ABCC4 p.Lys304Asn

[switch to full view]
Comments [show]
Publications
PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."
No. Sentence Comment
191 MRP4 protein has been detected in human kidney (van Aubel et al., 2002), lung (Torky et al., 2005), liver (Rius et al., 2003), prostate (Lee et al., 2000), brain (Nies et al., 2004), pancreas (König et al., 2005), lymphocytes (Schuetz et al., 1999), and platelets Figure 4 Predicted membrance topology of MRP4 (ABCC4) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 4 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD Val854Phe Ile18Leu Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304Asn in out Membrane Cys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val MRP4 (ABCC4) COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val (Jedlitschky et al., 2004).
X
ABCC4 p.Lys304Asn 18464048:191:615
status: NEW
Login to comment

236 Following the discovery and Table 4 MRP4 (ABCC4) Single nucleotide polymorphisms. Location, allele frequency and functional effects. Position in coding sequence Amino acid exchange Location Allele frequency Effect NCBI ID ReferenceAf Ca Jp others 52A>C Ile18Leu Exon 1 - 1.1 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568681 511T>G Cys171Gly Exon 4 - 0 [1] [2] - - rs4148460 559G>T Gly187Trp Exon 5 - 2.2 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568658 912G>T Lys304Asn Exon 8 - 9.9 [1] [2] - No influence on expression and localization in liver [1] rs2274407 1208T>C Pro403Leu Exon 9 - - - - - rs11568705 1492A>G Lys498Glu Exon 11 - - - - - rs11568669 1592G>A Arg531Gln Exon 12 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 1667A>G Tyr556Cys Exon 13 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2230A>G Met744Val Exon 18 - - - - - rs9282570 2269G>A Glu757Lys Exon 18 - 0.6 [1] [2] - No influence on expression and localization in liver [1] rs3765534 2326G>A Val776Ile Exon 19 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2560G>T Val854Phe Exon 21 - 1.7 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568694 2596A>G Ile866Val Exon 21 - 2.8 [1] 0 [2] - No influence on expression and localization in liver [1] 3425C>T Thr1142Met Exon 27 - 1.6 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568644 3814A>G Met1272Val Exon 30 - - - - - rs1134217 Reference without frequency means that SNP was detected but no frequency determined.
X
ABCC4 p.Lys304Asn 18464048:236:522
status: NEW
Login to comment

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."
No. Sentence Comment
117 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Liver efflux transporters (cont.) SLC47A1 (cont.) MATE1 (cont.) c.1490G>C c.149G>T p.C497S p.C497F N/A Reduced, unchanged or increased transport activities (substrate dependent) [170,229] c.1557G>C p.Q519H N/A Unchanged [170] ABCC4 MRP4 c.232C>G p.P78A N/A Increased intracellular drug accumulation (substrate dependent), lower transport protein expression [161] c.559C>T p.G187W N/A Increased intracellular drug accumulation, reduced transport protein expression Slightly reduced function [161] [162] c.877A>G p.K293E N/A Unchanged [161] c.912G>T p.K304N N/A Unchanged Unchanged [161] [162] c.1208C>T p.P403L N/A Increased intracellular drug accumulation [161] c.1460G>A p.G487E N/A Increased intracellular drug accumulation Reduced transport activity (substrate dependent) [161] [162] c.1492A>G p.K498E N/A Unaltered [161] c.1667A>G p.Y556C N/A Increased transport activity [162] c.2269G>A p.E575K N/A Increased transport activity [162] c.2230A>G p.M744V N/A Unchanged [161] c.2326G>A p.V776I N/A Reduced transport activity [162] c.2459G>T p.R820I N/A Reduced transport activity [162] c.2560G>T p.V854F N/A Unchanged [162] c.2596A>G p.I866V N/A Unchanged [162] c.2867G>C p.C956S N/A Reduced intracellular drug accumulation [161] c.3211G>A p.V1071I N/A Unchanged [161] c.3425C>T p.T1142M N/A Increased transport activity [162] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302].
X
ABCC4 p.Lys304Asn 21619426:117:627
status: NEW
Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined.
X
ABCC4 p.Lys304Asn 20103563:7118:1420
status: NEW
Login to comment

7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined.
X
ABCC4 p.Lys304Asn 20103563:7115:1399
status: NEW
Login to comment

PMID: 22955427 [PubMed] Nishijima T et al: "Single Nucleotide Polymorphisms in ABCC2 Associate With Tenofovir-Induced Kidney Tubular Dysfunction in Japanese Patients With HIV-1 Infection: A Pharmacogenetic Study."
No. Sentence Comment
60 The 14 SNPs selected were (1) ABCC2 (encodes MRP2) -24C → T (in the promoter; rs717620); 1249G → A (Val417Ile; rs2273697); 2366C → T (Ser789Phe; rs56220353); 2934G → A (Ser978Ser; rs3740070), (2) ABCC4 (encodes MRP4) 559G → T (Gly187Trp; rs11568658); 912G ș2; T (Lys304Asn; rs2274407); 2269G → A (Glu757Lys; rs3765534); 3348A → G (Lys1116Lys; rs1751034); 4135T → G [in the 3' untranslated region (UTR); (rs3742106)]; 4976T → C (3' UTR; rs1059751), (3) ABCC10 (encodes MRP10) 526G → A (intron; rs9349256); 2759T → C (Ile920Thr; rs2125739), (4) SLC22A6 (encodes OAT1) 180C → T (Asn60Asn; rs11568630), and (5) ABCB1 (encodes P-glycoprotein) 2677T → A/G (A:Ser893Thr, G:Ser893Ala; rs2032582).
X
ABCC4 p.Lys304Asn 22955427:60:297
status: NEW
Login to comment

