ABCMdb

PMID: 18364470

Abla N, Chinn LW, Nakamura T, Liu L, Huang CC, Johns SJ, Kawamoto M, Stryke D, Taylor TR, Ferrin TE, Giacomini KM, Kroetz DL
The human multidrug resistance protein 4 (MRP4, ABCC4): functional analysis of a highly polymorphic gene.
J Pharmacol Exp Ther. 2008 Jun;325(3):859-68. Epub 2008 Mar 25., [PubMed]

Sentences

No. Mutations Sentence Comment

9 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Gly187Trp However, two variants (G187W and G487E) showed a significantly reduced function compared to reference with both substrates, as evidenced by higher intracellular accumulation of AZT and PMEA compared to the reference MRP4 (43 and 69% increase in accumulation for G187W compared with the reference MRP4, with AZT and PMEA, respectively). Login to comment 54 ABCC4 p.Leu18Ile The previously described reference sequence (GenBank accession number NM_005845) contains two SNPs (rs11568681/Leu18Ile and rs1557070) with low frequencies (Ͻ10%) that are not found in our reference sequence. Login to comment 89 ABCC4 p.Gly538Asp This mutant, G538D, has an aspartate instead of a glycine at the fourth position in the ABC signature of the first nucleotide binding domain (NBD; Fig. 1). Login to comment 100 ABCC4 p.Gly187Trp ABCC4 p.Met744Val ABCC4 p.Lys304Asn Only three nonsynonymous variants (G187W, K304N, and M744V) have frequencies higher than 5% in a given ethnic group. Login to comment 110 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Pro78Ala ABCC4 p.Lys498Glu ABCC4 p.Met744Val ABCC4 p.Cys956Ser ABCC4 p.Lys293Glu ABCC4 p.Lys304Asn ABCC4 p.Val1071Ile ABCC4 p.Pro403Leu ABCC4 p.Gly538Asp Initially, ABCC4 haplotypes were inferred from all variable sites with a frequency higher than TABLE 1 Primers used for constructing the variants and the nonfunctional mutant by site-directed mutagenesis Variant Sequencea (5Ј-3Ј) P78A F: GAATGACGCACAGAAGGCTTCTTTAACAAGAGC R: GCTCTTGTTAAAGAAGCCTTCTGTGCGTCATTC G187W F: GTAACATGGCCATGTGGAAGACAACCACAG R: CTGTGGTTGTCTTCCACATGGCCATGTTAC K293E F: GTACGCCTGGGAAGAGTCATTTTCAAATC R: GATTTGAAAATGACTCTTCCCAGGCGTAC K304N F: CCAATTTGAGAAATAAGGAGATTTCCAAG R: CTTGGAAATCTCCTTATTTCTCAAATTGG P403L F: GCGCAACCGTCAGCTGCTGTCAGATGGTAAAAAG R: CTTTTTACCATCTGACAGCAGCTGACGGTTGCGC G487E F: CCCTGGGTGTTCTCGGAAACTCTGAGGAG R: CTCCTCAGAGTTTCCGAGAACACCCAGGG K498E F: GTAATATTTTATTTGGGAAGGAATACGAAAAGG R: CCTTTTCGTATTCCTTCCCAAATAAAATATTAC M744V F: GGGCAAACAAACAAAGTGTGCTAAATGTCACTG R: CAGTGACATTTAGCACACTTTGTTTGTTTGCCC C956S F: CGTCTGGATGCCATCTCTGCCATGTTTGTCATC R: GATGACAAACATGGCAGAGATGGCATCCAGACG V1071I F: CACAAGAAAAGATTGGCATTGTGGGAAG R: CTTCCCACAATGCCAATCTTTTCTTGTG G538D F: GGAACCACGCTGAGTGGAGACCAGAAAGCACGGGTAAACC R: GGTTTACCCGTGCTTTCTGGTCTCCACTCAGCGTGGTTCC F, forward; R, reverse. Login to comment 126 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Gly187Trp ABCC4 p.Met744Val ABCC4 p.Met744Val ABCC4 p.Cys956Ser ABCC4 p.Lys304Asn ABCC4 p.Lys304Asn ABCC4 p.Pro403Leu Ten nonsynonymous variants were chosen for this study based on a frequency of Ն5% in the populations studied (G187W, K304N, and M744V), high evolutionary conservation (all variants with the exception of M744V), or a high Grantham value (G187W Ͼ C956S Ͼ P403L ϭ G487E Ͼ K304N). Login to comment 128 ABCC4 p.Lys304Asn