M,EM na na Complete - 26 Female R1108C ND OU III 9 50 59 20/400 20/400 EM EM M,EM M,EM na na Complete - 27 Male V767D ND OD III 5 10 15 20/400 20/400 EM EM M M na na Patchy T 28 Male P1380L ND OU II/III 9 21 30 20/400 20/400 EM EM M M na na Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array, suggesting the presence of a currently unknown mutant allele; and *newly described mutation.
X
ABCA4 p.Pro1380Leu 20696155:185:309
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:185:489
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:185:567
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:185:574
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:185:1222
status: NEW
X
ABCA4 p.Pro1380Leu 20696155:185:1628
status: NEW
Login to comment

134 Patient 15 had 3 changes of the ABCA4 gene detected: M1 V, R2030Q and P1380L.
X
ABCA4 p.Pro1380Leu 20696155:134:70
status: NEW
Login to comment

PMID: 20647261 [PubMed] Schindler EI et al: "Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population."
No. Sentence Comment
54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text).
X
ABCA4 p.Pro1380Leu 20647261:54:177
status: NEW
Login to comment

57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text).
X
ABCA4 p.Pro1380Leu 20647261:57:177
status: NEW
Login to comment

PMID: 20398653 [PubMed] Chen B et al: "Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease."
No. Sentence Comment
82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done.
X
ABCA4 p.Pro1380Leu 20398653:82:2701
status: NEW
Login to comment

81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done.
X
ABCA4 p.Pro1380Leu 20398653:81:2699
status: NEW
Login to comment

PMID: 19265867 [PubMed] Passerini I et al: "Novel mutations in of the ABCR gene in Italian patients with Stargardt disease."
No. Sentence Comment
57 Table 2 Summary of the mutations identified in the ABCR gene in our series of STGD Italian patients Patient Allele 1 mutation Allele 2 mutation S 1 R212C T1019M S 8 V1433I V1433I S 21 A1598D A1598D S 33 N96K G978D S 56 A1598D G1961E S 70 R212C T1019M S 71 W700X WT S 74 6750delA V767D S 77 G1961E WT S 82 Q21X G1961E S 106 C1177X G1961E S 107 C1177X G1961E S 114 T970P-F1015E - S 115 T970P-F1015E - S 120 N415K G1961E S 162 324-327insT 324-327insT S 181 W1408X G1961E S 190 C1177X A1598D S 201 G1961E WT S 202 Q21X T970P-F1015E S 213 M840R G1961E S 231 WT WT S 236 C1177X G1961E S 237 WT WT S 241 V256 splice WT S 246 IVS6-1g4t R1108C S 260 L2221P 5109delG-I156V S 321 IVS9 þ 1G4C S1099X S 328 IVS42 þ 4delG IVS35 þ 2t4c S 346 E2096K WT S 347 IVS28 þ 5g4a WT S 353 P1484S-G1961E P68L S 354 P1484S-G1961E P68L S 355 P1484S-G1961E P68L S 360 G1961E 5961delGGAC S 364 IVS35 þ 2t4c G1961E S 365 L541P/A1038V G1961E S 377 IVS42 þ 4delG IVS35 þ 2t4c S 380 R653C WT S 413 R212C T1019M S 414 A1598D G1961E S 417 G1078E G1961E S 438 R1055W WT S 440 4021ins24bp T1526M-G1961E S 449 W1479X L2140Q S 450 W1479X L2140Q S 474 W1461X G 1977S S 486 WT WT S 492 R1098C/L1970F 6548insTGAA S 528 T977P IVS40 þ 5g4a S 531 G690V Q1332X S 532 R572X L1473M-4733delGTTT S 535 IVS40 þ 5g4a 5917delG S 550 IVS40 þ 5g4a 6750delA S 555 250insCAAA WT S 556 250insCAAA WT S 575 N96H G1961E S 590 W821R IVS40 þ 5g4a S 592 V931M R1108C S 593 V767D R2030X Table 2 (Continued ) Patient Allele 1 mutation Allele 2 mutation S 594 G172S G1961E S 602 P1380L G1961E S 607 E616K L1580S-K2172R S 640 250insCAAA S1696N S 694 IVS35 þ 2t4c G1961E S 725 IVS13 þ 1g4a Q1376 splice S 731 L541P-A1038V G1961E S 755 N965S IVS40 þ 5g4a S 789 E1087K G1977S S 968 T1019M G1961E S 992 R212C G1961E Bold values indicate novel mutations.
X
ABCA4 p.Pro1380Leu 19265867:57:1557
status: NEW
X
ABCA4 p.Pro1380Leu 19265867:57:1568
status: NEW
Login to comment

PMID: 19578016 [PubMed] Genead MA et al: "The natural history of stargardt disease with specific sequence mutation in the ABCA4 gene."
No. Sentence Comment
66 Genetic Mutations in the ABCA4 Gene in the Patients Patient No. Genetic Mutation Allele 1 Genetic Mutation Allele 2 Comments 1 gly1961glu exon 42 Heterozygous 2 gly1961glu exon 42 ala1038val exon 21 and leu541pro exon 12 Compound heterozygous 3 gly1961glu exon 42 Heterozygous 4 gly1961glu exon 42 arg2077trp exon 45 Compound heterozygous 5 gly1961glu exon 42 gly65glu exon 3 Compound heterozygous 6 gly1961glu exon 42 leu1201arg exon 24 Compound heterozygous 7 gly1961glu exon 42 Heterozygous 8 gly1961glu exon 42 Heterozygous 9 gly1961glu exon 42 del Co 1620-1622 exon 35 Compound heterozygous 10 gly1961glu exon 42 Heterozygous 11 gly1961glu exon 42 1bp del(T) Co 36 which creates stop at Co 38 Compound heterozygous 12 gly1961glu exon 42 IVS38-10 TϾC Compound heterozygous 13 gly1961glu exon 42 Heterozygous 14 gly1961glu exon 42 pro1380leu Compound heterozygous 15 gly1961glu exon 42 pro1380leu Compound heterozygous 16 gly1961glu exon 42 gly1961glu exon 42 Homozygous initial visit in the right eye was 0.87 (range, 0.10-1.40), whereas the median logMAR VA at the most recent FU visit was 1.00 (range, 0.18-2.80; P ϭ 0.325).
X
ABCA4 p.Pro1380Leu 19578016:66:840
status: NEW
X
ABCA4 p.Pro1380Leu 19578016:66:895
status: NEW
Login to comment

PMID: 19324865 [PubMed] Gomes NL et al: "A comparison of fundus autofluorescence and retinal structure in patients with Stargardt disease."
No. Sentence Comment
97 Summary of Genetic and Selected Clinical Findings Patient Age Sex Allele 1 Allele 2 Visual Acuity (LogMAR) PRL (Degrees) PRL Location OD OS OD OS OD OS 1 12 M K346T ND 0.7 0.7 5.8 5.9 S S 2 42 M ND ND 1.0 1.0 1.9 2.0 S S 3 31 M G1961E G1961E 0.5 0.5 2.8 1.9 S S 4 56 M P1380L S1696N 0.7 0.7 8.4 8.0 S S 5 23 F L541P/A1038V G1961E 1.0 1.0 0.0 0.0 F F 6 62 F D1532N G1961E 1.3 0.4 3.0 0.0 T F 7 65 F G1961E ND 0.3 1.3 4.0 2.0 S S 8 30 F G1961E ND 0.4 0.4 2.9 3.0 S S 9 24 F P1380L P1380L 0.3 0.3 8.6 8.5 S S 10 15 F L541P/A1038V G1961E 0.0 0.0 0.0 0.0 F F 11 20 F L541P/A1038V ND 0.3 0.4 1.8 2.0 S S ND, not determined; S, superior; F, foveal; T, temporal.
X
ABCA4 p.Pro1380Leu 19324865:97:269
status: NEW
X
ABCA4 p.Pro1380Leu 19324865:97:472
status: NEW
X
ABCA4 p.Pro1380Leu 19324865:97:479
status: NEW
Login to comment

PMID: 19365039 [PubMed] Roberts LJ et al: "Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip."
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction.
X
ABCA4 p.Pro1380Leu 19365039:31:2038
status: NEW
X
ABCA4 p.Pro1380Leu 19365039:31:2045
status: NEW
Login to comment

PMID: 19074458 [PubMed] Cideciyan AV et al: "ABCA4 disease progression and a proposed strategy for gene therapy."
No. Sentence Comment
48 Similarly, P47 (P1380L/ G1961E) had a sensitivity loss (2.3 dB) that was within normal limits at age 45, and this increased, but not significantly, to 3.6 dB over an 8-year period.
X
ABCA4 p.Pro1380Leu 19074458:48:16
status: NEW
Login to comment

126 For four missense mutations occurring homozygously (L244P, R220C, N965S and P1380L), we assumed that each allele contributed equally to disease severity.
X
ABCA4 p.Pro1380Leu 19074458:126:76
status: NEW
Login to comment

151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years.
X
ABCA4 p.Pro1380Leu 19074458:151:499
status: NEW
Login to comment

PMID: 18854780 [PubMed] Hwang JC et al: "Peripapillary atrophy in Stargardt disease."
No. Sentence Comment
5 Case 1 revealed peripapillary and central atrophy with heterozygous ABCA4 mutations P1380L and IVS40 ϩ 5GϾA.
X
ABCA4 p.Pro1380Leu 18854780:5:84
status: NEW
Login to comment

6 Case 2 demonstrated atrophic fleck lesions involving the peripapillary region and central atrophy with homozygous ABCA4 mutations P1380L and P1380L. Case 3 revealed bilateral central atrophy and pisciform fleck atrophy involving the peripapillary, macular, and peripheral regions with ABCA4 mutations P1380L and R2030Q.
X
ABCA4 p.Pro1380Leu 18854780:6:130
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:6:141
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:6:301
status: NEW
Login to comment

7 Overall, ABCA4 mutation P1380L was noted in 13 cases (8.7%), IVS40 ϩ 5GϾA in 6 cases (4.0%), and R2030Q in 1 case (0.7%).
X
ABCA4 p.Pro1380Leu 18854780:7:24
status: NEW
Login to comment

8 The remaining cases shared one common STGD mutation with Case 1, 2, and 3 (P1380L or IVS40 ϩ 5GϾA) and demonstrated classic STGD findings of central atrophy and varying presence of peripheral flecks without peripapillary lesions.
X
ABCA4 p.Pro1380Leu 18854780:8:75
status: NEW
Login to comment

25 Genetic testing was employed for further diagnostic information and two heterozygous ABCA4 mutations, P1380L and IVS40 ϩ 5GϾA, were identified and classified as disease-causing alleles, thereby confirming the diagnosis of STGD.
X
ABCA4 p.Pro1380Leu 18854780:25:102
status: NEW
Login to comment

32 STGD with peripapillary atrophy and mutations P1380L and IVS40 ϩ 5GϾA.
X
ABCA4 p.Pro1380Leu 18854780:32:46
status: NEW
Login to comment

41 Genotyping revealed homozygous ABCA4 mutations, P1380L and P1380L. Case 3 A 15-year-old female presented with complaints of difficulty reading materials held greater than 6 inches from her eyes.
X
ABCA4 p.Pro1380Leu 18854780:41:48
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:41:59
status: NEW
Login to comment

47 Genotyping was significant for ABCA4 mutations P1380L and R2030Q.
X
ABCA4 p.Pro1380Leu 18854780:47:47
status: NEW
Login to comment

