ABCG2 p.Cys603Ala

[switch to full view]
Comments [show]
Publications
PMID: 16086592 [PubMed] Bhatia A et al: "Oligomerization of the human ABC transporter ABCG2: evaluation of the native protein and chimeric dimers."
No. Sentence Comment
67 ABCG2∆EC-C, which contains all three endogenous extracellular cysteines replaced with alanine (C592A, C603A, C608A), was constructed by site-directed mutagenesis of the parent plasmid pTM1-ABCG2 (R482G).
X
ABCG2 p.Cys603Ala 16086592:67:109
status: VERIFIED
Login to comment

PMID: 16107343 [PubMed] Henriksen U et al: "Identification of intra- and intermolecular disulfide bridges in the multidrug resistance transporter ABCG2."
No. Sentence Comment
3 Upon mutation of Cys-592 or Cys-608 to alanine (C592A and C608A), ABCG2 migrated as a dimer in SDS-PAGE under non-reducing conditions; however, mutation of Cys603 to Ala (C603A) caused the transporter to migrate as a single monomeric band.
X
ABCG2 p.Cys603Ala 16107343:3:156
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:3:156
status: NEW
Login to comment

4 Despite this change, C603A displayed efficient membrane targeting and preserved transport function.
X
ABCG2 p.Cys603Ala 16107343:4:21
status: VERIFIED
Login to comment

6 In contrast to C603A, both C592A and C608A displayed impaired membrane targeting and function.
X
ABCG2 p.Cys603Ala 16107343:6:15
status: VERIFIED
Login to comment

7 Moreover, when only Cys-592 or Cys-608 were present (C592A/C603A and C603A/ C608A), the transporter displayed impaired plasma membrane expression and function.
X
ABCG2 p.Cys603Ala 16107343:7:59
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:7:69
status: VERIFIED
Login to comment

104 The resulting constructs (C592A, C603A, and C608A) were stably expressed in HEK293 cells using the bicistronic vector pCIN4 (28), and total cell lysates were analyzed by Western blotting in the presence of increasing concentrations of DTT (Fig. 3).
X
ABCG2 p.Cys603Ala 16107343:104:33
status: VERIFIED
Login to comment

107 Interestingly, the disulfide bridge-linked dimer was completely absent in the C603A mutant (Fig. 3B).
X
ABCG2 p.Cys603Ala 16107343:107:78
status: VERIFIED
Login to comment

113 Subsequent immunocytochemistry analysis of the single mutants was in agreement with the Western blot analysis and supported that the wt and C603A mutant were expressed almost exclusively in the plasma membrane (Fig. 3, B and D).
X
ABCG2 p.Cys603Ala 16107343:113:140
status: VERIFIED
Login to comment

114 In comparison, C592A and C608A exhibited less apparent plasma membrane staining and substantially more intracellular staining than in wt and C603A (Fig. 3, A and C).
X
ABCG2 p.Cys603Ala 16107343:114:141
status: VERIFIED
Login to comment

118 Only in C603A, the resistance FIGURE 3.
X
ABCG2 p.Cys603Ala 16107343:118:8
status: VERIFIED
Login to comment

120 C608A (A), C603A (B),C592A(C),andwt(D)areshown.Immunostainings of the corresponding cells are shown directly below.
X
ABCG2 p.Cys603Ala 16107343:120:11
status: VERIFIED
Login to comment

125 The analysis showed that, although C603A tended to have a higher total expression, there were no significant changes in the expression of C592A and C608A.
X
ABCG2 p.Cys603Ala 16107343:125:35
status: VERIFIED
Login to comment

129 To further explore this hypothesis, we mutated two cysteines at a time, resulting in C592A/C603A, C592A/C608A, and C603A/C608A, each of which contained one remaining extracellular cysteine.
X
ABCG2 p.Cys603Ala 16107343:129:91
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:129:115
status: VERIFIED
Login to comment

133 In contrast, protein expression was very low in the construct containing only Cys-592 (C603A/ C608A) (Figs. 5C and 6C) and slightly lower than wt for C592A/C603A, in which only Cys-608 is present (Figs. 5A and 6C).
X
ABCG2 p.Cys603Ala 16107343:133:87
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:133:156
status: VERIFIED
Login to comment

134 Notably, we also detected dimer formation in C603A/C608A and C592A/C603A.
X
ABCG2 p.Cys603Ala 16107343:134:45
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:134:67
status: VERIFIED
Login to comment

136 A, comparison of cell survival between non-transfected HEK293 cells (E) and HEK293 cells transfected with ABCG2-wt (●), C592A (‚), C603A (ƒ), and C608A (Ⅺ).
X
ABCG2 p.Cys603Ala 16107343:136:145
status: VERIFIED
Login to comment

145 Shown are C592A/C603A (A), wt (B), C603A/C608A (C), and C592A/ C608A (D).
X
ABCG2 p.Cys603Ala 16107343:145:16
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:145:35
status: VERIFIED
Login to comment

152 Staining of the transfected HEK293 cells showed that, although C592A/C608A (Fig. 5D) mostly resembled the membrane-localized expression pattern of wt (Fig. 5B), C592A/C603A displayed largely intracellular staining (Fig. 5A), and C603A/C608A was hardly visible (Fig. 5C).
X
ABCG2 p.Cys603Ala 16107343:152:167
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:152:229
status: VERIFIED
Login to comment

157 For both C603A/C608A and C592A/C603A, we observed a marked decrease in resistance to mitoxantrone and a concomitant decrease in expression (Fig. 6, B and C).
X
ABCG2 p.Cys603Ala 16107343:157:9
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:157:31
status: VERIFIED
Login to comment

160 We also substituted all three extracellular cysteines in ABCG2 simultaneously (C592A/C603A/C608A).
X
ABCG2 p.Cys603Ala 16107343:160:85
status: VERIFIED
Login to comment

162 Specifically, we were almost unable to detect any expressed protein in the immunostainings (Fig. 7B) To further explore the function of the hypothesized disulfide bridges, we performed efflux experiments on the mutants containing either both Cys-592 and Cys-608 (C603A), predicted to form an intramolecular disulfide bridge, or Cys-603 only (C592A/C608A), predicted to form an intermolecular disulfide bridge (Fig. 9).
X
ABCG2 p.Cys603Ala 16107343:162:263
status: VERIFIED
Login to comment