Variants referred to as "evolutionarily conserved" show a complete conservation across the seven species, with the exception of an arginine to lysine change for variant K304N in two species. Login to comment 140 ABCC4 p.Gly538Asp This is illustrated by the fact that the accumulation of both substrates in the cells transfected with the G538D construct is not statistically different from the vector-transfected cells (Fig. 4A). Login to comment 144 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp However, the function of two variants (G187W and G487E) was significantly reduced compared to the reference, and this was observed both with AZT and PMEA (p Ͻ 0.001 and p Ͻ 0.005, Student`s t test with Bonferroni`s correction for 10 comparisons) (Fig. 4B). Login to comment 145 ABCC4 p.Glu757Lys ABCC4 p.Glu757Lys ABCC4 p.Gly487Glu ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Gly187Trp ABCC4 p.Gln1314Arg ABCC4 p.Gln1314Arg ABCC4 p.Pro78Ala ABCC4 p.Pro78Ala ABCC4 p.Pro78Ala ABCC4 p.Ile625Met ABCC4 p.Ile625Met ABCC4 p.Thr1142Met ABCC4 p.Thr1142Met ABCC4 p.Pro667Leu ABCC4 p.Pro667Leu ABCC4 p.Met744Val ABCC4 p.Met744Val ABCC4 p.Cys956Ser ABCC4 p.Cys956Ser ABCC4 p.Leu18Ile ABCC4 p.Leu18Ile ABCC4 p.Met184Thr ABCC4 p.Met184Thr ABCC4 p.Arg820Ile ABCC4 p.Arg820Ile ABCC4 p.Lys293Glu ABCC4 p.Lys293Glu ABCC4 p.Lys304Asn ABCC4 p.Lys304Asn ABCC4 p.Val1071Ile ABCC4 p.Val1071Ile ABCC4 p.Pro403Leu ABCC4 p.Pro403Leu ABCC4 p.Pro403Leu ABCC4 p.Val900Leu ABCC4 p.Val900Leu ABCC4 p.Arg1220Gln ABCC4 p.Arg1220Gln ABCC4 p.Val854Phe ABCC4 p.Val854Phe ABCC4 p.Thr356Met ABCC4 p.Thr356Met The P78A and P403L TABLE 2 Selected genetic variants in ABCC4a Exon Nucleotide Position Golden Path Positionb Variant Flagb Nucleotide Change Amino Acid or Intronic Position Amino Acid Change Grantham Score Allele Frequencyc AA (n ϭ 160) CA (n ϭ 160) AS (n ϭ 120) ME (n ϭ 100) 1 -49 chr13:94751618 rs3751333 C Ͼ T 5Ј-UTR - - 0.013 0.019 0.102 0.03 1 52 chr13:94751518 rs11568681 C Ͼ A 18 Leu to Ile 5 0.006 0.044 0.034 0.01 1 IVS1ϩ10 chr13:94751486 rs11568682 C Ͼ T Intronic - - 0.006 0.019 0 0 2 IVS2ϩ7 chr13:94697891 rs11568700 C Ͼ T Intronic - - 0.031 0 0 0 3 IVS3-5 chr13:94697355 rs4148437 T Ͼ C Intronic - - 0.087 0.331 0.183 0.25 3d 232 chr13:94697304 rs11568689 C Ͼ G 78 Pro to Ala 27 0 0 0.008 0 4 IVS4-10 chr13:94685099 rs11568638 C Ͼ T Intronic - - 0.025 0 0 0 4 IVS4ϩ10 chr13:94684855 rs11568637 A Ͼ G Intronic - - 0.031 0 0.117 0 5 551 chr13:94661017 rs11568657 T Ͼ C 184 Met to Thr 81 0.013 0 0 0 5 559 chr13:94661009 rs11568658 G Ͼ T 187 Gly to Trp 184 0 0.025 0.108 0.130 6 669 chr13:94659805 rs899494 C Ͼ T 223 Syn 0.219 0.200 0.125 0.090 6 717 chr13:94659757 rs11568674 T Ͼ C 239 Syn 0 0 0.008 0 7 877 chr13:94658089 rs11568684 A Ͼ G 293 Lys to Glu 56 0.006 0 0 0 8 912 chr13:94657036 rs2274407 G Ͼ T 304 Lys to Asn 94 0.181 0.087 0.225 0.160 8 951 chr13:94656997 rs2274406 G Ͼ A 317 Syn 0.619 0.406 0.458 0.390 8 969 chr13:94656979 rs2274405 G Ͼ A 323 Syn 0.312 0.406 0.458 0.320 8 1035 chr13:94656913 rs11568703 G Ͼ A 345 Syn 0 0.013 0 0 8 1067 chr13:94656881 rs11568701 C Ͼ T 356 Thr to Met 81 0 0 0 0.010 8 IVS8ϩ8 chr13:94656779 rs11568702 T Ͼ A Intronic - 0 0.013 0 0 9 1208 chr13:94645146 rs11568705 C Ͼ T 403 Pro to Leu 98 0.006 0 0 0 11 