PMID: 17083032 [PubMed] Izzedine H et al: "Association between ABCC2 gene haplotypes and tenofovir-induced proximal tubulopathy."
No. Sentence Comment
81 (%) P Group 1 (n p 13) Group 2 (n p 17) Exon 6, 669 CrT (rs899494) Ile223Ile Genotype .04 CC 6 (46) 14 (82) CT 7 (54) 3 (18) TT 0 0 Allele C 19 (73.1) 31 (91.2) T 7 (26.9) 3 (8.8) Exon 8, 912 GrT (rs2274407) Lys304Asn Genotype .43 GG 12 (92) 17 (100) GT 1 (8) 0 TT 0 0 Allele G 25 (96.2) 34 (100) T 1 (3.8) 0 Exon 8, 951 GrA (rs2274406) Arg317Arg Genotype .31 GG 4 (31) 6 (33) GA 6 (46) 6 (33) AA 3 (23) 5 (33) Allele G 14 (53.9) 18 (53.0) A 12 (46.1) 16 (47.0) Exon 8, 969 GrA (rs2274405) Ser323Ser Genotype .93 GG 5 (38) 7 (40) GA 5 (38) 6 (33) AA 3 (24) 4 (27) Allele G 15 (57.7) 20 (58.8) A 11 (42.3) 14 (41.2) Exon 11, 1497 CrT (rs1557070) Tyr499Tyr Genotype .43 CC 12 (92) 17 (100) CT 1 (8) 0 TT 0 0 Allele C 25 (96.2) 34 (100) T 1 (3.8) 0 Exon 26, 3310 TrC (rs11568655) Leu1104Leu Genotype .43 TT 12 (92) 17 (100) TC 1 (8) 0 CC 0 0 Allele T 25 (96.2) 34 (100) C 1 (3.8) 0 Exon 26, 3348 ArG (rs1751034) Lys1116Lys Genotype .44 AA 8 (61) 8 (47) AG 3 (23) 7 (41) GG 2 (15) 2 (12) Allele A 19 (73.1) 23 (67.7) G 7 (26.9) 11 (32.3) (continued) Table 2.
X
ABCC4 p.Lys304Asn 17083032:81:208
status: NEW
Login to comment

PMID: 21792076 [PubMed] Pankratz VS et al: "Systematic evaluation of genetic variants in three biological pathways on patient survival in low-stage non-small cell lung cancer."
No. Sentence Comment
130 Evidence shows that ABCC4 has very important roles in the pharmacogenetics of cancer33; for example, in childhood acute lymphoblastic leukemia (T-1393C and A934C [Lys304Asn] polymorphisms)34 and with cyclophosphamide-induced adverse drug reactions in patients with breast cancer (rs9561778).35 Among the 63 tag-SNPs analyzed from ABCC4 in our study, rs1729786 was found to be significantly associated with OS of LS-NSCLC; similar to rs3768490, rs1729786 is intronic, and its functional significance needs to be further elucidated.
X
ABCC4 p.Lys304Asn 21792076:130:163
status: NEW
Login to comment

PMID: 19515727 [PubMed] Ansari M et al: "Polymorphisms in multidrug resistance-associated protein gene 4 is associated with outcome in childhood acute lymphoblastic leukemia."
No. Sentence Comment
6 The CA genotype of A934C (Lys304Asn) substitution correlated in contrast with lower event-free survival (P ‫؍‬ .02) and higher frequency of high-grade thrombocytopenia (P ‫؍‬ .01).
X
ABCC4 p.Lys304Asn 19515727:6:26
status: NEW
Login to comment

33 In this study, theAallele of C934A(Lys304Asn) correlated with reduced EFS and higher incidence of high-grade thrombocytopenia.
X
ABCC4 p.Lys304Asn 19515727:33:35
status: NEW
Login to comment

4 The CA genotype of A934C (Lys304Asn) substitution correlated in contrast with lower event-free survival (P d1d; .02) and higher frequency of high-grade thrombocytopenia (P d1d; .01).
X
ABCC4 p.Lys304Asn 19515727:4:26
status: NEW
Login to comment

31 In this study, theAallele of C934A(Lys304Asn) correlated with reduced EFS and higher incidence of high-grade thrombocytopenia.
X
ABCC4 p.Lys304Asn 19515727:31:35
status: NEW
Login to comment

PMID: 18364470 [PubMed] Abla N et al: "The human multidrug resistance protein 4 (MRP4, ABCC4): functional analysis of a highly polymorphic gene."
No. Sentence Comment
100 Only three nonsynonymous variants (G187W, K304N, and M744V) have frequencies higher than 5% in a given ethnic group.
X
ABCC4 p.Lys304Asn 18364470:100:42
status: NEW
Login to comment