164 C603A displayed efflux similar to wt, whereas efflux in C592A-C608A was slightly decreased (Fig. 9).
X
ABCG2 p.Cys603Ala 16107343:164:0
status: VERIFIED
Login to comment

165 The pattern was, however, different when analyzing another substrate for ABCG2, BODIPY-prazosin; i.e. we observed BODIPY-prazosin efflux similar to the wt in C603A, whereas in C592A-C608A we could not detect any evidence for BODIPY-prazosin efflux (Fig. 9).
X
ABCG2 p.Cys603Ala 16107343:165:158
status: VERIFIED
Login to comment

168 Without prior TCEP reduction, we observed no labeling consistent with no cysteines on the extracellular face of the transporter available for biotinylation (Fig. 10); however, upon TCEP treatment, we found clear biotin labeling of both C603A and C592A/C608A.
X
ABCG2 p.Cys603Ala 16107343:168:236
status: VERIFIED
Login to comment

172 A, comparison of cell survival between empty HEK293 (E) and ABCG2-wt (●), C592A/C603A (‚), C592A/C608A (ƒ), and C603A/C608A (Ⅺ).
X
ABCG2 p.Cys603Ala 16107343:172:87
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:172:132
status: VERIFIED
Login to comment

181 Of all mutants tested, only C603A showed clear staining with anti-ABCG2 (5D3) (Fig. 11); all other mutants showed no staining (Fig. 11).
X
ABCG2 p.Cys603Ala 16107343:181:28
status: VERIFIED
Login to comment

196 The unconstrained plasma membrane targeting of C603A also indicates that we have not disrupted dimerization in the native membrane, because evidence has been obtained in the homologous FIGURE 7.
X
ABCG2 p.Cys603Ala 16107343:196:47
status: VERIFIED
Login to comment

202 The transmitted light image of the C592A/C603A/C608A (3cys) sample is also shown.
X
ABCG2 p.Cys603Ala 16107343:202:41
status: VERIFIED
Login to comment

206 Empty HEK293 (●), ABCG2-wt (Œ), and ABCG2-C592A/C603A/C608A (3cys) (f) are shown.
X
ABCG2 p.Cys603Ala 16107343:206:61
status: VERIFIED
Login to comment

219 In addition, biochemical evidence for the existence of this disulfide bridge was obtained from the biotinylation experiment showing biotinylation in C603A only with prior TCEP reduction (Fig. 10).
X
ABCG2 p.Cys603Ala 16107343:219:149
status: VERIFIED
Login to comment

221 Cys-592 and Cys-608 might nonetheless form intermolecular disulfide bridges when they are "alone" as indicated from the results with the double mutations; i.e. both in C603A/C608A (where Cys-592 is alone) and in C592A/C603A (where Cys-608 is alone), we observed some disulfide bridge-linked dimers despite the fact that Cys603 is mutated.
X
ABCG2 p.Cys603Ala 16107343:221:168
status: VERIFIED
X
ABCG2 p.Cys603Ala 16107343:221:218
status: VERIFIED
Login to comment

223 Efflux of BODIPY-prazosin and mitoxantrone is not affected by removal of the intermolecular disulfide bridge (C603A), whereas removal of the intramolecular disulfide bridge affects BODIPY-prazosin efflux (C592A/C608A).
X
ABCG2 p.Cys603Ala 16107343:223:110
status: VERIFIED
Login to comment

231 Cells stably expressing wt, C603A, or C592A/C608A ABCG2 were exposed to a cysteine-reactive biotinylation agent after incubation with (ϩ) or without (-) the reducing agent TCEP.
X
ABCG2 p.Cys603Ala 16107343:231:28
status: VERIFIED
Login to comment

241 Mutating all three extracellular cysteines in ABCG2 (C592A/C603A/ C608A) at the same time had detrimental effects on the transporter.
X
ABCG2 p.Cys603Ala 16107343:241:59
status: VERIFIED
Login to comment

243 This supports the conclusion that, although we can disrupt the putative intermolecular symmetrical disulfide bridge involving Cys-603 (C603A mutant) and although we can remove the putative intramolecular disulfide bridge between Cys-592 and Cys-608 (C592A/C608A mutant) without any major impact on expression of the transporter, it is not possible to remove both of them simultaneously.
X
ABCG2 p.Cys603Ala 16107343:243:135
status: VERIFIED
Login to comment

PMID: 16367905 [PubMed] Kage K et al: "Role of Cys-603 in dimer/oligomer formation of the breast cancer resistance protein BCRP/ABCG2."
No. Sentence Comment
143 (c) SN-38 sensitivity of parental PA317, PA/WT, PA/C603D, PA/C603Y, PA/ C603S and PA/C603A.
X
ABCG2 p.Cys603Ala 16367905:143:85
status: VERIFIED
Login to comment

PMID: 16983557 [PubMed] Kusuhara H et al: "ATP-binding cassette, subfamily G (ABCG family)."
No. Sentence Comment
74 Furthermore, substitution of alanine for cysteine 603 did not affect membrane localization and resistance to mitoxantrone, although it abolished dimerization [24].
X
ABCG2 p.Cys603Ala 16983557:74:29
status: VERIFIED
Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand.
X
ABCG2 p.Cys603Ala 18249138:245:2774
status: NEW
Login to comment

PMID: 18430864 [PubMed] Liu Y et al: "Effect of cysteine mutagenesis on the function and disulfide bond formation of human ABCG2."
No. Sentence Comment
111 Mutation of one or two of these residues (I2-CL, C284A, and C374A) did not signifi- TABLE 1 Primers used for construction of cysless mutants Mutations Primer Sequence RESa C43A TTTCATAACATTGCCTATCGAGTAAAACTGAAG BsrDI C55A GCTTTCTACCTGCACGAAAACCAGTTGAG BsgI C119A GCCAATTTCAAAGCGAATTCAGGTTACGTGG EcoRI C284A GAATCAGCTGGATATCACGCTGAGGCCTATAATAAC EcoRV C374A ACACCACCTCCTTCGCTCATCAACTCAGATG None C438A CTGACGACCAACCAAGCTTTCAGCAGTGTTTC HindIII C491A TATATTTACCGCTATAGTATACTTCATGTTAGG AccI C544A CTTCTCATGACGATCGCTTTTGTGTTTATGATG PvuI C592A GGACAAAACTTCGCCCCGGGACTCAATGCAA SmaI C603A/C608A AGGAAACAATCCTGCTAACTATGCAACAGCTACTGGCGAAGAATATTT -NspI C635A CACGTGGCCTTGGCTGCAATGATTGTTATTTTC BsrDI a Restriction (RES) enzyme digestion sites engineered in the primer for the convenience of detection.
X
ABCG2 p.Cys603Ala 18430864:111:573
status: VERIFIED
Login to comment