55 Genotyping revealed two heterozygous ABCA4 mutations, P1380L and S1696N.
X
ABCA4 p.Pro1380Leu 18854780:55:54
status: NEW
Login to comment

61 STGD mutations P1380L and P1380L.
X
ABCA4 p.Pro1380Leu 18854780:61:15
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:61:26
status: NEW
Login to comment

65 STGD mutations P1380L and R2030Q.
X
ABCA4 p.Pro1380Leu 18854780:65:15
status: NEW
Login to comment

87 Case 1 demonstrated peripapillary and central atrophy in a mildly myopic patient with ABCA4 mutations P1380L and IVS40 ϩ 5GϾA.
X
ABCA4 p.Pro1380Leu 18854780:87:102
status: NEW
Login to comment

88 Case 2 demonstrated atrophic fleck lesions involving the peripapillary region, central atrophy, and homozygous ABCA4 mutations P1380L and P1380L. Case 3 revealed bilateral central atrophy and pisciform fleck atrophy involving the peripapillary, macular, and peripheral regions with ABCA4 mutations P1380L and R2030Q.
X
ABCA4 p.Pro1380Leu 18854780:88:127
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:88:138
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:88:298
status: NEW
Login to comment

92 Overall, ABCA4 mutation P1380L was noted in 13 cases (8.7%), IVS40 ϩ 5GϾA in 6 cases (4.0%), and R2030Q in 1 case (0.7%).
X
ABCA4 p.Pro1380Leu 18854780:92:24
status: NEW
Login to comment

93 Cases 4 and 5 share common ABCA4 mutations with cases 1, 2, and 3 (P1380L or IVS40 ϩ 5GϾA), but did not yield findings of peripapillary atrophy. We were unable to find any previous reports in the literature of peripapillary atrophy in STGD, compound heterozygous ABCA4 mutations P1380L and IVS40 ϩ 5GϾA, clinical descriptions of homozygous mutations P1380L and P1380L, or clinical descriptions of compound heterozygous mutations P1380L and R2030Q.
X
ABCA4 p.Pro1380Leu 18854780:93:67
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:93:291
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:93:374
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:93:385
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:93:453
status: NEW
Login to comment

99 STGD mutations P1380L and S1696N.
X
ABCA4 p.Pro1380Leu 18854780:99:15
status: NEW
Login to comment

102 Summary of Findings Case Number ABCA4 Mutation(s) Confirming Stargardt Disease Peripapillary Atrophy BCVA Age of Onset (yrs) Duration of Disease (yrs)OD OS 1 P1380L IVS40 ϩ 5GϾA Yes 20/400 20/400 29 16 2 P1380L P1380L Yes 20/40 20/150 18 1 3 P1380L R2030Q Yes 20/150 20/150 8 6 4 P1380L S1696N No 20/150 20/70 45 7 5 IVS40 ϩ 5GϾA - No 20/400 20/400 17 28 BCVA, best-corrected visual acuity.
X
ABCA4 p.Pro1380Leu 18854780:102:158
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:102:216
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:102:223
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:102:254
status: NEW
X
ABCA4 p.Pro1380Leu 18854780:102:292
status: NEW
Login to comment

PMID: 19365591 [PubMed] Maia-Lopes S et al: "ABCA4 mutations in Portuguese Stargardt patients: identification of new mutations and their phenotypic analysis."
No. Sentence Comment
68 Family Patient CFC Onset (age) VA (OD/OS) Nucleotide changes (exons) Effect changes [references] 1 4427 S 7 1/10 / 1/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4413 S 14 1/10 / 0.5/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4454 S 11 1/10 / 1/10 c.286A>G(3) / c.
X
ABCA4 p.Pro1380Leu 19365591:68:30
status: NEW
X
ABCA4 p.Pro1380Leu 19365591:68:166
status: NEW
X
ABCA4 p.Pro1380Leu 19365591:68:252
status: NEW
Login to comment

69 4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 2 4458 Mi 5 8/10 / 6/10 ND / ND ND/ND 4455 S 8 1/10 / 8/10 ND / ND ND/ND 3 4431 Mo 6 1,6/10 / 1,6/10 c.1804C>T(13) / c.IVS+5G>A(40) p.Arg602Trp [30]/SPLICE [11] 4 4626 S 6 FC / FC c.3211_3212insGT(22) / c.3211_3212insGT(22) p.Asp1048fs [5]/p.Asp1048fs [5] 5 4514 S 12 1/10 / 1/10 c.32T>C(1) / c.
X
ABCA4 p.Pro1380Leu 19365591:69:30
status: NEW
Login to comment

67 Family Patient CFC Onset (age) VA (OD/OS) Nucleotide changes (exons) Effect changes [references] 1 4427 S 7 1/10 / 1/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4413 S 14 1/10 / 0.5/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4454 S 11 1/10 / 1/10 c.286A>G(3) / c.
X
ABCA4 p.Pro1380Leu 19365591:67:166
status: NEW
X
ABCA4 p.Pro1380Leu 19365591:67:252
status: NEW
Login to comment

PMID: 18285826 [PubMed] Kitiratschky VB et al: "ABCA4 gene analysis in patients with autosomal recessive cone and cone rod dystrophies."
No. Sentence Comment
70 of alleles Reference Missense: 6 c.731T4Ca p.L244P 2 23 12 c.1622T4Cb p.L541P 1 5 13 c.1928T4G p.V643G 1 9 17 c.2588G4C p.G863A and p.G863del 2 4 21 c.3113C4Tb p.A1038V 1 4 25 c.3608G4A p.G1203E 1 24 28 c.4139C4T p.P1380L 2 25 30 c.4457C4T p.P1486L 1 25 30 c.4462T4C p.C1488R 1 25 37 c.5285C4A p.A1762D 1 24 41 c.5819T4C p.L1940P 1 26 42 c.5882G4A p.G1961E 1 9 45 c.6148G4C p.V2050L 1 25 45 c.6229C4T p.R2077W 1 25 Nonsense: 6 c.700C4T p.Q234X 1 This study 6 c.735T4G p.Y245X 2 24 28 c.4234C4T p.Q1412X 1 10 Deletion: 24 c.3539_3554del p.S1181PfsX8 1 This study 43 c.5917delG p.V1973X 3 27 Splice site/intronic: 26 c.5196+1G4A Splicing 1 9 34 c.4848+2T4C Splicing 1 This study 36 c.5196+1_5196+4del Splicing 1 15 39 c.5461À10T4C Unknown 8 14 40 c.5714+5G4A Splicing?
X
ABCA4 p.Pro1380Leu 18285826:70:215
status: NEW
Login to comment

99 Another arCRD patient (RCD9/ 1989) harbours two mutations (p.P1380L and p.R2077W) which are both characterised by substantially impaired ATP-binding.32 A fourth arCRD patient (RCD92/6809) is homozygous for the missense mutation p.L244P.
X
ABCA4 p.Pro1380Leu 18285826:99:61
status: NEW
Login to comment

PMID: 16682602 [PubMed] Fingert JH et al: "Case of Stargardt disease caused by uniparental isodisomy."
No. Sentence Comment
2 Goldmann vi- sualfieldsconfirmedbilateralcentral scotomas,andastandardelectroreti- nogramwasnormal.Thepatientwas tested for ABCA4 mutations using standardmethods6 andwasfoundto behomozygousforanABCA4muta- tion of proline to leucine at position 1380 (P1380L).
X
ABCA4 p.Pro1380Leu 16682602:2:213
status: NEW
X
ABCA4 p.Pro1380Leu 16682602:2:250
status: NEW
Login to comment

3 Interestingly, only the patient`s father is a carrier of the P1380L mutation.
X
ABCA4 p.Pro1380Leu 16682602:3:61
status: NEW
Login to comment

6 Quantitative polymer- asechainreactionexperimentscon- firmed that the patient was truly homozygous for P1380L (data not shown),suggestingthatbothcopies of this mutation were paternally inherited due to uniparental disomy.
X
ABCA4 p.Pro1380Leu 16682602:6:103
status: NEW
Login to comment

13 Recessive alleles on the involved chromosome in uniparental disomy may become homozygous in offspring.Consequently,uniparentaldi- somy may result in expression of a recessive disease inherited from only 1parent.Thisnon-Mendelianmecha- nism of disease inheritance has been observed in rod monochromacy,7 retinitis pigmentosa,8-11 and Leber congenital amaurosis.10 We investigated whether the patient inherited both P1380L alleles of the ABCA4 gene from her father by genotyping the patient and her family at 24 short tandem repeat polymorphism genetic markers distributed across chromosome 1 using standard techniques12 (Figure 3).
X
ABCA4 p.Pro1380Leu 16682602:13:414
status: NEW
Login to comment

17 These data suggest that the patient is homozygous for the P1380L ABCA4 mutation as a consequence of inheriting 2 identical copies of chromosome 1 from her father (uniparental paternal isodisomy).
X
ABCA4 p.Pro1380Leu 16682602:17:58
status: NEW
Login to comment

24 Wt/P1380L Wt/Wt P1380/WtP1380L/P1380L Figure 2.
X
ABCA4 p.Pro1380Leu 16682602:24:3
status: NEW
X
ABCA4 p.Pro1380Leu 16682602:24:25
status: NEW
Login to comment

26 The proband (filled symbol) has Stargardt disease and is homozygous for the P1380L mutation (mutation of proline to leucine at position 1380) in ABCA4.
X
ABCA4 p.Pro1380Leu 16682602:26:76
status: NEW
X
ABCA4 p.Pro1380Leu 16682602:26:105
status: NEW
Login to comment

101 D1S468 D1S1612* D1S1635* D1S552 D1S3721* D1S188* D1S2868* D1S2849* D1S406* D1S2779* ABCA4 (P1380L) D1S1587 Centromere D1S1671* D1S3723* D1S305* D1S1595* D1S1699 D1S1677 D1S2790* D1S1660* D1S1726 D1S1632 124 FO8 D1S179* D1S1609* 4.22 16.22 23.35 45.33 72.59 126.16 126.16 126.16 126.16 126.16 128.73 134.20 140.39 159.32 161.05 170.84 175.62 190.98 212.44 214.08 214.08 226.16 252.12 274.53 2 2 2 1 3 2 1 2 1 1 L 2 • 1 4 1 1 1 2 4 1 2 1 2 3 2 2 2 2 1 3 2 1 2 1 1 L 2 • 1 4 1 1 1 2 4 1 2 1 2 3 2 Patient Mother 1 1 1 1 2 3 2 1 3 2 P 1 • 2 1 2 2 1 2 1 2 2 1 2 1 1 2 3 3 1 4 4 3 3 4 2 P 2 • 2 2 2 3 1 3 2 3 3 3 3 2 3 Father Sister 2 2 2 1 1 1 1 2 1 1 P 2 • 1 3 1 1 1 2 3 1 1 1 1 3 2 2 2 3 2 3 2 2 3 2 2 L 2 • 1 4 2 1 2 1 4 1 2 2 2 3 3 1 1 1 1 1 2 1 1 1 1 P 2 • 1 1 1 1 1 2 1 1 1 2 1 2 1 2 2 3 2 4 4 3 2 4 2 L 2 • 2 4 2 3 1 3 4 3 2 3 3 3 3 Marker Locus, cM Figure 3.
X
ABCA4 p.Pro1380Leu 16682602:101:91
status: NEW
Login to comment