110 Initially, ABCC4 haplotypes were inferred from all variable sites with a frequency higher than TABLE 1 Primers used for constructing the variants and the nonfunctional mutant by site-directed mutagenesis Variant Sequencea (5Ј-3Ј) P78A F: GAATGACGCACAGAAGGCTTCTTTAACAAGAGC R: GCTCTTGTTAAAGAAGCCTTCTGTGCGTCATTC G187W F: GTAACATGGCCATGTGGAAGACAACCACAG R: CTGTGGTTGTCTTCCACATGGCCATGTTAC K293E F: GTACGCCTGGGAAGAGTCATTTTCAAATC R: GATTTGAAAATGACTCTTCCCAGGCGTAC K304N F: CCAATTTGAGAAATAAGGAGATTTCCAAG R: CTTGGAAATCTCCTTATTTCTCAAATTGG P403L F: GCGCAACCGTCAGCTGCTGTCAGATGGTAAAAAG R: CTTTTTACCATCTGACAGCAGCTGACGGTTGCGC G487E F: CCCTGGGTGTTCTCGGAAACTCTGAGGAG R: CTCCTCAGAGTTTCCGAGAACACCCAGGG K498E F: GTAATATTTTATTTGGGAAGGAATACGAAAAGG R: CCTTTTCGTATTCCTTCCCAAATAAAATATTAC M744V F: GGGCAAACAAACAAAGTGTGCTAAATGTCACTG R: CAGTGACATTTAGCACACTTTGTTTGTTTGCCC C956S F: CGTCTGGATGCCATCTCTGCCATGTTTGTCATC R: GATGACAAACATGGCAGAGATGGCATCCAGACG V1071I F: CACAAGAAAAGATTGGCATTGTGGGAAG R: CTTCCCACAATGCCAATCTTTTCTTGTG G538D F: GGAACCACGCTGAGTGGAGACCAGAAAGCACGGGTAAACC R: GGTTTACCCGTGCTTTCTGGTCTCCACTCAGCGTGGTTCC F, forward; R, reverse.
X
ABCC4 p.Lys304Asn 18364470:110:467
status: NEW
Login to comment

126 Ten nonsynonymous variants were chosen for this study based on a frequency of Ն5% in the populations studied (G187W, K304N, and M744V), high evolutionary conservation (all variants with the exception of M744V), or a high Grantham value (G187W Ͼ C956S Ͼ P403L ϭ G487E Ͼ K304N).
X
ABCC4 p.Lys304Asn 18364470:126:123
status: NEW
X
ABCC4 p.Lys304Asn 18364470:126:299
status: NEW
Login to comment

128 Variants referred to as "evolutionarily conserved" show a complete conservation across the seven species, with the exception of an arginine to lysine change for variant K304N in two species.
X
ABCC4 p.Lys304Asn 18364470:128:169
status: NEW
Login to comment

145 The P78A and P403L TABLE 2 Selected genetic variants in ABCC4a Exon Nucleotide Position Golden Path Positionb Variant Flagb Nucleotide Change Amino Acid or Intronic Position Amino Acid Change Grantham Score Allele Frequencyc AA (n ϭ 160) CA (n ϭ 160) AS (n ϭ 120) ME (n ϭ 100) 1 -49 chr13:94751618 rs3751333 C Ͼ T 5Ј-UTR - - 0.013 0.019 0.102 0.03 1 52 chr13:94751518 rs11568681 C Ͼ A 18 Leu to Ile 5 0.006 0.044 0.034 0.01 1 IVS1ϩ10 chr13:94751486 rs11568682 C Ͼ T Intronic - - 0.006 0.019 0 0 2 IVS2ϩ7 chr13:94697891 rs11568700 C Ͼ T Intronic - - 0.031 0 0 0 3 IVS3-5 chr13:94697355 rs4148437 T Ͼ C Intronic - - 0.087 0.331 0.183 0.25 3d 232 chr13:94697304 rs11568689 C Ͼ G 78 Pro to Ala 27 0 0 0.008 0 4 IVS4-10 chr13:94685099 rs11568638 C Ͼ T Intronic - - 0.025 0 0 0 4 IVS4ϩ10 chr13:94684855 rs11568637 A Ͼ G Intronic - - 0.031 0 0.117 0 5 551 chr13:94661017 rs11568657 T Ͼ C 184 Met to Thr 81 0.013 0 0 0 5 559 chr13:94661009 rs11568658 G Ͼ T 187 Gly to Trp 184 0 0.025 0.108 0.130 6 669 chr13:94659805 rs899494 C Ͼ T 223 Syn 0.219 0.200 0.125 0.090 6 717 chr13:94659757 rs11568674 T Ͼ C 239 Syn 0 0 0.008 0 7 877 chr13:94658089 rs11568684 A Ͼ G 293 Lys to Glu 56 0.006 0 0 0 8 912 chr13:94657036 rs2274407 G Ͼ T 304 Lys to Asn 94 0.181 0.087 0.225 0.160 8 951 chr13:94656997 rs2274406 G Ͼ A 317 Syn 0.619 0.406 0.458 0.390 8 969 chr13:94656979 rs2274405 G Ͼ A 323 Syn 0.312 0.406 0.458 0.320 8 1035 chr13:94656913 rs11568703 G Ͼ A 345 Syn 0 0.013 0 0 8 1067 chr13:94656881 rs11568701 C Ͼ T 356 Thr to Met 81 0 0 0 0.010 8 IVS8ϩ8 chr13:94656779 rs11568702 T Ͼ A Intronic - 0 0.013 0 0 9 1208 chr13:94645146 rs11568705 C Ͼ T 403 Pro to Leu 98 0.006 0 0 0 11 1458 chr13:94637043 rs11568670 G Ͼ A 486 Syn 0 0.006 0 0 11 1460 chr13:94637041 rs11568668 G Ͼ A 487 Gly to Glu 98 0 0 0.008 0 11 1492 chr13:94637009 rs11568669 A Ͼ G 498 Lys to Glu 56 0.025 0 0 0 11 1497 chr13:94637004 rs1557070 C Ͼ T 499 Syn 0.238 0 0 0 14 1737 chr13:94620874 rs11568664 T Ͼ C 579 Syn 0.006 0 0 0 15 IVS15-7 chr13:94616629 rs11568696 A Ͼ G Intronic - 0.031 0 0 0 15 1875 chr13:94616572 rs11568699 A Ͼ G 625 Ile to Met 10 0.006 0 0 0 15 2000 chr13:94616447 rs11568697 C Ͼ T 667 Pro to Leu 98 0 0.006 0 0 15 2001 chr13:94616446 rs11568698 C Ͼ T 667 Syn 0.013 0 0 0 16 2100 chr13:94614708 rs11568666 C Ͼ T 700 Syn 0 0.013 0 0 18 2230 chr13:94613455 rs9282570 A Ͼ G 744 Met to Val 21 0.050 0 0 0 18 2269 chr13:94613416 rs3765534 G Ͼ A 757 Glu to Lys 56 0.025 0.013 0.033 0.030 19 2364 chr13:94611535 rs11568709 C Ͼ T 788 Syn 0.006 0 0 0 20 2459 chr13:94566253 rs11568659 G Ͼ T 820 Arg to Ile 97 0.006 0 0 0 21 2560 chr13:94533521 rs11568694 G Ͼ T 854 Val to Phe 50 0.006 0 0 0 21 2577 chr13:94533504 rs11568691 C Ͼ T 859 Syn 0 0.006 0 0 22 2698 chr13:94525795 rs11568673 G Ͼ T 900 Val to Leu 32 0 0.006 0 0.010 22 2712 chr13:94525781 rs1678339 G Ͼ A 904 Syn 0.156 0.031 0.217 0.020 23 2844 chr13:94524542 rs1189466 C Ͼ T 948 Syn 0.075 0.031 0.208 0.020 23 2847 chr13:94524539 rs11568708 C Ͼ T 949 Syn 0.019 0 0 0 23 2867 chr13:94524519 rs11568707 G Ͼ C 956 Cys to Ser 112 0.006 0 0 0 26 3211 chr13:94513114 rs11568653 G Ͼ A 1071 Val to Ile 29 0.006 0 0 0 26 3255 chr13:94513070 rs11568652 C Ͼ A 1085 Syn 0.013 0 0 0.010 26 3310 chr13:94513015 rs11568655 T Ͼ C 1104 Syn 0.100 0 0 0.010 26 3348 chr13:94512977 rs1751034 A Ͼ G 1116 Syn 0.231 0.169 0.242 0.200 27 3425 chr13:94503381 rs11568644 C Ͼ T 1142 Thr to Met 81 0 0.006 0 0 28 3609 chr13:94494541 rs11568695 G Ͼ A 1203 Syn 0.206 0 0 0.010 29 3659 chr13:94494013 rs11568639 G Ͼ A 1220 Arg to Gln 43 0.006 0 0 0 29 3723 chr13:94493949 rs11568640 C Ͼ T 1241 Syn 0.006 0 0 0 30 3774 chr13:94484956 rs11568704 G Ͼ A 1258 Syn 0.037 0 0 0 31 IVS31-3 chr13:94471940 rs9524765 C Ͼ T Intronic - 0.225 0 0 0.02 31 3941 chr13:94471867 rs11568688 A Ͼ G 1314 Gln to Arg 43 0.006 0 0 0 31 4016 chr13:94471792 rs3742106 T Ͼ G 3Ј-UTR - 0.287 0.388 0.467 0.470 Dashes indicate not relevant.
X
ABCC4 p.Lys304Asn 18364470:145:1351
status: NEW
X
ABCC4 p.Lys304Asn 18364470:145:1369
status: NEW
Login to comment