112 The primer sequence for the C603A/C608A mutant does not contain the NspI site present in the wild-type sequence.
X
ABCG2 p.Cys603Ala 18430864:112:28
status: VERIFIED
Login to comment

131 To test this hypothesis, we engineered another construct that has all three cysteine residues in the third extracellular loop mutated to alanine (C592A, C603A, and C608A) to determine whether dimers linked by intermolecular disulfide bonds exist with this mutant.
X
ABCG2 p.Cys603Ala 18430864:131:153
status: VERIFIED
Login to comment

PMID: 18644784 [PubMed] Ozvegy-Laczka C et al: "Interaction with the 5D3 monoclonal antibody is regulated by intramolecular rearrangements but not by covalent dimer formation of the human ABCG2 multidrug transporter."
No. Sentence Comment
7 When analyzing ABCG2 mutants carrying Cys-to-Ala changes in the extracellular loop, we found that the mutant C603A (lacking the intermolecular S-S bond) showed comparable transport activity and 5D3 reactivity to the wild-type ABCG2.
X
ABCG2 p.Cys603Ala 18644784:7:109
status: VERIFIED
Login to comment

28 Interestingly, mutation of Cys-603 to Ala, Gly, or Ser does not remarkably influence the expression and functionality of the transporter (9-11).
X
ABCG2 p.Cys603Ala 18644784:28:27
status: VERIFIED
Login to comment

168 Fig. 4A shows that all Cys-to-Ala mutants (except for C603A/ C608A that was expressed in very low amount and exclusively in an underglycosylated form) could be detected by Western blotting, using the ABCG2-specific BXP-21 antibody.
X
ABCG2 p.Cys603Ala 18644784:168:54
status: VERIFIED
Login to comment

169 The mutants C592A and C603A showed expression levels comparable to that of the wild-type ABCG2, whereas the amount of double mutant C592A/C608A or the triple Ala mutant proteins was about 50% of that seen for the wild-type ABCG2.
X
ABCG2 p.Cys603Ala 18644784:169:22
status: VERIFIED
Login to comment

173 Hoechst 33342 and pheophorbide A were transported by all of the mutants (except for C603A/C608A); however, the mitoxantrone transport capacity of the mutants, lacking the intramolecular or both disulfide bonds, was significantly weaker than that of the R482G or C603A variants.
X
ABCG2 p.Cys603Ala 18644784:173:84
status: VERIFIED
X
ABCG2 p.Cys603Ala 18644784:173:262
status: VERIFIED
Login to comment

174 There was also a difference in rhodamine123 uptake, with the C592A and C592A/ C603A mutants showing practically no transport activity (Fig. 4B).
X
ABCG2 p.Cys603Ala 18644784:174:78
status: VERIFIED
Login to comment

176 When cells expressing the different Cys-to-Ala mutants were labeled with the 5D3 antibody, we found that only the C603A variant had a clearly detectable 5D3 labeling and the C592A/ C608A mutant showed some weak 5D3 binding capacity (Fig. 5A, upper panel).
X
ABCG2 p.Cys603Ala 18644784:176:114
status: VERIFIED
Login to comment

177 Similar to that seen in the case of the wild-type ABCG2, PFA fixation (Fig. 5A, lower panel) or Ko143 treatment (not shown) of the cells expressing the C603A mutant and the double mutant C592A/C608A resulted in an increased 5D3 binding.
X
ABCG2 p.Cys603Ala 18644784:177:152
status: VERIFIED
Login to comment

180 Fig. 5B shows that all mutants could be detected by the BXP-21 antibody, recognizing an intracellular epitope of ABCG2, and all of them were present in the plasma membrane (except for the hardly expressed C603A/C608A double mutant, which was found, for the most part, intracellularly).
X
ABCG2 p.Cys603Ala 18644784:180:205
status: VERIFIED
Login to comment

181 However, 5D3 labeling analyzed by confocal microscopy gave the same result as the flow cytometry measurements, that is, only the cells expressing the wild-type ABCG2, C603A, and the C592A/ C608A variants (the latter one seen only at increased detector voltage) could bind the 5D3 antibody.
X
ABCG2 p.Cys603Ala 18644784:181:167
status: VERIFIED
Login to comment

184 We found that, in contrast to a 30-40% inhibition found in the case of the wild-type ABCG2, 5D3 did not influence the Hoechst 33342 transport activity of the C592A/C608A and C592A/C603A/C608A mutants (data not shown).
X
ABCG2 p.Cys603Ala 18644784:184:180
status: VERIFIED
Login to comment

186 Effect of DTT on 5D3 Labeling of the Cys-to-Ala Mutants-To test whether decreased 5D3 binding in ABCG2-expressing cells treated with DTT was due to the reduction of the extracellular cysteines, we also examined the effect of DTT on 5D3 labeling of the mutants C603A and C592A/C608A in native or PFA-fixed cells.
X
ABCG2 p.Cys603Ala 18644784:186:260
status: VERIFIED
Login to comment

187 Fig. 6, A and B, shows that DTT is still effective in the reduction of 5D3 binding in the case of the C603A mutant but has practically no effect on 5D3 labeling of the C592A/C608A mutant.
X
ABCG2 p.Cys603Ala 18644784:187:102
status: VERIFIED
Login to comment

199 Interaction of ABCG2 with the 5D3 Monoclonal Antibody SEPTEMBER 19, 200•VOLUME 283•NUMBER 38 JOURNAL OF BIOLOGICAL CHEMISTRY 26065 in 5D3 binding that reached its minimum (almost the fluorescence of the background) at 10-50 mM DTT in ABCG2 and C603A-expressing cells, whereas DTT had no effect on labeling of the C592A/C608A double mutant (Fig. 6C).
X
ABCG2 p.Cys603Ala 18644784:199:259
status: VERIFIED
Login to comment