99 D1S468 D1S1612* D1S1635* D1S552 D1S3721* D1S188* D1S2868* D1S2849* D1S406* D1S2779* ABCA4 (P1380L) D1S1587 Centromere D1S1671* D1S3723* D1S305* D1S1595* D1S1699 D1S1677 D1S2790* D1S1660* D1S1726 D1S1632 124 FO8 D1S179* D1S1609* 4.22 16.22 23.35 45.33 72.59 126.16 126.16 126.16 126.16 126.16 128.73 134.20 140.39 159.32 161.05 170.84 175.62 190.98 212.44 214.08 214.08 226.16 252.12 274.53 2 2 2 1 3 2 1 2 1 1 L 2 ߦ 1 4 1 1 1 2 4 1 2 1 2 3 2 2 2 2 1 3 2 1 2 1 1 L 2 ߦ 1 4 1 1 1 2 4 1 2 1 2 3 2 Patient Mother 1 1 1 1 2 3 2 1 3 2 P 1 ߦ 2 1 2 2 1 2 1 2 2 1 2 1 1 2 3 3 1 4 4 3 3 4 2 P 2 ߦ 2 2 2 3 1 3 2 3 3 3 3 2 3 Father Sister 2 2 2 1 1 1 1 2 1 1 P 2 ߦ 1 3 1 1 1 2 3 1 1 1 1 3 2 2 2 3 2 3 2 2 3 2 2 L 2 ߦ 1 4 2 1 2 1 4 1 2 2 2 3 3 1 1 1 1 1 2 1 1 1 1 P 2 ߦ 1 1 1 1 1 2 1 1 1 2 1 2 1 2 2 3 2 4 4 3 2 4 2 L 2 ߦ 2 4 2 3 1 3 4 3 2 3 3 3 3 Marker Locus, cM Figure 3.
X
ABCA4 p.Pro1380Leu 16682602:99:91
status: NEW
Login to comment

PMID: 16103129 [PubMed] Wiszniewski W et al: "ABCA4 mutations causing mislocalization are found frequently in patients with severe retinal dystrophies."
No. Sentence Comment
146 Genotype-phenotype correlations among patients bearing one and two mislocalization-mutations Two mislocalization-alleles One mislocalization-allele RP STGD Allele 1 Allele 2 AO Allele 1 Allele 2 AO [L541P; A1038V] [L541P; A1038V] 7 [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 9 [L541P; A1038V] R1108H 13 [L541P; A1038V] G1961E 16 CRD [L541P; A1038V] G1961E 28 Allele 1 Allele 2 AO [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 10 [L541P; A1038V] L2027F 12 [L541P; A1038V] C1490Y 12 [L541P; A1038V] P1380L 5 R602W R602W 7 [L541P; A1038V] T1019M 6 [L541P; A1038V] G1961E 7 STGD [L541P; A1038V] T1019M 6 Allele 1 Allele 2 AO R602W L2027F 9 [L541P; A1038V] [L541P; A1038V] 12 C1490Y G1961E 28 C1490Y C1490Y 7 C1490Y G1961E 13 C1490Y R602W 9 C1490Y L2027F 10 C1490Y R602W 10 C1490Y L2027F 18 C1490 L2027F 18 AO-age of onset (in years).
X
ABCA4 p.Pro1380Leu 16103129:146:524
status: NEW
Login to comment

PMID: 15579991 [PubMed] Oh KT et al: "Electroretinographic findings in patients with Stargardt disease and fundus flavimaculatus."
No. Sentence Comment
9 The most common of these were His423Arg (9), frameshift mutations (7), Ala1038Val (7), and Pro1380Leu (6).
X
ABCA4 p.Pro1380Leu 15579991:9:91
status: NEW
Login to comment

165 In fact, the six most common HPRDCV, with the exception of His423Arg, (frameshift changes, Ala1038Val, Pro1380Leu, Arg1108Cys, Leu2027Phe) were observed with all three ERG classes: severe ERG derangements, mild ERG derangements, and normal ERG studies.
X
ABCA4 p.Pro1380Leu 15579991:165:103
status: NEW
Login to comment

PMID: 15192030 [PubMed] Stenirri S et al: "Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations."
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations.
X
ABCA4 p.Pro1380Leu 15192030:35:230
status: NEW
Login to comment

34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations.
X
ABCA4 p.Pro1380Leu 15192030:34:230
status: NEW
Login to comment

PMID: 14517951 [PubMed] Jaakson K et al: "Genotyping microarray (gene chip) for the ABCR (ABCA4) gene."
No. Sentence Comment
115 Mutations Detected in theTwoTest Populations by the ABCR400 Array,That Had Not Been Found by SSCP Number Nucleotide change Protein e¡ect Number of cases 1 161G4A C54Y 3 2 194G4A G65E 1 3 428C4T P143L 1 4 455G4A R152Q 1 5 514G4A G172S 1 6 635G4A R212H 1 7 656G4C R219T 1 8 768G4Ta Splice/V256V 3 9 1007C4G S336C 2 10 1268A4G H423R 4 11 1411G4A E471K 2 12 1622T4Ca L541P 8 13 1933G4A D645N 1 14 2041C4T R681X 5 15 2090G4A W697X 1 16 2471T4C I824T 1 17 2588G4Ca Splice/G863A 5 18 2828G4A R943Q 1 19 2966T4C V989A 1 20 2971G4C G991R 1 21 4139C4T P1380L 8 22 4195G4A E1399K 1 23 4328G4A R1443H 1 24 4457C4T P1486L 1 25 4462T4Ca C1488R 1 26 4469G4Aa C1490Y 1 27 4918C4Ta R1640W 2 28 IVS40+5G4A Splice 2 29 5537T4C I1846T 2 30 5882G4A G1961E 5 31 6089G4A R2030Q 1 32 6104T4C L2035P 1 33 6449G4A C2150Y 1 Mutation numbering is based on the cDNA sequence (GenBank NM_000350).
X
ABCA4 p.Pro1380Leu 14517951:115:547
status: NEW
Login to comment

PMID: 11726554 [PubMed] Shroyer NF et al: "Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration."
No. Sentence Comment
43 Of note, AR468-8 was heterozygous for three mutations: the transitions 3758C→T (encoding the missense mutation T1253M), 4139C→T (encoding the missense mutation P1380L) and 5882G→A (encoding the missense mutation G1961E).
X
ABCA4 p.Pro1380Leu 11726554:43:172
status: NEW
Login to comment

44 Segregation analysis in this family revealed that two alterations (T1253M and G1961E) were on the same chromosome; thus AR468-8 is compound heterozygous for a novel complex allele [T1253M; G1961E] and the missense mutation P1380L (Fig. 1).
X
ABCA4 p.Pro1380Leu 11726554:44:223
status: NEW
Login to comment

97 Pedigree Maternal allele Paternal allele AMD relative A priori Cosegregation AR19 pGM, -6 0.5 - AR33 [W1408R; R1640W] R24H and D1532N mA, -16 0.5 Yes AR59 4232insTATG C1488R pGM, -6 0.5 No AR80 T1526M pGF, -5 0.5 - AR80 T1526M mGF, -7 0.5 Yes AR125 4947delC C1488R pGM, -7 0.5 Yes AR215 [H1406Y; V2050L] pGM, -5 0.5 - AR218 2160+1G→C G1961E mA, -8 0.5 No AR262 W821R pGGF, -7 0.25 No AR271 P68R E1087K mGA, -6 0.25 No AR335 D645N F608I mGM, -9 0.5 Yes AR382 R1108C mGM, -6 0.5 Yes AR389 E2096K 5714+5G→A pGM, -8 0.5 Yes AR397 5196+1G→A 5585-1G→A mA, -5 0.5 No AR410 A1038V 768G→T pC, -5 0.25 Yes AR422 pGM, -6 0.5 - AR423 P1380L D1532N pGF, -4 0.5 No AR468 P1380L P1380L mU, -9 0.5 Yes AR484 L2027F G550R mGU, -5 0.25 Yes AR562 R2107H 3050+5G→A pGU, -5 0.25 No AR643 5196+2T→C L2027F mU, -4 0.5 Yes AR661 P1380L C54Y mGF, -6 0.5 Yes AR669 664del13 pGF, -4 0.5 No AR534 W821R P1380L pGM, -7 0.5 Yes (17) Family 1 R212C I2113M mGM, I-2 0.5 Yes (27) Family 2 R1108C R2107H mGM, I-2 0.5 Yes (27) Family 3 R212C G1977S mGF, I-1 0.5 Yes (27) 10.25 15 unlikely to account for many of the remaining alleles (our unpublished observations).
X
ABCA4 p.Pro1380Leu 11726554:97:652
status: NEW
X
ABCA4 p.Pro1380Leu 11726554:97:657
status: NEW
X
ABCA4 p.Pro1380Leu 11726554:97:687
status: NEW
X
ABCA4 p.Pro1380Leu 11726554:97:692
status: NEW
X
ABCA4 p.Pro1380Leu 11726554:97:694
status: NEW
X
ABCA4 p.Pro1380Leu 11726554:97:699
status: NEW
Login to comment

108 For example, the mutation P1380L was identified in 3/3 AMD-affected relatives of STGD patients (AR468-9, AR534-7, AR661-6).
X
ABCA4 p.Pro1380Leu 11726554:108:26
status: NEW
Login to comment

109 Although not significant (P = 0.083) by itself, analysis of additional STGD families who share the P1380L allele may reveal a selective association with AMD and thus allow calculation of the risk for this allele.
X
ABCA4 p.Pro1380Leu 11726554:109:99
status: NEW
Login to comment

114 Sun et al. (28) reported substantial defects in protein expression or ATP binding of eight AMD-associated mutations (R212C, G863A, A1038V, R1108C, R1129L, P1380L, G1961E and L2027F) and an abnormal increase in the ATPase activity of the D2177N mutation, and they reported mild defects or wild-type activity within the sensitivity of the assay in four other AMD-associated variants (E471K, C1488R, T1526M and R1898H).
X
ABCA4 p.Pro1380Leu 11726554:114:155
status: NEW
Login to comment

PMID: 11702214 [PubMed] Fumagalli A et al: "Mutational scanning of the ABCR gene with double-gradient denaturing-gradient gel electrophoresis (DG-DGGE) in Italian Stargardt disease patients."
No. Sentence Comment
37 DNA samples (n=22) carrying previously identified mutations in the ABCR gene were employed as controls for evaluating the efficacy of the DG-DGGE approach in detecting sequence variations R572Q (Lewis et al. 1999), Y639X (Lewis et al. 1999), G863A (Lewis et al. 1999; Maugeri et al. 1999), A1038V (Rozet et al. 1998), T1019M (Rozet et al. 1998), 3211insGT (Lewis et al. 1999), P1380L (Lewis et al. 1999), H1406Y (Lewis et al. 1999), 4947delC (Lewis et al. 1999), H1838Y (Lewis et al. 1999), 5714+5G→A (Cremers et al. 1998), N1868I (De La Paz et al. 1999), L1938L (Rivera et al. 2000), G1961E (Allikmets et al. 1997a, 1997b), L1970F (Lewis et al. 1999), L2027F (Nasonkin et al. 1998), V2050L (Lewis et al. 1999), E2131K (Lewis et al. 1999), R2139W (Lewis et al. 1999), 6709insG (Lewis et al. 1999), D2177N (Allikmets et al. 1997a, 1997b), 2181del12 (Lewis et al. 1999).
X
ABCA4 p.Pro1380Leu 11702214:37:377
status: NEW
Login to comment