245 However, this estimator probably can not account completely for these data, because another variant with a high Grantham value (K304N) does not show any functional difference.
X
ABCC4 p.Lys304Asn 18364470:245:128
status: NEW
Login to comment

PMID: 18300232 [PubMed] Janke D et al: "6-mercaptopurine and 9-(2-phosphonyl-methoxyethyl) adenine (PMEA) transport altered by two missense mutations in the drug transporter gene ABCC4."
No. Sentence Comment
34 We also sequenced large regions of the MRP4 gene of these individuals and identified 74 genetic variations, among them 10 missense mutations (I18L, G187W, K304N, R531Q, Y556C, E757 K, V776I, V854F, I866 V, and T1142 M).
X
ABCC4 p.Lys304Asn 18300232:34:155
status: NEW
Login to comment

107 The following primer pairs were applied to amplify SNP-containing fragments by PCR: * rs11568658 (c.559G4T, Gly187Trp): 50 -Biotin-CCTCTTTT ATTTCAGGCACTTCG-30 , * 50 -TGCAGCTTACCTGATCAAACTTGT-30 (117 bp) * rs2274407 (c.912G4T, Lys304Asn): 50 -Biotin-ACGATGA TTTTGCTTGCACT-30 , * 50 - CGTGAGCCACTTTATCTGGT-30 (146 bp) * rs11568644 (c.3425C4T, Thr1142Met): 50 -GGGCACTTAG GAACCTGTTTTGT-30 , * 50 -Biotin-CTCTTGTAAGGCATTCCACAGTTC-30 (101 bp).
X
ABCC4 p.Lys304Asn 18300232:107:227
status: NEW
Login to comment

110 Procedures of Pyrosequencing were performed according to the manufacturer`s instructions using the PSQ 96 SNP Reagent Kit (Biotage AB) and following sequencing primers: rs11568658 (Gly187Trp): 50 -CCTGTGGTTGTCTTCC-30 and rs2274407 (Lys304Asn): 50 -CTGTACTCTCTTTCAG-30 for reverse assay, rs11568644 (Thr1142Met), 50 -TGGATCCCTTTAATGAGC-30 for forward assay.
X
ABCC4 p.Lys304Asn 18300232:110:232
status: NEW
Login to comment