234 To find out which disulfide bridge is important for epitope formation, we analyzed different Cys-to-Ala mutants lacking the intermolecular (C603A), the intramolecular (C592A, C608A, C592A/C608A), or both kinds of (C592A/C603A, C603A/C608A, or C592A/ C603A/C608A) S-S bonds.
X
ABCG2 p.Cys603Ala 18644784:234:140
status: VERIFIED
X
ABCG2 p.Cys603Ala 18644784:234:220
status: VERIFIED
X
ABCG2 p.Cys603Ala 18644784:234:227
status: VERIFIED
X
ABCG2 p.Cys603Ala 18644784:234:250
status: VERIFIED
Login to comment

235 We found that the C603A mutant behaves similarly to ABCG2 having intact S-S bridges.
X
ABCG2 p.Cys603Ala 18644784:235:18
status: VERIFIED
Login to comment

236 The C603A mutant, which can be expressed in an amount comparable to ABCG2, is found in the plasma membrane (Figs.
X
ABCG2 p.Cys603Ala 18644784:236:4
status: VERIFIED
Login to comment

249 The single mutants, lacking the intramolecular S-S bond, i.e. C592A, C608A, as well as the C592A/C603A/C608A variant, had clearly detectable expression levels, were present in the plasma membrane, and were functional for active transport with somewhat altered substrate specificities (Figs. 4 and 5).
X
ABCG2 p.Cys603Ala 18644784:249:97
status: VERIFIED
Login to comment

PMID: 20622991 [PubMed] Ni Z et al: "Fluorescence resonance energy transfer (FRET) analysis demonstrates dimer/oligomer formation of the human breast cancer resistance protein (BCRP/ABCG2) in intact cells."
No. Sentence Comment
4 Wild-type BCRP and the mutant C603A were attached to cyan or yellow fluorescence protein and expressed in HEK293 cells by transient transfection.
X
ABCG2 p.Cys603Ala 20622991:4:30
status: VERIFIED
Login to comment

7 Wild-type BCRP and C603A were expressed in HEK293 cells at comparable levels.
X
ABCG2 p.Cys603Ala 20622991:7:19
status: VERIFIED
Login to comment

8 C603A was predominantly expressed in the plasma membrane as was wild-type protein.
X
ABCG2 p.Cys603Ala 20622991:8:0
status: VERIFIED
Login to comment

9 Furthermore, C603A retained the same mitoxantrone efflux activity and the ability of dimer/oligmer formation as wild-type BCRP.
X
ABCG2 p.Cys603Ala 20622991:9:13
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:9:30
status: NEW
Login to comment

38 In the present study, we used FRET microscopy to elucidate dimer/oligomer formation of BCRP in HEK293 cells, a method that avoids artificial alterations (e.g., formation or breakdown of disulfide bonds) during biochemical sample preparation. To further understand whether Cys603 plays an important role in dimer/oligomer formation of BCRP, we generated the mutant C603A and investigated the effect of the mutation of Cys603 on dimer/oligomer formation and activity of BCRP.
X
ABCG2 p.Cys603Ala 20622991:38:364
status: VERIFIED
Login to comment

54 Construction of CFP- or YFP-tagged wild-type BCRP or C603A The full length BCRP cDNA fragment was amplified using the pcDNA3.1 plasmid containing full length wild-type BCRP cDNA as a template with a forward primer containing a XhoI site (5`-CTTCGGCTCGAGCTATGTCTTCCAGTAATGTCGAA G-3`) and a reverse primer (5' GTCAGAATCTAGACAAGCTTGGTACCGAGCTCGGATCC-3').
X
ABCG2 p.Cys603Ala 20622991:54:53
status: VERIFIED
Login to comment

56 The resultant YFP-BCRP plasmid was used as a template for PCR mutagenesis to generate the C603A mutant in which Cys603 was replaced with Ala.
X
ABCG2 p.Cys603Ala 20622991:56:90
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:56:112
status: VERIFIED
Login to comment

57 The primers used to generate C603A were 5`- GCAACAGGAAACAATCCTGCTAACTATGCAACATGTAC-3` and 5`- GTACATGTTGCATAGTTAGCAGGATTGTTTCCTGTTGC-3`.
X
ABCG2 p.Cys603Ala 20622991:57:29
status: VERIFIED
Login to comment

58 To generate CFP-tagged wild-type BCRP or C603A, the YFP-BCRP plasmids were digested with XhoI and BamHI, and the DNA fragments containing wild-type and mutant BCRP cDNAs were subcloned into the pECFP-C1 plasmid.
X
ABCG2 p.Cys603Ala 20622991:58:41
status: VERIFIED
Login to comment

60 In these constructs, CFP or YFP was attached to the N-terminus of wild-type BCRP or C603A.
X
ABCG2 p.Cys603Ala 20622991:60:84
status: VERIFIED
Login to comment

65 In this 4 µg of cDNA, an equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs were used at a 1:1 ratio.
X
ABCG2 p.Cys603Ala 20622991:65:84
status: VERIFIED
Login to comment

73 Detection of cell surface expression of wild-type BCRP or C603A The 5D3 antibody recognizes a conformation-sensitive extracellular epitope in BCRP [32].
X
ABCG2 p.Cys603Ala 20622991:73:58
status: VERIFIED
Login to comment

74 Binding of the 5D3 antibody to the surface of cells expressing wild-type BCRP or C603A was examined using flow cytometry as previously described [33].
X
ABCG2 p.Cys603Ala 20622991:74:69
status: NEW
X
ABCG2 p.Cys603Ala 20622991:74:81
status: VERIFIED
Login to comment

79 Flow cytometric efflux assay MX efflux activity of wild-type BCRP or C603A was determined using flow cytometry as previously described [22].
X
ABCG2 p.Cys603Ala 20622991:79:69
status: VERIFIED
Login to comment

82 Then, MX efflux activity of cells expressing wild-type BCRP or C603A was determined as previously described [22].
X
ABCG2 p.Cys603Ala 20622991:82:63
status: VERIFIED
Login to comment