PMID: 11527935 [PubMed] Briggs CE et al: "Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration."
No. Sentence Comment
63 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P Ͻ 0.04).
X
ABCA4 p.Pro1380Leu 11527935:63:25
status: NEW
Login to comment

81 An additional three with Stargardt and two with CRD were homozygotes for a likely pathogenic sequence change (Leu244Pro, Pro1380Leu, Arg1640Gln, Cys2150Tyr, or Val1973[delG]).
X
ABCA4 p.Pro1380Leu 11527935:81:121
status: NEW
Login to comment

89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No.
X
ABCA4 p.Pro1380Leu 11527935:89:832
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:89:5297
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:89:5343
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:89:5531
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:89:5837
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:89:6108
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:89:6327
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:89:6416
status: NEW
Login to comment

62 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P b0d; 0.04).
X
ABCA4 p.Pro1380Leu 11527935:62:25
status: NEW
Login to comment

80 An additional three with Stargardt and two with CRD were homozygotes for a likely pathogenic sequence change (Leu244Pro, Pro1380Leu, Arg1640Gln, Cys2150Tyr, or Val1973[delG]).
X
ABCA4 p.Pro1380Leu 11527935:80:121
status: NEW
Login to comment

88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued).
X
ABCA4 p.Pro1380Leu 11527935:88:832
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:88:5375
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:88:5421
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:88:5609
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:88:5915
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:88:6186
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:88:6405
status: NEW
X
ABCA4 p.Pro1380Leu 11527935:88:6494
status: NEW
Login to comment

PMID: 11328725 [PubMed] Webster AR et al: "An analysis of allelic variation in the ABCA4 gene."
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Pro1380Leu 11328725:102:3564
status: NEW
Login to comment

148 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His.
X
ABCA4 p.Pro1380Leu 11328725:148:171
status: NEW
Login to comment

103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Pro1380Leu 11328725:103:3468
status: NEW
Login to comment

149 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His.
X
ABCA4 p.Pro1380Leu 11328725:149:171
status: NEW
Login to comment

PMID: 10958763 [PubMed] Rivera A et al: "A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration."
No. Sentence Comment
80 Nucleotide alterations occurring in sim- Table 2 ABCA4 Mutations Found in Patients with STGD and AMD and in Controls EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 3: 178GrA A60T 1 0 0 This study 179CrT A60E 1 0 0 This study 194GrA G65E 1 0 0 Fishman et al. (1999) 203CrT P68L 1 0 0 This study 214GrA G72R 1 0 0 This study 296insA Frameshift 2 0 0 This study 5: 454CrT R152X 1 0 0 This study 6: 634CrT R212C 1 0 0 Lewis et al. (1999) 688TrA C230S 1 0 0 This study 730delCT Frameshift 1 0 0 This study 740ArG N247S 1 0 0 This study 768GrT Splice 2 0 0 Maugeri et al. (1999) 8: 983ArT E328V 1a 0 0 This study 1086TrA Y362X 1 0 0 This study 10: 1317GrA W438X 1 0 0 This study 11: 1411GrA E471K 1 0 0 Lewis et al. (1999) 12: 1622TrC L541P 21a 1a 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 1715GrA R572Q 1a 0 0 Lewis et al. (1999) 13: 1819GrA G607R 1 0 0 This study 1903CrA Q635K 2a 0 0 This study 1903CrT Q635X 1 0 0 This study IVS13ϩ1GrA Splice 2 0 0 This study 14: 1957CrT R653C 1 0 0 This study 1988GrA W663X 1 0 0 This study 2041CrT R681X 4 0 0 Maugeri et al. (1999) 15: 2291GrA C764Y 1 0 0 This study 2292delT Frameshift 1a 0 0 This study 2295TrG S765R 1a 0 0 This study 16: 2564GrA W855X 1 0 0 Nasonkin et al. (1998) 17: 2588GrC Spliceb 17a 6 5 Allikmets et al. (1997a), Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999), Papaioannou et al. (2000) 18: 2701ArG T901A 0 2 0 This study 2741ArG H914A 0 0 1 This study 19: 2876CrT T959I 1 0 0 This study 20: IVS20ϩ5GrA Splice 1 0 0 This study 21: 3106GrA E1036K 1a 0 0 Nasonkin et al. (1998) 3113CrT A1038V 26a 4a 1 Allikmets et al. (1997a), Cremers et al. (1998), Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) T3187TrC S1063P 1 0 0 This study (Continued) 805 Table 2 Continued EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 22: 3292CrT R1097C 1 0 0 This study 3322CrT R1108C 4 0 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999) 24: 3528insTGCA Frameshift 1 0 0 This study 25: 3808GrT E1270X 1 0 0 This study 27: 3898CrT R1300X 1 0 0 This study 28: IVS28ϩ5GrA Splice 1 0 0 This study 4139CrT P1380L 1 0 0 Lewis et al. (1999) 4195GrA E1399K 2 0 0 This study 4234CrT Q1412X 4 0 0 Maugeri et al. (1999) 29: 4289TrC L1430P 2 0 0 This study 4318TrG F1440V 1 0 0 This study 4328GrA R1443H 1 0 0 This study 30: 4457CrT P1486L 1 0 0 Lewis et al. (1999) 4463GrA C1488Y 1 0 0 This study 31: 4610CrT T1537M 1 0 0 This study 35: IVS35ϩ2TrA Splice 1 0 0 This study 36: 5065TrC S1689P 1 0 0 This study 5114GrT R1705L 1 0 0 This study IVS36ϩ1GrA Splice 1 0 0 This study 37: 5198TrC M1733T 0 0 1 This study 5242GrA G1748R 1 0 0 This study 5248CrT Q1750X 1 0 0 This study 5288TrC L1763P 1 0 0 This study 38: IVS38ϩ1GrA Splice 1 0 0 This study 40: 5653GrA E1885K 1 0 0 This study 5693GrA R1898H 5 2 1 Allikmets et al. (1997b), Lewis et al. (1999) IVS40ϩ5GrA Splice 8a 0 0 Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999) 42: 5882GrA G1961E 34 4 2 Allikmets et al. (1997b), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 43: 5917delG Frameshift 3 0 0 This study 5923GrC G1975R 1 0 0 This study 5929GrA G1977S 1 0 0 Rozet et al. (1998), Lewis et al. (1999) 45: 6229CrG R2077G 1 0 0 This study 6229CrT R2077W 1 0 0 Allikmets et al. (1997a), Fishman et al. (1999), Lewis et al. (1999) 48: 6609CrA Y2203X 2 0 0 This study 6647GrT A2216V 0 0 1 This study a Mutation pairs occurring on a single haplotype.
X
ABCA4 p.Pro1380Leu 10958763:80:2280
status: NEW
Login to comment

PMID: 10396622 [PubMed] Shroyer NF et al: "The rod photoreceptor ATP-binding cassette transporter gene, ABCR, and retinal disease: from monogenic to multifactorial."
No. Sentence Comment
101 Cosegregation of a mutant ABCR allele, P1380L, was observed with both disease phenotypes (Fig. 1).
X
ABCA4 p.Pro1380Leu 10396622:101:39
status: NEW
Login to comment

105 The proband AR534-05 had two independent allelic mutations: a 4139C“T transition which by conceptual translation results in the missense amino acid substitution of leucine for proline at codon 1380 (P1380L; Fig. 1); and a 2461T“A transversion, resulting in a predicted amino acid substitution of arginine for tryptophan at codon 821 (W821R; Fig. 1).
X
ABCA4 p.Pro1380Leu 10396622:105:168
status: NEW
X
ABCA4 p.Pro1380Leu 10396622:105:169
status: NEW
Login to comment

106 The proband`s affected paternal cousins AR534-10 and AR534-12 were each compound heterozygotes for two transition mutations, one (P1380L; Fig. 1) inherited from their mother, the other 3364G“A, resulting in a predicted amino acid substitution of lysine for glutamate at codon 1122 (E1122K; Fig. 1), inherited from their father.
X
ABCA4 p.Pro1380Leu 10396622:106:130
status: NEW
Login to comment

108 The grandmother AR534-07 with AMD shared the P1380L mutation (Fig. 1) but had only polymorphisms in her other ABCR allele, confirming her heterozygous state.
X
ABCA4 p.Pro1380Leu 10396622:108:45
status: NEW
Login to comment

110 However, the mutation P1380L has been seen in three unrelated STGD pedigrees (Lewis et al., 1999).
X
ABCA4 p.Pro1380Leu 10396622:110:22
status: NEW
Login to comment

112 To investigate further the frequency of the P1380L allele, which is due to a base change that eliminates an MspI recognition site, 80 ophthalmoscopically normal individuals over the age of 65 were screened for this alteration by MspI digestion of PCR products encompassing exon 28 (data not shown).
X
ABCA4 p.Pro1380Leu 10396622:112:44
status: NEW
Login to comment

140 2537-25442542 Table 1 Base alteration Amino acid changeIndividual sequence Disease phenotype Mutation type 3364 G“A E1122K534-12 MissenseSTGD P1380L Missense4139 C“T W821R Missense534-05 STGD 2461 T“A 4139 C“T P1380L Missense None5682 G“C Silent 5814 A“G None Silent None Silent534-07 AMD 3294 C“T 4139 C“T P1380L Missense 5603 A“T N18681* Polymorphism SilentNone5682 G“C * This base alteration found in 29/220 controls.
X
ABCA4 p.Pro1380Leu 10396622:140:147
status: NEW
X
ABCA4 p.Pro1380Leu 10396622:140:230
status: NEW
X
ABCA4 p.Pro1380Leu 10396622:140:347
status: NEW
Login to comment

141 Table 1 Base alteration Amino acid change Individual sequence Disease phenotype Mutation type 3364 G]A E1122K 534-12 Missense STGD P1380L Missense 4139 C]T W821R Missense 534-05 STGD 2461 T]A 4139 C]T P1380L Missense None 5682 G]C Silent 5814 A]G None Silent None Silent 534-07 AMD 3294 C]T 4139 C]T P1380L Missense 5603 A]T N18681* Polymorphism Silent None 5682 G]C * This base alteration found in 29/220 controls.
X
ABCA4 p.Pro1380Leu 10396622:141:135
status: NEW
X
ABCA4 p.Pro1380Leu 10396622:141:217
status: NEW
X
ABCA4 p.Pro1380Leu 10396622:141:332
status: NEW
Login to comment

PMID: 9973280 [PubMed] Lewis RA et al: "Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease."
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift.
X
ABCA4 p.Pro1380Leu 9973280:76:709
status: NEW
Login to comment

148 Individual AR534-05, with genotype P1380L/ W821R, presented with visual impairment at age 10 years, whereas his cousins, each with genotype P1380L/ E1122K, had onset of visual impairment at ages 8-10 years.
X
ABCA4 p.Pro1380Leu 9973280:148:35
status: NEW
X
ABCA4 p.Pro1380Leu 9973280:148:140
status: NEW
Login to comment

149 Two compound heterozygous families, AR335 and AR341, had both mutations in the same exon (F608I/D645N in exon 13 and P1380L/W1408R in exon 28, respectively) and had an early age at onset of 6 years.
X
ABCA4 p.Pro1380Leu 9973280:149:35
status: NEW
X
ABCA4 p.Pro1380Leu 9973280:149:117
status: NEW
X
ABCA4 p.Pro1380Leu 9973280:149:140
status: NEW
Login to comment