190 Hepatic MRP4 Expression in Relation to MRP4 Protein Variants Genomic DNA samples corresponding to 285 liver samples of Caucasian origin were screened for three frequent Caucasian MRP4 mutations: c.559G4T (G187W), c.912G4T (K304N), and c.3425C4T (T1142 M) (Supplementary Table S1) [Gradhand et al., in press].
X
ABCC4 p.Lys304Asn 18300232:190:223
status: NEW
Login to comment

211 MRP4 protein expression in samples carrying nonsynonymous SNPs relative to the control group taken as 100% was as follows: G187W (69%, n 5 7, all heterozygous), K304N (101%, n 5 12, 11 heterozygous, one homozygous), and T1142 M (60%, n 5 4, all heterozygous).
X
ABCC4 p.Lys304Asn 18300232:211:161
status: NEW
Login to comment

247 With the exception of K304N, MRP4 nonsynonymous SNPs reported in our previous study [Gradhand et al., in press] have been found to be heterozygous in the DNA samples screened.
X
ABCC4 p.Lys304Asn 18300232:247:22
status: NEW
Login to comment

250 In this study, the more common variants G187W, K304N, and I866 V exhibited normal functional activity, consistent with the observation that common variants are less likely to exhibit altered function than are rare variants.
X
ABCC4 p.Lys304Asn 18300232:250:47
status: NEW
Login to comment

258 Conservation of the MRP4 Polymorphic AminoAcids Among Di¡erent ABCC Orthologs and Homologsà Protein Speciesa G187W K304N G487E Y556C E757K V776I R820I V854F I866V T1142M MRP4 Human G K G Y E V R V I T Mouse G K G Y E V R I V T Rat G K G Y G V R I L S MRP1 Human K Q D Y K ^ N C F S Mouse K Q D Y F A ^ V F S Rat K Q D Y ^ G N V V S MRP2 Human K K G Y S G R L V S Mouse R K G Y S G R L V S Rat K K G Y S G R L I S MRP3 Human R Q C F L G R L V S Rat R Q C F S G R I V S MRP5 Human ^ ^ A Y D L R V S T Mouse ^ ^ A Y D L R V S T Rat ^ ^ A Y D L R V S T MRP6 Human K G T Y G H S V V S Mouse K G T Y H G N G V T Rat K G T Y G N G V V T ÃAligned using ClustalW (www.ebi.ac.uk/clustalw).
X
ABCC4 p.Lys304Asn 18300232:258:125
status: NEW
Login to comment

264 In our human liver study we found no significant influence of three MRP4 missense mutations (G187W, K304N, and T1142 M) on its hepatic expression.
X
ABCC4 p.Lys304Asn 18300232:264:100
status: NEW
Login to comment