85 FRET microscopy and data analysis HEK293 cells were grown in polystyrene vessels and transiently co-transfected with a total of 1 µg of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors at a 1:1 ratio as described above.
X
ABCG2 p.Cys603Ala 20622991:85:179
status: VERIFIED
Login to comment

107 Results Expression of wild-type BCRP and C603A in HEK293 cells An equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/ YFP control vectors were co-transfected into HEK293 cells, and the expression levels of wild-type and mutant BCRP were examined by immunobloting of whole cell lysates.
X
ABCG2 p.Cys603Ala 20622991:107:41
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:107:44
status: NEW
Login to comment

108 The expression levels of wild-type BCRP and C603A were comparable (Figure 1A), indicating that the expression and/or stability of BCRP was not affected by the mutation of Cys603.
X
ABCG2 p.Cys603Ala 20622991:108:44
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:108:80
status: NEW
X
ABCG2 p.Cys603Ala 20622991:108:145
status: NEW
Login to comment

110 Cell surface expression of wild-type BCRP and C603A We next determined cell surface expression of wild-type BCRP and C603A by measuring binding of the phycoerythrin-conjugated 5D3 to the surface of cells expressing these proteins.
X
ABCG2 p.Cys603Ala 20622991:110:46
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:110:117
status: VERIFIED
Login to comment

112 However, cells expressing wild-type BCRP or C603A demonstrated a significant shift in phycoerythrin fluorescence between the 5D3 and IgG2b treatments (Figure 1B), supporting cell surface expression of wild-type BCRP or C603A, respectively.
X
ABCG2 p.Cys603Ala 20622991:112:44
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:112:45
status: NEW
Login to comment

113 Cellular localization of wild-type BCRP or C603A To determine whether the mutation of Cys603 could affect the plasma membrane localization of BCRP, transfected cells were analyzed using confocal fluorescence microscopy.
X
ABCG2 p.Cys603Ala 20622991:113:43
status: VERIFIED
Login to comment

116 Thus, in the case of wild-type BCRP or C603A, a strong CFP or YFP fluorescence signal or the signal in the merged image was observed primarily on the plasma membrane (Figure 2), suggesting that wild-type BCRP or C603A was predominantly targeted to the plasma membrane of HEK293 cells.
X
ABCG2 p.Cys603Ala 20622991:116:39
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:116:169
status: NEW
X
ABCG2 p.Cys603Ala 20622991:116:213
status: VERIFIED
Login to comment

117 MX efflux activity of wild-type BCRP or C603A We next determined if the mutation of Cys603 affects BCRP efflux activity using a model fluorescent substrate MX.
X
ABCG2 p.Cys603Ala 20622991:117:40
status: VERIFIED
Login to comment

118 Incubation of cells expressing wild-type BCRP or C603A with the BCRP-specific inhibitor FTC resulted in a similarly significant increase in the intracellular MX accumulation compared to that without FTC treatment (data not shown), suggesting that MX is actively effluxed by wild-type BCRP or C603A.
X
ABCG2 p.Cys603Ala 20622991:118:49
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:118:292
status: VERIFIED
Login to comment

119 Thus, the FTC-inhibitable MX efflux activities of wild-type BCRP and C603A were comparable (Figure 3).
X
ABCG2 p.Cys603Ala 20622991:119:69
status: VERIFIED
Login to comment

120 The FTC-inhibitable MX efflux activities of cells expressing only the CFP/YFP pair control were significantly lower than those of the cells expressing wild-type BCRP or C603A (Figure 3).
X
ABCG2 p.Cys603Ala 20622991:120:39
status: NEW
X
ABCG2 p.Cys603Ala 20622991:120:169
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:120:212
status: NEW
Login to comment

121 These results suggest that C603A fully retains MX efflux activity comparable to wild-type protein.
X
ABCG2 p.Cys603Ala 20622991:121:27
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:121:40
status: NEW
Login to comment

122 Detection of dimer/oligomer formation of wild-type BCRP or C603A by FRET analysis We then determined the effect of the mutation of Cys603 on dimer/oligmer formation of BCRP in intact cells using FRET microscopy.
X
ABCG2 p.Cys603Ala 20622991:122:49
status: NEW
X
ABCG2 p.Cys603Ala 20622991:122:59
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:122:292
status: NEW
Login to comment

123 FRET analysis was performed for cells expressing the CFP/YFP pair control, the CFP/YFP-tagged wild-type BCRP or C603A, or CFP alone.
X
ABCG2 p.Cys603Ala 20622991:123:69
status: NEW
X
ABCG2 p.Cys603Ala 20622991:123:112
status: VERIFIED
Login to comment

130 The FRET efficiencies of cells expressing CFP/YFP-tagged C603A were comparable to those of cells expressing CFP/YFP-tagged wild-type BCRP, suggesting that C603A retained the same ability to form a dimer/ oligomer as wild-type protein.
X
ABCG2 p.Cys603Ala 20622991:130:57
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:130:59
status: NEW
Login to comment

131 Chemical cross-linking To further confirm if the monomers of wild-type BCRP or C603A exist in close proximity in intact cells, we performed chemical cross-linking experiments using the homobifunctional amine-reactive cross-linker DSS (11.4 Å arm length) on intact cells expressing these proteins.
X
ABCG2 p.Cys603Ala 20622991:131:79
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:131:113
status: NEW
Login to comment

132 Either wild-type BCRP or C603A could be cross-linked as indicated by the appearance of higher molecule mass bands corresponding to dimers and oligomers of the 95 kDa CFP/YFP-tagged BCRP or C603A (Figure 5).
X
ABCG2 p.Cys603Ala 20622991:132:25
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:132:189
status: VERIFIED
Login to comment

135 This approach allows us to elucidate dimer/ oligomer formation of BCRP in a native cellular membrane environment without the need of biochemical sample preparation. To perform the FRET assay, the fluorescent protein CFP or YFP was attached to the N-terminal end of wild-type BCRP or the mutant C603A.
X
ABCG2 p.Cys603Ala 20622991:135:294
status: VERIFIED
Login to comment

142 With this method, we estimated the FRET efficiencies of intact cells expressing CFP/YFP-tagged wild-type BCRP or C603A, the CFP/YFP pair control or CFP alone.
X
ABCG2 p.Cys603Ala 20622991:142:71
status: NEW
X
ABCG2 p.Cys603Ala 20622991:142:113
status: VERIFIED
Login to comment