178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade.
X
ABCA4 p.Pro1380Leu 9973280:178:499
status: NEW
Login to comment

77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift.
X
ABCA4 p.Pro1380Leu 9973280:77:715
status: NEW
Login to comment

150 Two compound heterozygous families, AR335 and AR341, had both mutations in the same exon (F608I/D645N in exon 13 and P1380L/W1408R in exon 28, respectively) and had an early age at onset of 6 years.
X
ABCA4 p.Pro1380Leu 9973280:150:117
status: NEW
Login to comment

179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade.
X
ABCA4 p.Pro1380Leu 9973280:179:452
status: NEW
Login to comment

PMID: 23143460 [PubMed] Downes SM et al: "Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications."
No. Sentence Comment
30 In 3 of the 6 patients with a historical diagnosis Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients (continued) Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 11 4139Cb0e;T P1380L 5714 af9; 5Gb0e;A Splice NK NK 19 STGD m/0/0 0 2 PVs 12 4457Cb0e;T P1486L 4457Cb0e;T P1486L In trans Unaffected sibling carries 1 mutation 25 STGD maf9;af9;/1/1 0 2 PVs 13 4537dupC Q1513fs 6391Gb0e;A E2131K In trans Unaffected parents carriers 10 STGD maf9;/0/0 R152Q in cis with Q1513fs, E2131K in cis with E471K 2 PVs 14 6079Cb0e;T L2027F 6079Cb0e;T L2027F In trans Unaffected sibling carrier 28 STGD maf9;af9;/0/0 0 2 PVs 15 5018 af9; 2Tb0e;C NA 6316Cb0e;T R2106C In trans Affected sibling with same mutations 17 STGD m/0/1 0 2 PVs 16 3004Cb0e;T R1002Wb 1957Cb0e;T R653C In trans NK 16 STGD m/0/1 0 2 PVs 17 1253Tb0e;C F418S 2588Gb0e;C G863A NK NK 52 STGD maf9;/0/0 0 2 PVs 18 6709Ab0e;C T2237Pb 3064Gb0e;A E1022K In trans 2 Affected siblings with same mutations 6 STGD maf9;af9;/0/0 0 2 PVs 19 5260Tb0e;G Y1754D 4469Gb0e;A C1490Y In trans NK 12 STGD maf9;af9;/0/0 0 2 PVs 20 551Cb0e;T S184Fb 4793Cb0e;A A1598D NK 2 Affected siblings with same mutations 58 STGD m/NP/NP 0 2 PVs 21 550-551TCb0e;CG S184Rb 5882Gb0e;A G1961E In trans Affected sibling with same mutations 25 STGD maf9;af9;/0/0 0 2 PVs 22 5313-3Cb0e;G Spliceb 5882Gb0e;A G1961E In trans Unaffected parents carriers 47 STGD m/0/1 0 2 PVs 23 2588Gb0e;C G863A 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans NA 26 STGD maf9;af9;/3/1 1 In cis with G863A 2 PVs 24 5537Tb0e;C I1846T 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected son carries I1846T only 17 STGD maf9;af9;/3/3 0 2 PVs 25 6089Gb0e;A R2030Q 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected sibling carries R2030Q 4 STGD m/NP/NP 0 2 PVs 26 6730-1Gb0e;C Spliceb 2588Gb0e;C G863A NK NK 15 STGD NP/NP/NP 0 2 PVs 27 3291Ab0e;T R1097Sb 3056Cb0e;T T1019M In trans NK 9 STGD NP/NP/NP 1 In cis with R1097S 2 PVs 28 498delT L167HisfsX2b Not present NA NA NK 28 STGD m/1/1 0 1 PV 29 2345Gb0e;A W782Xb Not present NA NA Unaffected mother carries mutation 25 STGD m/1/1 0 1 PV 30 2588Gb0e;C G863A 4326Cb0e;A N1442K NK NK 36 STGD maf9;/0/0 0 1 PV af9; N1442K (unlikely) 31 2966Tb0e;C V989A Not present NA NA NK 49 STGD m/1/1 0 1 PV (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1487 (c)2012 American Medical Association. All rights reserved. Downloaded From: http://archopht.jamanetwork.com/ by a Semmelweis University Budapest User on 12/06/2015 lopathy is genetically heterogeneous. A total of 10 novel mutations were identified (Table).
X
ABCA4 p.Pro1380Leu 23143460:30:334
status: NEW
Login to comment

PMID: 23419329 [PubMed] Chacon-Camacho OF et al: "ABCA4 mutational spectrum in Mexican patients with Stargardt disease: Identification of 12 novel mutations and evidence of a founder effect for the common p.A1773V mutation."
No. Sentence Comment
82 These mutations were p.R24W, p.G818E, p.P1380L, p.V1682_V1686del, p.R1705Q, p.A1773V, p.I1775N, p.Y1779H, and p.N1868I.
X
ABCA4 p.Pro1380Leu 23419329:82:40
status: NEW
Login to comment

100 Allele 1 Allele 2 Genotype Exon Nucleotide change Polypeptide change Exon Nucleotide change Polypeptide change Familial case # 1 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 2 e NI e e NI e e 3 6 c.634C>T p.R212C (D) 38 c.5318C>T p.A1773V (D) Compound heterozygous 4 23 c.3386G>T p.R1129L (D) 28 c.4139C>T p.P1380L (D) Compound heterozygous 5 e NI e e NI e e 6 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 7 e NI e e NI e e 8 16 c.2453G>A p.G818E (D) 28 c.4249_4251 delTTC p.F1417del (D; N) Compound heterozygous 9 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous Sporadic case # 1 8 c.868C>T p.R290W (D) e IVS8&#fe;1G>A Splicing (D; N) Compound heterozygous 2 38 c.5318C>T p.A1773V (D) - NI - Heterozygous 3 20 c.3041T>G p.L1014R (D) 1; 49 c.52C>T; c.6764G>T p.R18W (D); p.S2255I (B) Compound heterozygous 4 13; 19 c.1804C>T; c.2828G>A p.R602W (D); p.R943Q (U) 16 c.2453G>A p.G818E (D) Compound heterozygous 5 38 c.5324T>A p. I1775N (D; N) 38 c.5324T>A p.I1775N (D; N) Homozygous 6 e NI e e NI e e 7 49 c.6764G>T p.S2255I (B) 49 c.6764 G>T p.S2255I (B) Homozygous 8 19; 40 c.2828 G>A; c.5503A>T p.R943Q (U); p.N1868I (U) 3 c.265G>T p.E89* (D; N) Compound heterozygous 9 38 c.5335T>C p.Y1779H (D;N) 38 c.5335T>C p.Y1779H (D;N) Homozygous 10 16 c.2453G>A p.G818E (D) 16 c.2453G>A p.G818E (D) Homozygous 11 6 c.723A>T p.E241D (D;N) 36 c.5114G>A p.R1705Q (D) Compound heterozygous 12 2 c.71G>A (D) p.R24H e NI e Heterozygous 13 30 c.4537_4538insC p.Q1513Pfs*41 (D; N) e NI e Heterozygous 14 32 c.4667G>C p.R1556T (D; N) 32 c.4667G>C p.R1556T (D; N) Homozygous 15 45 c.6221G>T p.G2074V (D; N) 16 c.2453G>A p.G818E (D) Compound heterozygous 16 16; 41 c.2453G>A; c.5824G>C p. G818E (D); p. E1942Q (B;N) 46 c.6384A>G p.H2128R (D) Compound heterozygous 17 16 c.2453G>A p. G818E (D) e NI e Heterozygous 18 32 c.4653G>A p. W1551* (D; N) e NI e Heterozygous 19 23 c.3386G>T p. R1129L (D) e NI e Heterozygous 20 36 c.5045_5059del GTTGCCATCTGCGTG p.V1682_ V1686del (D; N) 29; 49 c.4328G>A; c.6764G>T p.R1443H (D); p.S2255I (B) Compound heterozygous 21 19 c.2894A>G p.N965S (D) 19 c.2894A>G p.N965S (D) Homozygous 22 e NI e e NI e e STGD accounts for approximately 7% of all retinal dystrophies; it is one of the most common genetic forms of juvenile or early adult onset macular degeneration.
X
ABCA4 p.Pro1380Leu 23419329:100:326
status: NEW
Login to comment

119 ABCA4 Exon # Nucleotide change Predicted protein effect Number of alleles Population genotypic frequency in EVS Population allelic frequency in EVS (%) 1 c.52C>T p.R18W 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 2 c.71G>A p.R24H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 3 c.265G>T p.E89* (N) 1 NR NR 6 c.634C>T p.R212C 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 6 c.723A>T p.E241D (N) 1 NR NR 8 c.868C>T p.R290W 1 NR NR IVS8 IVS8 &#fe; 1G>A Splicing mutation (N) 1 NR NR 13 c.1804C>T p.R602W 1 NR NR 16 c.2453G>A p.G818E 7 NR NR 19 c.2828G>A p.R943Q 2 AA &#bc; 8/AG &#bc; 400/GG &#bc; 6095 A &#bc; 3.199/G &#bc; 96.801 19 c.2894A>G p.N965S 2 GG &#bc; 0/GA &#bc; 1/AA &#bc; 6502 G &#bc; 0.008/A &#bc; 99.992 20 c.3041T>G p.L1014R 1 NR NR 23 c.3386G>T p.R1129L 2 NR NR 28 c.4139C>T p.P1380L 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 28 c.4249_4251del TTC p.F1417del (N) 1 NR NR 29 c.4328G>A p.R1443H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 30 c.4537_4538insC p.Q1513Pfs*41 (N) 1 NR NR 32 c.4653G>A p.W1551* (N) 1 NR NR 32 c.4667G>C p.R1556T (N) 2 NR NR 36 c.5044_5058del GTTGCCATCTGCGTG p.V1682_V1686del (N) 1 NR NR 36 c.5114G>A p.R1705Q 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 38 c.5318C>T p.A1773V 8 NR NR 38 c.5324T>A p.I1775N (N) 2 NR NR 38 c.5335T>C p.Y1779H (N) 2 NR NR 40 c.5503A>T p.N1868I 1 TT &#bc; 16/TA &#bc; 589/AA &#bc; 5898 T &#bc; 4.775/A &#bc; 95.225 41 c.5824G>C p.E1942Q (N) 1 NR NR 45 c.6221G>T p.G2074V (N) 1 NR NR 46 c.6384A>G p.H2128R 1 NR NR 49 c.6764G>T p.S2255I 4 TT &#bc; 516/TG &#bc; 1473/GG &#bc; 4514 T &#bc; 19.26/G &#bc; 80.74 gold standard for ABCA4 mutational screening.
X
ABCA4 p.Pro1380Leu 23419329:119:856
status: NEW
Login to comment

PMID: 23499370 [PubMed] Fujinami K et al: "A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations."
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2.
X
ABCA4 p.Pro1380Leu 23499370:89:975
status: NEW
X
ABCA4 p.Pro1380Leu 23499370:89:1896
status: NEW
X
ABCA4 p.Pro1380Leu 23499370:89:1959
status: NEW
Login to comment

PMID: 23953153 [PubMed] Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."
No. Sentence Comment
127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value.
X
ABCA4 p.Pro1380Leu 23953153:127:422
status: NEW
Login to comment