PMID: 17404579 [PubMed] Gradhand U et al: "Variability in human hepatic MRP4 expression: influence of cholestasis and genotype."
No. Sentence Comment
45 Table 2 Genetic variations identified in the MRP4 gene among 95 Caucasian individuals Variant ID Sequence context 50 Systematic name Sequence context 30 Genetic element Effect Frequency (%) Heterozygous Homozygous NCBI SNP ID HW HW 1 GAACTCCTGA g.-2174C4G GTCAGGTGAT Promoter 23.7 28.5 5.4 3.0 2 CACCTGCCTC g.-2152A4G GCCTCCCAGA Promoter 2.2 2.2 0.0 0.0 3 TGGGCTAAAG g.-2055C4A CATCCTCCTG Promoter 40.9 47.9 39.8 36.3 rs2389235 4 CTAAAGCCAT g.-2051C4T CTCCTGTCTC Promoter 38.7 45.1 46.2 43.0 rs1764419 5 ATTTTTAAAA g.-1980-1981insA CTTTTGGTAG Promoter 39.8 45.5 45.2 42.3 6 CACTATGCTG g.-1949G4C CTAGCCTGTG Promoter 1.1 1.1 0.0 0.0 7 CATCTATAAA g.-1508G4A TAAGGATAAC Promoter 12.6 11.8 0.0 0.4 rs868853 8 AAATTATCAG g.-1235T4C ATTTGAACTT Promoter 2.1 2.1 0.0 0.0 9 TACTTAAACT g.-1130G4A AGTTGGGAGG Promoter 42.4 46.3 15.2 13.3 rs2993579 10 CCATGGCACC g.-642G4C TCGTTTGGTC Promoter 41.9 46.7 41.9 39.6 rs869951,39 11 CGCGTCTCCT g.-289C4G CCGCCGCGTC Promoter 2.2 2.2 0.0 0.0 12 CCGCGGCCAC g.-49C4T GCCGCCTGAT 50 UTR/ Exon 1 1.1 1.1 0.0 0.0 rs3751333,39 13 TGCCCGTGTA g.15C4T CAGGAGGTGA Exon 1 synonymous 1.1 1.1 0.0 0.0 14 GGACGCGAAC g.52A4C TCTGCTCACG Exon 1 I18L 2.2 2.2 97.8 97.8 rs11568681 15 GGTGAGTGTC g.84C4T CCGCCCGAAA Intron 1 2.2 2.1 0.0 0.0 rs11568682 16 CACTCTCCCG g.138G4C GGCCGCGCCC Intron 1 1.1 1.0 0.0 0.0 17 ACCCATGGAG g.53498G4A TAGGAGTCTA Intron 1 46.7 47.4 15.2 14.9 rs9556466 18 TTTTTCCTCAT g.54215T4C GTAGGTTCTG Intron 2 46.7 47.0 14.4 14.3 rs4148437,39 19 AGCATGGGTG g.66387A4G CAGAGCAAGC Intron 3 11.9 11.2 0.0 0.4 39 20 GGTAAGTGAC g.66715A4G TTCAGCATTA Intron 4 2.2 2.2 0.0 0.0 rs11568637 21 CATGGCCATG g.90561G4T GGAAGACAAC Exon 5 G187W* 4.3 4.2 0.0 0.0 rs11568658 22 CACCCCTCTT g.90673T4C CCCCTTTTAT Intron 5 25.3 23.7 73.6 74.4 rs899496,39 23 TTTCTGGAGG g.90696C4T AGGGGCTCAC Intron 5 38.9 37.5 5.6 6.3 rs4148472,39 24 GCAGGGGCTC g.90705-90708delACTC TGTTCACACT Intron 5 44.9 47.7 38.2 36.8 rs3046400 25 TGTGTTCTTA g.91667C4T TGGTTTTGCT Intron 5 1.1 1.1 0.0 0.0 26 TGCAGGCGAT g.91765C4T GCAGTGACTG Exon 6 synonymous 19.4 19.2 1.1 1.2 rs899494,39 27 GTTGTCGGAA g.93281G4T CAAAAGCGCT Intron 6 43.5 41.5 48.9 49.9 rs2274410,39 28 GGCTGTGATC g.93355G4A CTCAGGCTCA Intron 6 15.2 17.7 2.2 1.0 rs2274409,39 29 CTCATCTCCC g.93372G4A TGTCTGGTTC Intron 6 2.2 2.2 0.0 0.0 rs11568683 30 AAGTTTTACT g.93595A4G TGTTTTCACA Intron 7 43.5 41.5 48.9 49.9 rs2274408,39 31 TCTCTTTCAG g.94534G4T AAGGAGATTT Exon 8 K304N 17.6 17.8 1.1 1.0 rs2274407,39 32 CCTGCCTCAG g.94573G4A GGGATGAATT Exon 8 synonymous 47.2 42.3 6.7 9.2 rs2274406,39 33 ATTTGGCTTC g.94591G4A TTTTTCAGTG Exon 8 synonymous 47.2 42.3 6.7 9.2 rs2274405,39 34 CAGGTTGGTG g.94791T4A CAGATGCCAT Intron 8 4.4 4.3 0.0 0.0 rs11568702 35 CACTATGTTC g.94865C4G AGTGTAATGA Intron 8 47.2 42.3 46.1 48.5 rs3818494,39 36 TGACATTTAA g.94883C4T TCTCTCATAA Intron 8 47.2 42.3 46.1 48.5 rs3818494,39 37 TAGAGAATTT g.106549T4C GAGGTGTTAC Intron 9 55.6 49.9 24.4 27.3 rs2274403,39 38 GCATTGCAGT g.114366G4A GCTTATTCTT Intron 10 9.8 9.3 0.0 0.2 rs4148487,39 39 CTCTGAAAAA g.114614G4A GTGAGTGATG Exon 11 synonymous 1.1 1.1 0.0 0.0 40 ATAGGAGATC g.123270G4A GGGAACCACG Exon 12 R531Q 1.1 1.1 0.0 0.0 41 GCTGACATCT g.123548A4G TCTCCTGGAC Exon 13 Y556C* 1.1 1.1 0.0 0.0 42 GAGGTCTCCC g.130808G4A AACTTGCAAG Intron 14 24.4 23.1 1.1 1.8 rs11568663 43 TGCCTGTTTC g.136709C4T CCACAGCTTT Intron 15 18.2 16.5 0.0 0.8 rs4148501,39 44 GTTTTCAGGC g.136862C4T TATAAGAATT Exon 16 synonymous 2.1 2.1 0.0 0.0 rs11568666 45 ATGTATGAAA g.137735T4C ACTCCAAAAT Intron 17 16.1 14.8 83.9 84.5 rs11568650 46 GGTTCATTTT g.138034T4C AAAAAAATGT Intron 17 20.7 20.3 1.1 1.3 39 47 AAATGTAACC g.138154G4A AGAAGCTAGA Exon 18 E757K 1.1 1.1 0.0 0.0 rs3765534,39 48 TGTAGCTACC g.139997G4A TTCTTTTTGG Exon 19 V776I 1.1 1.1 0.0 0.0 49 ACCACTGACA g.185182T4G CGGCTTATTT Intron 19 46.7 49.9 29.3 27.8 rs1678394,39 50 TGAATAATAT g.185207A4G TTAAATACAT Intron 19 4.3 4.2 0.0 0.0 rs2296652 51 ATTTGCTGCC g.185369G4A CTGACGTTTT Exon 20 synonymous 1.1 1.1 0.0 0.0 52 ACAACTCATG g.217965C4A AAGTATTTTT Intron 20 6.7 6.4 93.3 93.4 rs1189437,39 53 GGTTGGTGTG g.218049G4T TCTCTGTGGC Exon 21 V854F* 3.3 3.3 0.0 0.0 rs11568694 54 TTGGATCGCA g.218085A4G TACCCTTGGT Exon 21 I866 V* 5.6 5.4 0.0 0.1 55 CTTGGGAGGC g.225708C4T GCAGGTTTTT Intron 21 28.0 25.8 1.2 2.3 rs11568672 Figure 3 Predicted two-dimensional protein structure of the MRP4 protein.
X
ABCC4 p.Lys304Asn 17404579:45:2419
status: NEW
Login to comment

52 MRP4 protein expression in samples carrying non-synonymous polymorphisms relative to the control group (n ¼ 8) was as follows: G187W 58% (n ¼ 2), K304N 54% (n ¼ 3), R531Q 20% (n ¼ 1), Y556C 60% (n ¼ 1), E757K 86% (n ¼ 1), V776I 161% (n ¼ 1), V854F 96% (n ¼ 1), I866V 78% (n ¼ 4) and T1142M 40% (n ¼ 2).
X
ABCC4 p.Lys304Asn 17404579:52:156
status: NEW
Login to comment