148 Ala substitution of Cys603 did not deteriorate expression, plasma membrane localization, and activity of BCRP in HEK293 cells (Figs. 1 - 3), which is in good agreement with previous studies [18,24,25].
X
ABCG2 p.Cys603Ala 20622991:148:0
status: VERIFIED
Login to comment

150 This conclusion was obtained by the demonstration that wild-type BCRP migrated as a band of approximately double the size of a BCRP monomer under non-reducing conditions; however, after Cys603 was mutated to Ala, the C603A mutant migrated as a single monomeric band [18,23,24].
X
ABCG2 p.Cys603Ala 20622991:150:91
status: NEW
X
ABCG2 p.Cys603Ala 20622991:150:186
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:150:217
status: VERIFIED
Login to comment

151 Nevertheless, at least one study [23] showed that a substantial amount of C603A and other mutants at position Cys603 remained as dimers under non-reducing conditions. It is worth noting that the observation of dimer/oligomer formation of BCRP via intermolecular disulfide bonds has so far been reported all using in vitro biochemical methods such as immunoblotting under nonreducing conditions. It is possible that oxidation during biochemical sample preparation may cause formation of intermolecular disulfide bridges or disulfide bonds may be disrupted in the process of cell lysis or sample preparation involving solubilization of membrane proteins with detergents.
X
ABCG2 p.Cys603Ala 20622991:151:74
status: VERIFIED
Login to comment

153 We found that the FRET efficiency of CFP/YFP-tagged C603A was the same as that of CFP/YFP-tagged wild-type BCRP (Figure 4), suggesting that Ala substitution of Cys603 does not affect the ability of BCRP to form a dimer/oligomer.
X
ABCG2 p.Cys603Ala 20622991:153:52
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:153:140
status: VERIFIED
X
ABCG2 p.Cys603Ala 20622991:153:293
status: NEW
Login to comment

154 Chemical cross-linking experiments also indicate that CFP/YFP-tagged C603A molecules may exist in cells in close proximity (Figure 5).
X
ABCG2 p.Cys603Ala 20622991:154:69
status: VERIFIED
Login to comment

155 Given the fact that C603A retained full expression, plasma membrane targeting, and MX efflux activity comparable to wild-type protein (Figure 1-3), we would argue that the intermolecular disulfide bond formed by Cys603 alone may not be essential for dimerization or oligomerization of BCRP in vivo.
X
ABCG2 p.Cys603Ala 20622991:155:20
status: VERIFIED
Login to comment

12 Wild-type BCRP and C603A were expressed in HEK293 cells at comparable levels.
X
ABCG2 p.Cys603Ala 20622991:12:19
status: NEW
Login to comment

13 C603A was predominantly expressed in the plasma membrane as was wild-type protein.
X
ABCG2 p.Cys603Ala 20622991:13:0
status: NEW
Login to comment

14 Furthermore, C603A retained the same mitoxantrone efflux activity and the ability of dimer/ oligmer formation as wild-type BCRP.
X
ABCG2 p.Cys603Ala 20622991:14:13
status: NEW
Login to comment

33 In the present study, we used FRET microscopy to elucidate dimer/oligomer formation of BCRP in HEK293 cells, a method that avoids artificial alterations (e.g., formation or breakdown of disulfide bonds) during biochemical sample preparation. To further understand whether Cys603 plays an important role in dimer/oligomer formation of BCRP, we generated the mutant C603A and investigated the effect of the mutation of Cys603 on dimer/oligomer formation and activity of BCRP.
X
ABCG2 p.Cys603Ala 20622991:33:364
status: NEW
Login to comment

49 Construction of CFP- or YFP-tagged wild-type BCRP or C603A The full length BCRP cDNA fragment was amplified using the pcDNA3.1 plasmid containing full length wild-type BCRP cDNA as a template with a forward primer containing a XhoI site (5`- CTTCGGCTCGAGCTATGTCTTCCAGTAATGTCGAA G-3`) and a reverse primer (5' GTCAGAATCTA- GACAAGCTTGGTACCGAGCTCGGATCC-3').
X
ABCG2 p.Cys603Ala 20622991:49:53
status: NEW
Login to comment

51 The resultant YFP-BCRP plasmid was used as a template for PCR mutagenesis to generate the C603A mutant in which Cys603 was replaced with Ala.
X
ABCG2 p.Cys603Ala 20622991:51:90
status: NEW
X
ABCG2 p.Cys603Ala 20622991:51:112
status: NEW
Login to comment

52 The primers used to generate C603A were 5`-GCAACAGGAAACAATCCTGCTAACTATGCA ACATGTAC-3` and 5`-GTACATGTTGCATAGTTAGCA GGATTGTTTCCTGTTGC-3`.
X
ABCG2 p.Cys603Ala 20622991:52:29
status: NEW
Login to comment

53 To generate CFP-tagged wild-type BCRP or C603A, the YFP-BCRP plasmids were digested with XhoI and BamHI, and the DNA fragments containing wild-type and mutant BCRP cDNAs were subcloned into the pECFP-C1 plasmid.
X
ABCG2 p.Cys603Ala 20622991:53:41
status: NEW
Login to comment

55 In these constructs, CFP or YFP was attached to the N-terminus of wild-type BCRP or C603A.
X
ABCG2 p.Cys603Ala 20622991:55:84
status: NEW
Login to comment

68 Detection of cell surface expression of wild-type BCRP or C603A The 5D3 antibody recognizes a conformation-sensitive extracellular epitope in BCRP [32].
X
ABCG2 p.Cys603Ala 20622991:68:58
status: NEW
Login to comment

69 Binding of the 5D3 antibody to the surface of cells expressing wild-type BCRP or C603A was examined using flow cytometry as previously described [33].
X
ABCG2 p.Cys603Ala 20622991:69:81
status: NEW
Login to comment

77 Then, MX efflux activity of cells expressing wild-type BCRP or C603A was determined as previously described [22].
X
ABCG2 p.Cys603Ala 20622991:77:63
status: NEW
Login to comment

80 FRET microscopy and data analysis HEK293 cells were grown in polystyrene vessels and transiently co-transfected with a total of 1 µg of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors at a 1:1 ratio as described above.
X
ABCG2 p.Cys603Ala 20622991:80:179
status: NEW
Login to comment