141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3.
X
ABCA4 p.Pro1380Leu 23953153:141:1579
status: NEW
Login to comment

145 p. Pro1380Leu, c.5461-10T>C, and p.Gly1961Glu, occurring in 19, 14, 23, and 17 patients, respectively.
X
ABCA4 p.Pro1380Leu 23953153:145:3
status: NEW
Login to comment

164 Comparison of the Most Prevalent ABCA4 Variants` Frequency Between the Cohort With the Foveal-Sparing Stargardt Disease and the Group With the Typical Stargardt Disease (Without Evidence of Foveal Sparing) Number of Alleles and Those Frequencies Foveal-Sparing Stargardt Disease (n &#bc; 31, Total 30 Variants in 62 Alleles) Typical Stargardt Disease (n &#bc; 140, Total 72 Variants in 280 Alleles) c.2588G>C, p.Gly863Ala 4 (6.45%) 19 (6.79%) c.4139C>T, p.Pro1380Leu 2 (3.23%) 14 (5.00%) c.6079C>T, p.Leu2027Phe 4 (6.45%) 10 (3.57%) c.6089G>A, p.Arg2030Gln 4 (6.45%) 3 (1.07%) c.5461-10T>C 3 (4.84%) 23 (8.21%) c.5882G>A, p.Gly1961Glu 1 (1.61%) 17 (6.07%) in the foveal-sparing phenotype compared to the typical phenotype; there was also clear concordance in sibships with the foveal-sparing phenotype, although a possible influence of genetic/environmental modifiers cannot be excluded.
X
ABCA4 p.Pro1380Leu 23953153:164:456
status: NEW
Login to comment

PMID: 23982839 [PubMed] Fujinami K et al: "ABCA4 gene screening by next-generation sequencing in a British cohort."
No. Sentence Comment
55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho.
X
ABCA4 p.Pro1380Leu 23982839:55:1348
status: NEW
X
ABCA4 p.Pro1380Leu 23982839:55:1402
status: NEW
X
ABCA4 p.Pro1380Leu 23982839:55:1452
status: NEW
X
ABCA4 p.Pro1380Leu 23982839:55:1501
status: NEW
X
ABCA4 p.Pro1380Leu 23982839:55:1553
status: NEW
X
ABCA4 p.Pro1380Leu 23982839:55:1580
status: NEW
X
ABCA4 p.Pro1380Leu 23982839:55:1607
status: NEW
Login to comment

62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred.
X
ABCA4 p.Pro1380Leu 23982839:62:2476
status: NEW
Login to comment

PMID: 24071957 [PubMed] Duncker T et al: "Distinct characteristics of inferonasal fundus autofluorescence patterns in stargardt disease and retinitis pigmentosa."
No. Sentence Comment
51 Summary of Demographic, Clinical, and Genetic Data Patient Condition ABCA4 Mutations Sex Age, y Eye Iris Color Race/Ethnicity BCVA Snellen (logMAR) P1 STGD1 p.P1380L, p.G1961E M 12 OS Blue White 20/100 (0.70) P2 STGD1 p.P1380L, p.G1961E F 17 OS Brown White 20/150 (0.88) P3 STGD1 p.Q1003X, p.G1961E M 25 OS Brown White 20/40 (0.30) P4 STGD1 p.C54Y F 48 OD Blue White 20/30 (0.20) P5 STGD1 p.R2077W F 52 OD Blue White 20/40 (0.30) P6 STGD1 p.[L541P;A1038V] M 13 OS Brown White 20/150 (0.88) P7 STGD1 p.T972N, p.L2027F F 14 OS Blue White 20/80 (0.60) P8 STGD1 c.4537_4538insC, p.V1686M M 49 OS Brown White 20/50 (0.40) P9 STGD1 p.R1108H, p.P1380L M 50 OS Blue White 20/200 (1.00) P10 STGD1 c.5714&#fe;5G>A F 34 OD Blue White 20/200 (1.00) P11 STGD1 p.Q636H, p.G1961E M 46 OD Brown Indian 20/400 (1.30) P12 STGD1 c.5461-10T>C M 35 OD Brown Black 20/400 (1.30) P13 STGD1 p.R1640W F 20 OD Brown Black 20/125 (0.80) P14 STGD1 p.R290W M 47 OS Brown White 20/40 (0.30) P15 STGD1 p.A1773V, p.G1961E M 18 OD Brown White 20/150 (0.88) P16 AD RP p.T17M* F 23 OD Brown Hispanic 20/30 (0.20) P17 AD RP N/A M 39 OS Brown White 20/20 (0.00) P18 AR RP N/A M 50 OS Green White 20/20 (0.00) AD, autosomal dominant; AR, autosomal recessive; BCVA, best corrected visual acuity; F, female; logMAR, logarithm of the minimum angle of resolution; M, male; N/A, not available.
X
ABCA4 p.Pro1380Leu 24071957:51:159
status: NEW
X
ABCA4 p.Pro1380Leu 24071957:51:220
status: NEW
X
ABCA4 p.Pro1380Leu 24071957:51:638
status: NEW
Login to comment

PMID: 24550365 [PubMed] Huang WC et al: "Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations."
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized.
X
ABCA4 p.Pro1380Leu 24550365:74:1555
status: NEW
Login to comment

PMID: 24677105 [PubMed] Burke TR et al: "Quantitative fundus autofluorescence in recessive Stargardt disease."
No. Sentence Comment
47 In some cases where no mutations were detected by the array, or in more recently recruited patients, the next generation sequencing of the entire ABCA4 open reading frame and adjacent intronic sequences was performed on the Roche 454 platform.30 The four most common mutations found in six or more patients were: G1961E (12 patients from 11 families); L541P/ A1038V (eight patients from five families); L2027F (six patients from five families); and P1380L (six patients from six families).
X
ABCA4 p.Pro1380Leu 24677105:47:449
status: NEW
Login to comment

78 [L541P; A1038V] 413 1.9 2 F 25 11 0.80 0.80 II II p.G863A; c.5898&#fe;1G > A 710 675 3.4 3.3 3 M 11 6 0.80 0.70 I - p.G1961E; p.P1380L 267 2.3 4.1 M 35 10 0.30 0.18 I - p.G1961E; p.
X
ABCA4 p.Pro1380Leu 24677105:78:128
status: NEW
Login to comment

80 [L541P; A1038V] 356 354 1.7 1.8 5 F 14 1 0.60 0.60 II II p.L2027F; p.T972N 737 718 2.3 2.6 6 M 45 31 1.00 0.88 I I p.G1961E; p.P1380L 623 543 4.2 4.0 7 F 42 5 0.30 CF - I p.E1252* 557 2.1 8 M 15 4 0.80 0.80 II II p.L2027F; p.R2077W 728 697 3.2 3.2 9 F 24 2 0.60 0.40 II II p.R1161S 571 647 3.8 3.5 10 M 46 15 1.30 1.30 I I p.G1961E; p.Q636H 394 351 2.3 2.4 11.1 M 12 2 1.00 1.00 II - p.
X
ABCA4 p.Pro1380Leu 24677105:80:127
status: NEW
Login to comment

82 [L541P; A1038V]; p.R1640W 850 4.4 12 F 27 9 1.30 1.00 - III p.P1380L; p.P1380L 577 4.8 13 F 39 8 0.12 0.00 - I c.250_251insCAAA 616 2.3 14 M 23 4 0.88 0.60 - II p.C54Y 535 5.1 15.1 M 49 17 1.00 0.88 I I p.Y1557C 646 604 4.1 3.9 15.2 M 46 7 0.10 0.48 I I p.Y1557C 456 508 2.6 2.3 16.1 F 27 14 0.88 0.88 III III p.L2027F; p.G851D 448 459 6.0 6.3 16.2 F 29 19 1.30 1.18 III III p.L2027F; p.G851D 538 569 7.4 7.9 17 M 22 18 1.30 1.00 III III p.P1380L; p.R2030Q 434 411 5.7 6.0 18 M 37 16 0.70 0.70 I I p.G1961E; p.G1961E 281 279 2.6 2.2 19 F 33 5 0.88 0.70 I I p.G1961E; c.4540-2A > G 412 420 2.5 2.8 20 F 26 12 0.60 0.60 - I p.G1961E; p.
X
ABCA4 p.Pro1380Leu 24677105:82:62
status: NEW
X
ABCA4 p.Pro1380Leu 24677105:82:72
status: NEW
X
ABCA4 p.Pro1380Leu 24677105:82:441
status: NEW
Login to comment

83 [L541P; A1038V] 398 2.4 21 F 45 31 0.88 0.88 I I p.R1640W 647 613 2.6 2.8 22 M 43 7 1.00 0.00 - III p.A1773V; p.G1591G 640 6.9 23 F 41 1 0.10 CF II II p.P1486L; p.A1598D 613 572 6.0 6.5 24 F 19 4 0.60 0.70 I - p.G1961E; p.P1380L 368 2.4 25 F 23 4 0.88 0.80 - I p.
X
ABCA4 p.Pro1380Leu 24677105:83:222
status: NEW
Login to comment

84 [A854T; A1038V]; p.C2150Y 512 2.3 26 F 52 1 0.70 0.48 I - p.R212C 722 2.0 27 F 52 13 1.00 1.00 - I p.A1038V; p.A848D 459 4.1 28 M 20 5 0.30 0.40 I - p.L2027F; p.R1108H 507 2.3 29 M 23 7 1.00 1.00 I I p.G1961E; p.R2030Q 334 347 2.4 2.0 30 M 44 26 0.70 0.70 - II p.P1380L; p.R1108H 453 4.7 31 F 30 22 1.00 1.30 - I p.G1961E; c.6005&#fe;1G > T 428 2.3 32 M 12 8 0.40 0.40 I - p.W821R; p.C2150Y 306 2.0 33 F 20 9 0.88 0.88 III III p.R602W; p.M1882I 650 655 2.6 2.5 34 F 47 4 0.40 0.40 I - p.G1961E; p.R1129C 400 2.5 35 F 19 3 0.70 0.48 II II p.
X
ABCA4 p.Pro1380Leu 24677105:84:263
status: NEW
Login to comment

135 Comparing each of the four most common mutations separately with healthy eyes, G1961E (P &#bc; 0.001); L541P/ A1038V (P < 0.001); L2027F (P < 0.001); and P1380L (P &#bc; 0.024) eyes had qAF8 that was significantly higher than in FIGURE 2.
X
ABCA4 p.Pro1380Leu 24677105:135:154
status: NEW
Login to comment

152 Genotype-Phenotype Relations (TF) When compared separately with healthy eyes, three of the four most common mutations, L541P/A1038V (P < 0.001); L2027F (P < 0.001); and P1380L (P &#bc; 0.001), had TF that was significantly higher than in healthy eyes, when corrected for age.
X
ABCA4 p.Pro1380Leu 24677105:152:169
status: NEW
Login to comment

155 When compared with all other patients who did not have that particular mutation, G851D (P < 0.001) and P1380L (P &#bc; 0.008) were associated with higher TF, while G1961E (P &#bc; 0.01) was associated with lower TF in this sample.
X
ABCA4 p.Pro1380Leu 24677105:155:103
status: NEW
Login to comment

180 The mutations were confirmed in six or more patients (G1961E, L541P/A1038V, L2027F, and P1380L) or in two to four patients (R1640W, Y1557C, G851D, and R2030Q).
X
ABCA4 p.Pro1380Leu 24677105:180:88
status: NEW
Login to comment