1458 chr13:94637043 rs11568670 G Ͼ A 486 Syn 0 0.006 0 0 11 1460 chr13:94637041 rs11568668 G Ͼ A 487 Gly to Glu 98 0 0 0.008 0 11 1492 chr13:94637009 rs11568669 A Ͼ G 498 Lys to Glu 56 0.025 0 0 0 11 1497 chr13:94637004 rs1557070 C Ͼ T 499 Syn 0.238 0 0 0 14 1737 chr13:94620874 rs11568664 T Ͼ C 579 Syn 0.006 0 0 0 15 IVS15-7 chr13:94616629 rs11568696 A Ͼ G Intronic - 0.031 0 0 0 15 1875 chr13:94616572 rs11568699 A Ͼ G 625 Ile to Met 10 0.006 0 0 0 15 2000 chr13:94616447 rs11568697 C Ͼ T 667 Pro to Leu 98 0 0.006 0 0 15 2001 chr13:94616446 rs11568698 C Ͼ T 667 Syn 0.013 0 0 0 16 2100 chr13:94614708 rs11568666 C Ͼ T 700 Syn 0 0.013 0 0 18 2230 chr13:94613455 rs9282570 A Ͼ G 744 Met to Val 21 0.050 0 0 0 18 2269 chr13:94613416 rs3765534 G Ͼ A 757 Glu to Lys 56 0.025 0.013 0.033 0.030 19 2364 chr13:94611535 rs11568709 C Ͼ T 788 Syn 0.006 0 0 0 20 2459 chr13:94566253 rs11568659 G Ͼ T 820 Arg to Ile 97 0.006 0 0 0 21 2560 chr13:94533521 rs11568694 G Ͼ T 854 Val to Phe 50 0.006 0 0 0 21 2577 chr13:94533504 rs11568691 C Ͼ T 859 Syn 0 0.006 0 0 22 2698 chr13:94525795 rs11568673 G Ͼ T 900 Val to Leu 32 0 0.006 0 0.010 22 2712 chr13:94525781 rs1678339 G Ͼ A 904 Syn 0.156 0.031 0.217 0.020 23 2844 chr13:94524542 rs1189466 C Ͼ T 948 Syn 0.075 0.031 0.208 0.020 23 2847 chr13:94524539 rs11568708 C Ͼ T 949 Syn 0.019 0 0 0 23 2867 chr13:94524519 rs11568707 G Ͼ C 956 Cys to Ser 112 0.006 0 0 0 26 3211 chr13:94513114 rs11568653 G Ͼ A 1071 Val to Ile 29 0.006 0 0 0 26 3255 chr13:94513070 rs11568652 C Ͼ A 1085 Syn 0.013 0 0 0.010 26 3310 chr13:94513015 rs11568655 T Ͼ C 1104 Syn 0.100 0 0 0.010 26 3348 chr13:94512977 rs1751034 A Ͼ G 1116 Syn 0.231 0.169 0.242 0.200 27 3425 chr13:94503381 rs11568644 C Ͼ T 1142 Thr to Met 81 0 0.006 0 0 28 3609 chr13:94494541 rs11568695 G Ͼ A 1203 Syn 0.206 0 0 0.010 29 3659 chr13:94494013 rs11568639 G Ͼ A 1220 Arg to Gln 43 0.006 0 0 0 29 3723 chr13:94493949 rs11568640 C Ͼ T 1241 Syn 0.006 0 0 0 30 3774 chr13:94484956 rs11568704 G Ͼ A 1258 Syn 0.037 0 0 0 31 IVS31-3 chr13:94471940 rs9524765 C Ͼ T Intronic - 0.225 0 0 0.02 31 3941 chr13:94471867 rs11568688 A Ͼ G 1314 Gln to Arg 43 0.006 0 0 0 31 4016 chr13:94471792 rs3742106 T Ͼ G 3Ј-UTR - 0.287 0.388 0.467 0.470 Dashes indicate not relevant. Login to comment 152 ABCC4 p.Cys956Ser It is interesting that the C956S variant showed a slight increase in function with PMEA (p Ͻ 0.001). Login to comment 153 ABCC4 p.Gly187Trp The G187W variant had the greatest decrease in function, with a 43 and 69% increase in accumulation of AZT and PMEA, respectively, compared to reference MRP4. Login to comment 154 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Pro78Ala ABCC4 p.Cys956Ser To characterize the functional difference observed with some of the variants, we measured the intracellular accumulation of AZT and PMEA as a function of the extracellular concentration for the reference and the variants that showed a reduced function with one or both substrates (P78A, G187W, and G487E), as well as the C956S variant, which was more functional with respect to PMEA transport (Fig. 5). Login to comment 156 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp The transport velocity curves (Fig. 5) suggest that the differences reported with some of the