72 Prediction of functional effects of non-synonymous variations In silico analysis of all 10 detected amino acid exchanges revealed that five of them (I18L, K304N, R531Q, E757K, V776I) can be considered benign, whereas others especially near or within transmembrane regions or ATP-binding domains are possibly (G187W, Y556C, V854F, I866V) or in one case (T1142M) even very likely damaging for protein localization and/or function (Figure 3).
X
ABCC4 p.Lys304Asn 17404579:72:155
status: NEW
Login to comment

46 Table 2 Genetic variations identified in the MRP4 gene among 95 Caucasian individuals Variant ID Sequence context 50 Systematic name Sequence context 30 Genetic element Effect Frequency (%) Heterozygous Homozygous NCBI SNP ID HW HW 1 GAACTCCTGA g.-2174C4G GTCAGGTGAT Promoter 23.7 28.5 5.4 3.0 2 CACCTGCCTC g.-2152A4G GCCTCCCAGA Promoter 2.2 2.2 0.0 0.0 3 TGGGCTAAAG g.-2055C4A CATCCTCCTG Promoter 40.9 47.9 39.8 36.3 rs2389235 4 CTAAAGCCAT g.-2051C4T CTCCTGTCTC Promoter 38.7 45.1 46.2 43.0 rs1764419 5 ATTTTTAAAA g.-1980-1981insA CTTTTGGTAG Promoter 39.8 45.5 45.2 42.3 6 CACTATGCTG g.-1949G4C CTAGCCTGTG Promoter 1.1 1.1 0.0 0.0 7 CATCTATAAA g.-1508G4A TAAGGATAAC Promoter 12.6 11.8 0.0 0.4 rs868853 8 AAATTATCAG g.-1235T4C ATTTGAACTT Promoter 2.1 2.1 0.0 0.0 9 TACTTAAACT g.-1130G4A AGTTGGGAGG Promoter 42.4 46.3 15.2 13.3 rs2993579 10 CCATGGCACC g.-642G4C TCGTTTGGTC Promoter 41.9 46.7 41.9 39.6 rs869951,39 11 CGCGTCTCCT g.-289C4G CCGCCGCGTC Promoter 2.2 2.2 0.0 0.0 12 CCGCGGCCAC g.-49C4T GCCGCCTGAT 50 UTR/ Exon 1 1.1 1.1 0.0 0.0 rs3751333,39 13 TGCCCGTGTA g.15C4T CAGGAGGTGA Exon 1 synonymous 1.1 1.1 0.0 0.0 14 GGACGCGAAC g.52A4C TCTGCTCACG Exon 1 I18L 2.2 2.2 97.8 97.8 rs11568681 15 GGTGAGTGTC g.84C4T CCGCCCGAAA Intron 1 2.2 2.1 0.0 0.0 rs11568682 16 CACTCTCCCG g.138G4C GGCCGCGCCC Intron 1 1.1 1.0 0.0 0.0 17 ACCCATGGAG g.53498G4A TAGGAGTCTA Intron 1 46.7 47.4 15.2 14.9 rs9556466 18 TTTTTCCTCAT g.54215T4C GTAGGTTCTG Intron 2 46.7 47.0 14.4 14.3 rs4148437,39 19 AGCATGGGTG g.66387A4G CAGAGCAAGC Intron 3 11.9 11.2 0.0 0.4 39 20 GGTAAGTGAC g.66715A4G TTCAGCATTA Intron 4 2.2 2.2 0.0 0.0 rs11568637 21 CATGGCCATG g.90561G4T GGAAGACAAC Exon 5 G187W* 4.3 4.2 0.0 0.0 rs11568658 22 CACCCCTCTT g.90673T4C CCCCTTTTAT Intron 5 25.3 23.7 73.6 74.4 rs899496,39 23 TTTCTGGAGG g.90696C4T AGGGGCTCAC Intron 5 38.9 37.5 5.6 6.3 rs4148472,39 24 GCAGGGGCTC g.90705-90708delACTC TGTTCACACT Intron 5 44.9 47.7 38.2 36.8 rs3046400 25 TGTGTTCTTA g.91667C4T TGGTTTTGCT Intron 5 1.1 1.1 0.0 0.0 26 TGCAGGCGAT g.91765C4T GCAGTGACTG Exon 6 synonymous 19.4 19.2 1.1 1.2 rs899494,39 27 GTTGTCGGAA g.93281G4T CAAAAGCGCT Intron 6 43.5 41.5 48.9 49.9 rs2274410,39 28 GGCTGTGATC g.93355G4A CTCAGGCTCA Intron 6 15.2 17.7 2.2 1.0 rs2274409,39 29 CTCATCTCCC g.93372G4A TGTCTGGTTC Intron 6 2.2 2.2 0.0 0.0 rs11568683 30 AAGTTTTACT g.93595A4G TGTTTTCACA Intron 7 43.5 41.5 48.9 49.9 rs2274408,39 31 TCTCTTTCAG g.94534G4T AAGGAGATTT Exon 8 K304N 17.6 17.8 1.1 1.0 rs2274407,39 32 CCTGCCTCAG g.94573G4A GGGATGAATT Exon 8 synonymous 47.2 42.3 6.7 9.2 rs2274406,39 33 ATTTGGCTTC g.94591G4A TTTTTCAGTG Exon 8 synonymous 47.2 42.3 6.7 9.2 rs2274405,39 34 CAGGTTGGTG g.94791T4A CAGATGCCAT Intron 8 4.4 4.3 0.0 0.0 rs11568702 35 CACTATGTTC g.94865C4G AGTGTAATGA Intron 8 47.2 42.3 46.1 48.5 rs3818494,39 36 TGACATTTAA g.94883C4T TCTCTCATAA Intron 8 47.2 42.3 46.1 48.5 rs3818494,39 37 TAGAGAATTT g.106549T4C GAGGTGTTAC Intron 9 55.6 49.9 24.4 27.3 rs2274403,39 38 GCATTGCAGT g.114366G4A GCTTATTCTT Intron 10 9.8 9.3 0.0 0.2 rs4148487,39 39 CTCTGAAAAA g.114614G4A GTGAGTGATG Exon 11 synonymous 1.1 1.1 0.0 0.0 40 ATAGGAGATC g.123270G4A GGGAACCACG Exon 12 R531Q 1.1 1.1 0.0 0.0 41 GCTGACATCT g.123548A4G TCTCCTGGAC Exon 13 Y556C* 1.1 1.1 0.0 0.0 42 GAGGTCTCCC g.130808G4A AACTTGCAAG Intron 14 24.4 23.1 1.1 1.8 rs11568663 43 TGCCTGTTTC g.136709C4T CCACAGCTTT Intron 15 18.2 16.5 0.0 0.8 rs4148501,39 44 GTTTTCAGGC g.136862C4T TATAAGAATT Exon 16 synonymous 2.1 2.1 0.0 0.0 rs11568666 45 ATGTATGAAA g.137735T4C ACTCCAAAAT Intron 17 16.1 14.8 83.9 84.5 rs11568650 46 GGTTCATTTT g.138034T4C AAAAAAATGT Intron 17 20.7 20.3 1.1 1.3 39 47 AAATGTAACC g.138154G4A AGAAGCTAGA Exon 18 E757K 1.1 1.1 0.0 0.0 rs3765534,39 48 TGTAGCTACC g.139997G4A TTCTTTTTGG Exon 19 V776I 1.1 1.1 0.0 0.0 49 ACCACTGACA g.185182T4G CGGCTTATTT Intron 19 46.7 49.9 29.3 27.8 rs1678394,39 50 TGAATAATAT g.185207A4G TTAAATACAT Intron 19 4.3 4.2 0.0 0.0 rs2296652 51 ATTTGCTGCC g.185369G4A CTGACGTTTT Exon 20 synonymous 1.1 1.1 0.0 0.0 52 ACAACTCATG g.217965C4A AAGTATTTTT Intron 20 6.7 6.4 93.3 93.4 rs1189437,39 53 GGTTGGTGTG g.218049G4T TCTCTGTGGC Exon 21 V854F* 3.3 3.3 0.0 0.0 rs11568694 54 TTGGATCGCA g.218085A4G TACCCTTGGT Exon 21 I866 V* 5.6 5.4 0.0 0.1 55 CTTGGGAGGC g.225708C4T GCAGGTTTTT Intron 21 28.0 25.8 1.2 2.3 rs11568672 Figure 3 Predicted two-dimensional protein structure of the MRP4 protein.
X
ABCC4 p.Lys304Asn 17404579:46:2419
status: NEW
Login to comment