221 In our cohort, the mutations G851D and P1380L had high AF texture while G1961E was associated with lower AF texture.
X
ABCA4 p.Pro1380Leu 24677105:221:39
status: NEW
Login to comment

233 Additional missense mutations found to associate with elevated qAF8 compared with other mutations in our sample were L2027F and P1380L.
X
ABCA4 p.Pro1380Leu 24677105:233:128
status: NEW
Login to comment

234 The L2027F mutation causes an amino acid change in NBD-2 and confers reduced ATP binding.11,48 P1380L is also a severe mutation and is suggested to cause either impaired ATP binding11 or altered transport of ABCA4 protein across the outer segment membrane.46 When P1380L is carried in compound heterozygosity with R2077W, autosomal recessive cone-rod dystrophy results.49 When harbored as a homozygous mutation or as a compound heterozygous mutation with R2030Q or IVS40 &#fe; 5G>A, the mutation is associated with central atrophy and peripapillary disease, the latter being an uncommon phenotype.50 The missense mutation G1961E in exon 42 of the ABCA4 gene is the most common ABCA4 mutation.51 This sequence change results in a glycine to glutamate substitution within the NBD-2 of the protein.11,45 The G1961E allele always cosegregates with the disease in families.45,52 Nevertheless, the G1961E mutation in ABCA4 is perplexing since in an in vitro assay this mutation conferred a markedly aberrant decrease in all-trans-retinal stimulated ABCA4 ATPase activity,11 yet it is considered to be associated with mild disease.
X
ABCA4 p.Pro1380Leu 24677105:234:95
status: NEW
X
ABCA4 p.Pro1380Leu 24677105:234:264
status: NEW
Login to comment

PMID: 25139735 [PubMed] Lee W et al: "The external limiting membrane in early-onset Stargardt disease."
No. Sentence Comment
87 [L541P;A1038V] ND P4 13 Caucasian 20/80 (0.60) 20/50 (0.40) 2 1 Mid ND p.P1380L c.5714&#fe;5G>A P5 14 Caucasian 20/200 (1.00) 20/150 (0.88) 1 1 Late 0.5 p.P1380L c.5714&#fe;5G>A P6 13 Caucasian 20/40 (0.30) 20/50 (0.40) 2 1 Late ND p.
X
ABCA4 p.Pro1380Leu 25139735:87:73
status: NEW
X
ABCA4 p.Pro1380Leu 25139735:87:155
status: NEW
Login to comment

91 [L541P;A1038V] p.R1640W P15 16 Caucasian 20/200 (1.00) 20/200 (1.00) 2 n/a Mid-late 8 p.K346T p.T1117I P16 9 Caucasian 20/150 (0.88) 20/150 (0.88) 1 n/a 1 p.P1380L p.G1961E P17 18 Caucasian 20/40 (0.30) 20/150 (0.88) 1 1 Early 3 p.P1380L p.G1961E P18ߥ 18 Caucasian 20/150 (0.88) 20/150 (0.88) 2 1 Late 4 p.
X
ABCA4 p.Pro1380Leu 25139735:91:157
status: NEW
X
ABCA4 p.Pro1380Leu 25139735:91:231
status: NEW
Login to comment

PMID: 25283059 [PubMed] Duncker T et al: "Quantitative fundus autofluorescence distinguishes ABCA4-associated and non-ABCA4-associated bull's-eye maculopathy."
No. Sentence Comment
65 Sex Age (yrs) Race or Ethnicity Best-Corrected Visual Acuity (Logarithm of the Minimum Angle of Resolution Units) Genetic Data Average of Quantitative Fundus Autofluorescence Values of the 8 Segments ABCA4 Mutations Right Eye Left Eye Allele 1 Allele 2 Right Eye Left Eye 1 M 36 White 0.70 0.70 p.G1961E p.G1961E 282 279 2 F 46 White 0.40 0.40y p.G1961E p.R1129C 391 3 M 17 Asian Indian 0.70 0.88 p.G1961E c.6729&#fe;4_&#fe;18del 340 363 4 M 17 White 0.88 0.88 p.G1961E p.A1773V 340 366 5 M 21 White 0.88 0.88 p.G1961E p.W15* 341 325 6 F 22 White 0.70 0.48 p.G1961E p.G863A 361 351 7 F 20 White 0.70z 0.88z p.G1961E p.L541P 317 8 M 12 White 0.80 0.70 p.G1961E p.P1380L 251 242 9 F 21 White 0.88 0.88 p.G1961E p.R212C 407 439 10 F 26 White 0.40z 0.70z p.G1961E c.5196&#fe;1056A/G 379 344 11 F 24 White 0.88z 0.88z p.G1961E p.C2150R 405 396 12 F 24 White 0.30z 0.18z p.G1961E p.N96D 513 549 13 F 20 White 0.30 0.40 p.G1961E p.N96D 397 355 14 M 25 White 0.00y 0.30 p.G1961E p.Q1003* 322 328 15 M 8.2 White 0.88 0.88 p.
X
ABCA4 p.Pro1380Leu 25283059:65:662
status: NEW
Login to comment

PMID: 25301883 [PubMed] Noupuu K et al: "Structural and genetic assessment of the ABCA4-associated optical gap phenotype."
No. Sentence Comment
88 [4139C > T];[5882G > A] p.[(P1380L)];[(G1961E)] P11, M c.
X
ABCA4 p.Pro1380Leu 25301883:88:28
status: NEW
Login to comment

PMID: 25342616 [PubMed] Duncker T et al: "Correlations among near-infrared and short-wavelength autofluorescence and spectral-domain optical coherence tomography in recessive Stargardt disease."
No. Sentence Comment
88 [L541P;A1038V] 4 4 17.9 M Indian Brown 0.7 0.9 p.G1961E c.6729&#fe;4_&#fe;18del 3 5 12.1 M White Green 0.8 0.7 p.G1961E p.P1380L 3 6 46.4 M Black Brown 0.3 0.8 p.T1526M 2 7 42.6 F White Brown 1.3 1.3 p.G1961E p.
X
ABCA4 p.Pro1380Leu 25342616:88:122
status: NEW
Login to comment

91 [L541P;A1038V] 5 14 22.4 F White Brown 0.8 0.8 p.R212C 3 15 20.2 M White Brown 0.9 0.9 p.G1961E p.P1380L 1 16 27.6 M Arabic Brown 0.0 0.0 p.R1300* p.R2106C 3 17 26.8 M White Blue 0.5 0.5 p.G1961E c.3050&#fe;5G>A 1 18 24.9 F White Hazel 0.9 0.9 p.G1961E p.C2150R 5 19 13.2 M White Blue 0.9 1.0 p.W821R p.C2150Y 3 20 61.0 F White Green 2.0 0.0 c.250_251insCAAA 2 21 36.3 F White Blue 1.3 0.1 p.N1799D 1 22 14.1 F White Green 1.0 0.9 p.R1108C p.Q1412* 2 23 18.6 M White Brown 0.9 0.9 p.G1961E p.A1773V 3 24 53.3 F White Blue 0.3 (0.2) p.R2077W 2 BCVA values in parenthesis indicate fellow eyes that were not included in the study.
X
ABCA4 p.Pro1380Leu 25342616:91:98
status: NEW
Login to comment

PMID: 26024099 [PubMed] Duncker T et al: "Quantitative Fundus Autofluorescence and Optical Coherence Tomography in PRPH2/RDS- and ABCA4-Associated Disease Exhibiting Phenotypic Overlap."
No. Sentence Comment
63 [L541P;A1038V] NS n/a 443 24 F 20.2 White 0.88 0.88 p.G1961E p.P1380L NS 376 400 25 F 22.9 White 0.88 0.80 p.
X
ABCA4 p.Pro1380Leu 26024099:63:63
status: NEW
Login to comment

65 [L541P;R1443H] NS 479 487 32 F 23 White 0.30 0.18 p.G1961E p.P1380L NF 412 444 33 M 28.4 White 0.70 0.48 NF NF NF 388 n/a 34ߥ M 61.5 White 1.30 0.60 NF NF E191Xjj 490 459 35ߥ M 30.6 White 0.00 0.00 NF NF E191Xjj 345 324 36 M 51.5 White 0.30 0.54 NF NF NF 515 497 37 M 53.2 White 0.60 0.60 NF NF NF 212 239 38 F 35.3 White 0.88 0.10 p.N1799D NF NF n/a 387 39 F 55 White 0.00 0.00 p.R2077W NF NF 541 586 BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available; NF, not found.
X
ABCA4 p.Pro1380Leu 26024099:65:61
status: NEW
Login to comment

PMID: 26024107 [PubMed] Greenstein VC et al: "Near-infrared autofluorescence: its relationship to short-wavelength autofluorescence and optical coherence tomography in recessive stargardt disease."
No. Sentence Comment
74 Selected Demographic, Clinical, and Genetic Characteristics of the Study Cohort Patient Sex Disease-Associated ABCA4 Variant(s) Age Eye BCVA 1 F p.G1961E; c2382&#fe;1G>A 36 OS 0.8 2 M p.[L541P;A1038V] 8 OS 0.6 3 M p.G1961E; c.6729&#fe;5_&#fe;19del 18 OS 0.9 4 M p.P1380L; p.G1961E 12 OD 0.8 5 M c.571-1G>T 43 OD 0.4 6 M p.Q1003*; p.G1961E 25 OS 0 7 M p.[L541P;A1038V]; p.L2027F 8 OD N/A 8 F p.R212C; p.G1961E 22 OD 0.8 9 F p.P1380L; p.G1961E 20 OD 0.9 10 M p.R1300*; p.R2106C 26 OS 0 11 M c.3050&#fe;5G>A; p.G1961E 27 OD 0.5 12 F p.G1961E; p.C2150R 25 OD 0.7 13 M p.W821R; p.C2150Y 13 OD 0.4 14 F p.N1799D 36 OD 1.3 15 M p.A1773V; p.G1961E 19 OD 0.7 FIGURE 1.
X
ABCA4 p.Pro1380Leu 26024107:74:264
status: NEW
X
ABCA4 p.Pro1380Leu 26024107:74:425
status: NEW
Login to comment

PMID: 26230768 [PubMed] Sparrow JR et al: "Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography."
No. Sentence Comment
48 [IVS15&#fe;1G>A 2 M 12.00 Caucasian 0.5 0.5 p. [L541P; A1038V] 3* M 9.00 Caucasian 1 1 p. [W855*]; [T1526M] 4 F 47.55 Caucasian 1.3 1.3 p. [L541P; A1038V]; [G1961E] 5* F 16.47 Caucasian 0.6 0.6 p. [T972N]; [L2027F] 6* M 16.98 Caucasian 1.3 1.3 p. [K346T]; [T1117I] 7 F 23.80 Caucasian 0.6 0.4 p. [R1161S] 8* F 28.67 Caucasian 1.3 1.3 p. [P1380L]; [P1380L] 9 M 42.83 Caucasian 0.9 0.4 c.
X
ABCA4 p.Pro1380Leu 26230768:48:338
status: NEW
X
ABCA4 p.Pro1380Leu 26230768:48:348
status: NEW
Login to comment