102 Results Expression of wild-type BCRP and C603A in HEK293 cells An equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors were co-transfected into HEK293 cells, and the expression levels of wild-type and mutant BCRP were examined by immunobloting of whole cell lysates.
X
ABCG2 p.Cys603Ala 20622991:102:41
status: NEW
X
ABCG2 p.Cys603Ala 20622991:102:120
status: NEW
Login to comment

103 The expression levels of wild-type BCRP and C603A were comparable (Figure 1A), indicating that the expression and/ or stability of BCRP was not affected by the mutation of Cys603.
X
ABCG2 p.Cys603Ala 20622991:103:44
status: NEW
Login to comment

105 Cell surface expression of wild-type BCRP and C603A We next determined cell surface expression of wild-type BCRP and C603A by measuring binding of the phycoerythrin-conjugated 5D3 to the surface of cells expressing these proteins.
X
ABCG2 p.Cys603Ala 20622991:105:46
status: NEW
X
ABCG2 p.Cys603Ala 20622991:105:117
status: NEW
Login to comment

109 A, whole cell lysates (20 μg of protein each lane) prepared from HEK293 cells transiently transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors were immunoblotted as described.
X
ABCG2 p.Cys603Ala 20622991:109:146
status: NEW
Login to comment

115 The histograms for CFP/YFP, wild-type BCRP, and C603A are indicated above the graphs.
X
ABCG2 p.Cys603Ala 20622991:115:48
status: NEW
Login to comment

125 Confocal fluorescence images of HEK293 cells co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNAs. HEK293 cells were co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors and processed for confocal fluorescence microscope analysis as described.
X
ABCG2 p.Cys603Ala 20622991:125:98
status: NEW
X
ABCG2 p.Cys603Ala 20622991:125:182
status: NEW
Login to comment

127 Images for CFP/YFP, wild-type BCRP, and C603A are indicated on the left.
X
ABCG2 p.Cys603Ala 20622991:127:40
status: NEW
Login to comment

128 the cells expressing wild-type BCRP or C603A (Figure 3).
X
ABCG2 p.Cys603Ala 20622991:128:39
status: NEW
Login to comment

129 These results suggest that C603A fully retains MX efflux activity comparable to wild-type protein.
X
ABCG2 p.Cys603Ala 20622991:129:27
status: NEW
Login to comment

138 The FRET efficiencies of cells expressing CFP/ YFP-tagged C603A were comparable to those of cells expressing CFP/YFP-tagged wild-type BCRP, suggesting that C603A retained the same ability to form a dimer/oligomer as wild-type protein.
X
ABCG2 p.Cys603Ala 20622991:138:58
status: NEW
X
ABCG2 p.Cys603Ala 20622991:138:156
status: NEW
Login to comment

139 Chemical cross-linking To further confirm if the monomers of wild-type BCRP or C603A exist in close proximity in intact cells, we performed chemical cross-linking experiments using the homobifunctional amine-reactive cross-linker DSS (11.4 Å arm length) on intact cells expressing these proteins.
X
ABCG2 p.Cys603Ala 20622991:139:79
status: NEW
Login to comment

140 Either wild-type BCRP or C603A could be cross-linked as indicated by the appearance of higher mole- Figure 3.
X
ABCG2 p.Cys603Ala 20622991:140:25
status: NEW
Login to comment

141 FTC-inhibitable MX efflux activities of wild-type BCRP and C603A.
X
ABCG2 p.Cys603Ala 20622991:141:59
status: NEW
Login to comment

147 FRET efficiencies of cells co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNAs. HEK293 cells were co-transfected with CFP/ YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors or the CFP vector alone and processed for determining FRET efficiencies as described.
X
ABCG2 p.Cys603Ala 20622991:147:80
status: NEW
X
ABCG2 p.Cys603Ala 20622991:147:165
status: NEW
Login to comment

160 With this method, we estimated the FRET efficiencies of intact cells expressing CFP/YFP-tagged wild-type BCRP or C603A, the CFP/YFP pair control or CFP alone.
X
ABCG2 p.Cys603Ala 20622991:160:113
status: NEW
Login to comment

166 Ala substitution of Cys603 did not deteriorate expression, plasma membrane localization, and activity of BCRP in HEK293 cells (Figs. 1 - 3), which is in good agreement with previous studies [18, 24, 25].
X
ABCG2 p.Cys603Ala 20622991:166:0
status: NEW
Login to comment

168 This conclusion was obtained by the demonstration that wild-type BCRP migrated as a band of approximately double the size of a BCRP monomer under non-reducing conditions; however, after Cys603 was mutated to Ala, the C603A mutant migrated as a single monomeric band [18, 23, 24].
X
ABCG2 p.Cys603Ala 20622991:168:186
status: NEW
X
ABCG2 p.Cys603Ala 20622991:168:217
status: NEW
Login to comment

171 Chemical cross-linking of wild-type BCRP or C603A on intact cells using DSS was described in the Materials and Methods section.
X
ABCG2 p.Cys603Ala 20622991:171:44
status: NEW
Login to comment

172 Whole cell lysates prepared from HEK293 cells transiently transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors were immunoblotted using the mAb BXP-21 as described.
X
ABCG2 p.Cys603Ala 20622991:172:108
status: NEW
Login to comment

173 The constructs (CFP/YFP, wild-type BCRP, and C603A) are indicated below the blot.
X
ABCG2 p.Cys603Ala 20622991:173:45
status: NEW
Login to comment

174 As indicated with arrows, the molecular weight of CFP/YFP-tagged wild-type BCRP or C603A monomer is approximately 95 kDa.
X
ABCG2 p.Cys603Ala 20622991:174:83
status: NEW
Login to comment

175 substantial amount of C603A and other mutants at position Cys603 remained as dimers under non-reducing conditions. It is worth noting that the observation of dimer/oligomer formation of BCRP via intermolecular disulfide bonds has so far been reported all using in vitro biochemical methods such as immunoblotting under non-reducing conditions. It is possible that oxidation during biochemical sample preparation may cause formation of intermolecular disulfide bridges or disulfide bonds may be disrupted in the process of cell lysis or sample preparation involving solubilization of membrane proteins with detergents.
X
ABCG2 p.Cys603Ala 20622991:175:22
status: NEW
Login to comment