variants (G187W and G487E) are real and concentration-independent, and this effect seems more pronounced with AZT. Login to comment 176 ABCC4 p.Gly187Trp The MRP4 and GAPDH signals were quantified using image analysis, and the G187W variant was expressed at a significantly lower level than that of the reference MRP4 (data not shown). Login to comment 179 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Pro78Ala ABCC4 p.Cys956Ser ABCC4 p.Gly538Asp To check that the functional differences were not due to differences in localization of the variants at the cell membrane, immunocytochemistry studies were carried out with the less functional variants (G187W, G487E, and P78A), the nonfunctional mutant (G538D) and the more functional variant (C956S). Login to comment 195 ABCC4 p.Gly487Glu ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Gly187Trp ABCC4 p.Pro78Ala ABCC4 p.Cys956Ser ABCC4 p.Cys956Ser The values represent the mean Ϯ S.D. of n ϭ 3 (AZT) or n ϭ 4 (PMEA) determinations (f, reference; ࡗ, P78A; Œ, G187W; ‚, G487E; and E, C956S). Login to comment 218 ABCC4 p.Gly187Trp Four variants have significantly lower function, with the G187W variant displaying the greatest reduction in function. Login to comment 219 ABCC4 p.Cys956Ser In contrast, the C956S variant had a significantly higher transport of PMEA. Login to comment 229 ABCC4 p.Gly187Trp One exception to this is the G187W variant, which had lower levels of antiretroviral transport and showed deceased expression by Western blotting. Login to comment 234 ABCC4 p.Gly187Trp The Grantham value for G187W is the greatest among the nonsynonymous variants of MRP4 (D ϭ 184), indicating that this variant has the greatest structural change, with respect to composition, Fig. 7. Login to comment 240 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Pro78Ala ABCC4 p.Cys956Ser ABCC4 p.Pro403Leu ABCC4 p.Gly538Asp C, P78A; D, G187W; E, P403L; F, G487E; G, C956S; H, G538D. Login to comment 244 ABCC4 p.Gly487Glu ABCC4 p.Cys956Ser It is supported by the fact that the G487E and C956S variants also have high Grantham values (D ϭ 98 and 102, respectively) and altered functions. Login to comment 245 ABCC4 p.Lys304Asn However, this estimator probably can not account completely for these data, because another variant with a high Grantham value (K304N) does not show any functional difference. Login to comment 246 ABCC4 p.Gly487Glu ABCC4 p.Gly187Trp ABCC4 p.Pro78Ala ABCC4 p.Cys956Ser ABCC4 p.Pro403Leu The ϳ50% reduction in function observed with the G187W variant could be clinically relevant, whereas the small differences observed with the other variants (G487E, P78A, P403L, and C956S) are less likely to be significant. Login to comment 247 ABCC4 p.Gly187Trp The G187W variant is present at a frequency of 2.5 to 13% in various ethnic groups. Login to comment 249 ABCC4 p.Gly187Trp The G187W MRP4 variant could also play a role at the organism level, because MRP4 is expressed in the kidney and the liver where it may be involved in antiviral elimination (Zamek-Gliszczynski et al., 2006; Imaoka et al., 2007). Login to comment 261 ABCC4 p.Gly187Trp The G187W variant shows the greatest decrease in function and lower expression in this in vitro system. Login to comment