49 [571-1G>T 10* M 13.89 Caucasian 0.4 0.4 p. [L541P; A1038V]; [L2027F] 11* F 20.20 Caucasian 0.9 0.9 p. [P1380L]; [G1961E] 12 M 27.61 African-Arab 0 0 p. [R1300*]; [R2106C] 13* M 46.93 Caucasian 0.3 0.4 p. [C1490Y]; [G1961E] 14* M 26.82 Caucasian 0 0 c.
X
ABCA4 p.Pro1380Leu 26230768:49:103
status: NEW
Login to comment

PMID: 26377081 [PubMed] Cideciyan AV et al: "Predicting Progression of ABCA4-Associated Retinal Degenerations Based on Longitudinal Measurements of the Leading Disease Front."
No. Sentence Comment
153 example, among the 14 patients compound heterozygous for the common G1961E allele (Supplementary Table S1), the model would predict foveal disease in the first decade of life for three alleles (P68L;G1961E, L541P;A1038V, and T1019M), second decade of life for four alleles (R1129L, C54Y, R152Stop, and V256V) and fourth decade of life for four alleles (P1380L, R1640Q, c.5312&#fe;1 G>A, and M669fs).
X
ABCA4 p.Pro1380Leu 26377081:153:353
status: NEW
Login to comment

PMID: 26551331 [PubMed] Duncker T et al: "Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers."
No. Sentence Comment
28 [L541P;A1038V] 0.10 0.10 OS n/a 141 S2.2 F 44.4 Indian Mother c.6729&#fe;5_&#fe;19del 0.10 0.00 OS 257 291 S2.3 M 56.2 Indian Father p.G1961E 0.00 0.00 OD 475 431 S3.4 F 54.1 White Mother p.G863A 0.00 0.00 OS 459 451 S3.5 F 82.0 White Grandmother p.G863A 0.00 0.00 OD n/a n/a S4.2 F 44.6 White Mother p.W855* 0.00 0.00 OD 330 n/a S4.3 M 40.9 White Father p.T1526M 0.00 0.00 OS 283 271 S5.2 F 71.5 White Sister p.C698Y 0.00 0.10 OD n/a n/a S5.3 F 67.5 White Sister c.2160&#fe;1G>C 0.00 0.00 OS n/a n/a S5.4 F 62.9 White Sister p.C698Y 0.00 0.00 OD n/a n/a S6.2 M 54.9 Black Brother p.T1526M 0.10 0.00 OS 477 423 S7.2 F 48.9 White Mother c.5196&#fe;1G>A 0.00 0.00 OS 443 415 S8.2 F 59.6 White Mother p.K346T 0.00 0.00 OD 546 483 S8.3 M 54.6 White Father p.T1117I 0.10 0.10 OD 289 n/a S9.2 F 51.5 White Mother c.5196&#fe;1137G>A 0.00 0.00 n/a 302 n/a S9.3 M 57.8 White Father p.C54Y 0.00 0.00 OS 419 375 S10.2 M 24.1 Indian Brother p.Q2220* 0.00 0.00 OD 227 227 S11.2 F 40.0 Asian Mother c.5923del 0.00 0.18 OD 229 191 S11.3 M 40.1 Asian Father p.R408* 0.00 0.00 OD 195 178 S12.2 F 53.2 White Mother p.L2027F 0.00 0.00 n/a 355 309 S13.2 F 49.8 White Mother p.R1161S 0.00 0.00 OS 367 372 S13.3 M 22.3 White Brother p.R1161S 0.00 0.00 OD 202 206 S14.2 F 67.0 White Mother p.P1380L 0.00 0.00 OD n/a n/a S14.3 F 24.4 White Sister p.P1380L 0.00 0.00 OS n/a 163 S15.3 F 26.8 White Sister c.3050&#fe;5G>A 0.00 0.00 n/a 293 281 S16.2 M 53.7 Black Father c.4253&#fe;5G>T 0.00 0.00 n/a n/a 204 S17.2 F 60.0 Hispanic Mother p.A1038V 0.00 0.00 n/a 247 n/a S18.2 F 41.8 Indian Father c.5917del 0.00 0.00 OD n/a 194 S18.3 M 48.6 Indian Mother c.859-9T>C 0.00 0.00 OD 253 215 S18.4 F 12.9 Indian Sister c.5917del 0.00 0.00 OD 84 93 S19.4 F 58.5 White Mother p.L2027F 0.00 0.00 OD 205 n/a S19.5 M 61.6 White Father p.G851D 0.10 0.10 OD n/a n/a S20.2 F 41.5 White Mother c.5312&#fe;1G>A 0.00 0.00 n/a 335 351 S20.3 M 39.0 White Father p.R2030* 0.00 0.10 n/a 442 n/a S21.3 F 53.1 White Mother p.G1961E 0.00 0.00 OD 490 488 S22.3 M 46.3 White Father p.L2027F 0.00 0.00 OS 386 376 S22.4 F 47.1 White Mother p.
X
ABCA4 p.Pro1380Leu 26551331:28:1269
status: NEW
X
ABCA4 p.Pro1380Leu 26551331:28:1325
status: NEW
Login to comment

31 [L541P;A1038V] 0.10 0.00 OS 174 143 S27.2 F 46.2 White Mother p.P1380L 0.00 0.10 OD 379 320 S27.3 M 47.3 White Father p.G1961E 0.00 0.00 OD 413 384 S27.4 F 17.4 White Sister p.P1380L 0.00 0.00 OS 184 189 S28.2 F 58.9 White Mother p.
X
ABCA4 p.Pro1380Leu 26551331:31:64
status: NEW
X
ABCA4 p.Pro1380Leu 26551331:31:176
status: NEW
Login to comment

68 [66G>A;859-9T>C] p.Q2220* CF 1.30 n/a n/a P 11.1 M 15.0 Asian p.R408* c.5935del 1.10 1.30 n/a n/a P 12.1&#a7; M 15.1 White p.L2027F p.R2077W 0.80 0.80 728 697 P 13.1&#a7; F 23.8 White p.R1161S 0.60 0.40 571 647 P 14.1&#a7; F 27.3 White p.P1380L p.P1380L 1.30 1.00 n/a 577 P 15.1 M 17.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 15.2 F 22.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 16.1 F 19.1 Black p.V989A c.4253&#fe;5G>T 0.30 0.40 97 n/a P 17.1 F 21.8 Hispanic p.A1038V p.G1441D 0.70 0.88 551 528 P 18.1 M 22.0 Indian c.859-9T>C c.5917del 0.88 0.88 527 n/a P 19.1&#a7; F 27.2 White p.G851D p.L2027F 0.88 0.88 448 459 P 19.2&#a7; F 29.2 White p.G851D p.L2027F 1.30 1.18 538 569 P 19.3 F 34.2 White p.G851D p.L2027F 1.00 1.30 442 n/a P 20.1 F 9.5 White c.5312&#fe;1G>A p.R2030* 0.88 0.70 998 929 P 21.1ߤ F 24.6 White p.N96D p.G1961E 0.30 0.18 513 549 P 21.2ߤ F 20.9 White p.N96D p.G1961E 0.30 0.40 397 355 P 22.1 M 8.0 White p.
X
ABCA4 p.Pro1380Leu 26551331:68:238
status: NEW
X
ABCA4 p.Pro1380Leu 26551331:68:247
status: NEW
Login to comment

72 [L541P;A1038V] p.G1961E 0.60 0.54 320 307 P 27.1&#a7; F 18.8 White p.P1380L p.G1961E 0.60 0.70 368 n/a P 28.1&#a7; F 22.9 White p.
X
ABCA4 p.Pro1380Leu 26551331:72:69
status: NEW
Login to comment

75 [W1408R;R1640W] 1.00 1.00 n/a n/a P 33.1&#a7; M 23.0 White p.R2030Q p.G1961E 1.00 1.00 334 347 P 34.1 M 46.9 White p.C1490Y p.G1961E 0.40 0.30 376 384 P 35.1ߥ M 24.8 White c.3050&#fe;5G>A p.G1961E 0.00 0.00 381 451 P 36.1ߥ F 29.3 Hispanic p.L541P p.G1961E 0.40 0.40 479 487 P 37.1ߤ F 24.7 White p.G1961E p.C2150R 0.88 0.88 405 396 P 38.1&#a7; M 11.7 White p.W821R p.C2150Y 0.40 0.40 306 n/a P 39.1 F 12.8 White p.P1380L c.5714&#fe;5G>A 0.60 0.40 558 573 P 39.2 M 14.1 White p.P1380L c.5714&#fe;5G>A 0.88 0.88 395 462 P 40.1ߤ F 16.2 White p.K1547* p.R2030Q 0.70 0.40 481 513 P 41.1 F 19.0 White p.C54Y 0.88 0.88 n/a n/a P 42.1ߤ F 13.0 White p.R1108C p.Q1412* 1.30 1.00 511 528 P 43.1ߤ M 17.4 White p.A1773V p.G1961E 0.88 0.88 340 366 P 44.1 M 14.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 44.2 F 7.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 45.1 F 42.4 White p.N965Y p.P1486L 0.10 0.40 n/a n/a BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available.
X
ABCA4 p.Pro1380Leu 26551331:75:431
status: NEW
X
ABCA4 p.Pro1380Leu 26551331:75:494
status: NEW
Login to comment

111 [L541P; A1038V] in six carriers, p.P1380L in four carriers, and p.L2027F in three carriers.
X
ABCA4 p.Pro1380Leu 26551331:111:35
status: NEW
Login to comment

123 Quantitative autofluorescence intensities associated with 4 common ABCA4 mutations: p.G1961E, p.P1380L, p.
X
ABCA4 p.Pro1380Leu 26551331:123:96
status: NEW
Login to comment

137 [L541P; A1038V], p.P1380L, and p.L2027F mutations (and no p.G1961E mutation on the other allele).24 To determine whether similar differences in the segregation of qAF8 levels could also be observed for ABCA4 mutations in carriers and whether specific ABCA4 mutations may be associated with higher qAF8 levels, we plotted qAF values for carriers and affected patients who carried one of the four most common mutations (p.G1961E, p.
X
ABCA4 p.Pro1380Leu 26551331:137:19
status: NEW
Login to comment

138 [L541P;A1038V], p.P1380L, and p.L2027F) (Fig. 4).
X
ABCA4 p.Pro1380Leu 26551331:138:18
status: NEW
Login to comment

145 Color-coded maps of quantitative fundus autofluorescence and inheritance patterns of families carrying ABCA4 mutations p.P1380L (family 39) p.G1961E; p.
X
ABCA4 p.Pro1380Leu 26551331:145:121
status: NEW
Login to comment

147 [L541P; A1038V] (family 1), and p.G1961E; p.P1380L (family 27).
X
ABCA4 p.Pro1380Leu 26551331:147:44
status: NEW
Login to comment

163 [L541P; A1038V], p.P1380L, and p.L2027F, are indicated in color.
X
ABCA4 p.Pro1380Leu 26551331:163:19
status: NEW
Login to comment

169 Nevertheless, we concluded that based on qAF values (measured at an eccentricity of 78-98), the mutations p.L2027F and p.P1380L and the complex allele p.
X
ABCA4 p.Pro1380Leu 26551331:169:121
status: NEW
Login to comment

196 Thickness profiles acquired by segmentation of spectral-domain optical coherence tomography (SD-OCT) images of carriers of ABCA4 mutations p.G1961E, p.L541P/A1038V, p.P1380L, and p.L2027F.
X
ABCA4 p.Pro1380Leu 26551331:196:167
status: NEW
Login to comment