53 MRP4 protein expression in samples carrying non-synonymous polymorphisms relative to the control group (n &#bc; 8) was as follows: G187W 58% (n &#bc; 2), K304N 54% (n &#bc; 3), R531Q 20% (n &#bc; 1), Y556C 60% (n &#bc; 1), E757K 86% (n &#bc; 1), V776I 161% (n &#bc; 1), V854F 96% (n &#bc; 1), I866V 78% (n &#bc; 4) and T1142M 40% (n &#bc; 2).
X
ABCC4 p.Lys304Asn 17404579:53:154
status: NEW
Login to comment

73 Prediction of functional effects of non-synonymous variations In silico analysis of all 10 detected amino acid exchanges revealed that five of them (I18L, K304N, R531Q, E757K, V776I) can be considered benign, whereas others especially near or within transmembrane regions or ATP-binding domains are possibly (G187W, Y556C, V854F, I866V) or in one case (T1142M) even very likely damaging for protein localization and/or function (Figure 3).
X
ABCC4 p.Lys304Asn 17404579:73:155
status: NEW
Login to comment

PMID: 24991206 [PubMed] Goricar K et al: "Polymorphisms in folate pathway and pemetrexed treatment outcome in patients with malignant pleural mesothelioma."
No. Sentence Comment
35 MTHFD1 rs2236225 (Arg653Gln), MTHFR rs1801133 (Ala222Val) and rs1801131 (Glu429Ala), SLCO1B1 rs2306283 (Asn130Asp), and ABCB1 rs1045642 (Ile1145Ile) polymorphisms were determined using TaqMan SNP Genotyping assays according to the manufacturer`s instructions (Applied Biosystems, Foster City, CA) as previously described.22 Genotyping of MTRR rs1801394 (Ile22Met), MTR rs1805087 (Asp919Gly), SLC19A1 rs1051266 (Arg27Cys), SLCO1B1 rs11045879 (intronic), rs4149056 (Val174Ala) and rs2900478 (intronic), ABCC2 rs717620 (5` untranslated region (UTR) -24C>T), rs2273697 (Val417Ile) and rs2804402 (5` UTR -1019A>G), ABCC4 rs2274407 (Lys304Asn), and ABCG2 rs2231142 (Gln141Lys) and rs2231137 (Val12Met) polymorphisms was carried out using a fluorescence-based competitive allele-specific (KASPar) assay according to the manufacturer`s instructions (KBiosciences, Herts, UK).
X
ABCC4 p.Lys304Asn 24991206:35:627
status: NEW
Login to comment