177 We found that the FRET efficiency of CFP/YFP-tagged C603A was the same as that of CFP/YFP -tagged wild-type BCRP (Figure 4), suggesting that Ala substitution of Cys603 does not affect the ability of BCRP to form a dimer/oligomer.
X
ABCG2 p.Cys603Ala 20622991:177:52
status: NEW
X
ABCG2 p.Cys603Ala 20622991:177:141
status: NEW
Login to comment

178 Chemical cross-linking experiments also indicate that CFP/YFP-tagged C603A molecules may exist in cells in close proximity (Figure 5).
X
ABCG2 p.Cys603Ala 20622991:178:69
status: NEW
Login to comment

179 Given the fact that C603A retained full expression, plasma membrane targeting, and MX efflux activity comparable to wild-type protein (Figure 1-3), we would argue that the intermolecular disulfide bond formed by Cys603 alone may not be essential for dimerization or oligomerization of BCRP in vivo.
X
ABCG2 p.Cys603Ala 20622991:179:20
status: NEW
Login to comment

PMID: 20705604 [PubMed] Desuzinges-Mandon E et al: "ABCG2 transports and transfers heme to albumin through its large extracellular loop."
No. Sentence Comment
6 Single-point mutations H583A and C603A inside ECL3 prevent the binding of hemin but hardly affect that of iron-free PPIX.
X
ABCG2 p.Cys603Ala 20705604:6:33
status: VERIFIED
Login to comment

70 The single-point mutations H598A, C603A, and Y608A were introduced by site-directed mutagenesis using the corresponding primers displayed in Table 1.
X
ABCG2 p.Cys603Ala 20705604:70:34
status: VERIFIED
Login to comment

220 Single-point Mutations H583A and C603A of ECL3 Alter Hemin Binding-We noticed that ECL3 displays a significant sequence similarity with the heme-binding domain of cytochrome b5, with 14.3% identity and 15.6% similarity, as shown in Fig. 6A.
X
ABCG2 p.Cys603Ala 20705604:220:33
status: VERIFIED
Login to comment

224 As shown, the most striking differences were observed for hemin binding because the H583A and C603A mutations lowered the binding affinity 5-6-fold.
X
ABCG2 p.Cys603Ala 20705604:224:94
status: VERIFIED
Login to comment

245 B, dissociation constants for hemin and PPIX binding to H583A, C603A, and Y605A mutant ECL3.
X
ABCG2 p.Cys603Ala 20705604:245:63
status: VERIFIED
Login to comment

278 Heme and hemin appear to be the preferred ligands, because (i) they display the highest binding affinities for both the isolated ECL3 domain (0.5-1 ␮M) and the full-length ABCG2 transporter (0.2 ␮M); (ii) the H583A and C603A single-point mutations alter more markedly the binding of hemin than that of metal-free corresponding PPIX; and (iii) pheophorbide a, which is transported by ABCG2 (26), displays a low binding affinity for ECL3 (3 ␮M), which is even lower for the full protein (Ͼ8 ␮M) when saturated with MTX or doxorubicin, suggesting that pheophorbide a will not bind to ECL3 under physiological conditions.
X
ABCG2 p.Cys603Ala 20705604:278:233
status: VERIFIED
Login to comment

PMID: 20812902 [PubMed] Ni Z et al: "Structure and function of the human breast cancer resistance protein (BCRP/ABCG2)."
No. Sentence Comment
138 The recent study using FRET and chemical cross-linking also revealed that Ala substitution of Cys603 had no any effect on dimer/oligomer formation of BCRP in vivo in intact cells [80].
X
ABCG2 p.Cys603Ala 20812902:138:74
status: VERIFIED
Login to comment

310 Ala substitution of Cys603 led to migration of BCRP bands to a size corresponding to BCRP monomers, but had no effect on plasma membrane expression and function, suggesting that Cys603 participates in intermolecular disulfide bond formation.
X
ABCG2 p.Cys603Ala 20812902:310:0
status: VERIFIED
Login to comment

PMID: 21991363 [PubMed] Haider AJ et al: "Dimerization of ABCG2 analysed by bimolecular fluorescence complementation."
No. Sentence Comment
86 Primer Sequence 59-39 Restriction site Purpose EYFPG2F CCTGTATTTTCAGGAATTCTATGTCTTCCAG EcoRI Generation of ABCG2 tagged N-terminally with complete eYFP YFPG2R GCTTGGTACCGATCTAGAATCCAATTTAAGAATA XbaI Common reverse primer for tagging ABCG2 N-terminally with fragments of vYFP or with complete eYFP VYFPG2F CCTGTATTTTCAGGAATTCATGTCTTCCAG EcoRI Generation of ABCG2 tagged N-terminally with vYFP fragments G2YFPF CCTGTATTTTCAGGGATCCATGTCTTCCAG BamHI Generation of ABCG2 with C-terminal vYFP fragments G2YFPR GAGCTCGGATCCCTCGAGAGAATATTTTTTAAG XhoI Generation of ABCG2 with C-terminal vYFP fragments E211QF ATCTTGTTCTTGGATCAACCTACAACAGGCTTAGACTCAAG n/a Mutating E211Q C603AF ACAGGAAACAATCCGGCCAACTATGCAACATGTACT n/a Mutating C603A doi:10.1371/journal.pone.0025818.t001 USA, [23]).
X
ABCG2 p.Cys603Ala 21991363:86:719
status: NEW
Login to comment

151 A second mutation, C603A, was introduced to prevent the inter-dimer disulphide bond that has been shown to be necessary for homodimer formation on non-denaturing SDS-PAGE, but which is not required for function [13,15].
X
ABCG2 p.Cys603Ala 21991363:151:19
status: NEW
Login to comment

153 All three constructs (WT, E211Q and C603A) showed BiFC (Figure 6B-D respectively) producing a fluorescence signal far in excess of the background observed with a single transfection (Figure 6A).
X
ABCG2 p.Cys603Ala 21991363:153:36
status: NEW
Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
226 The substitution of Cys603 by Ala caused the transporter to migrate electrophoretically as a monomer, which is not the case when substituting Cys592 or Cys608 by Ala.
X
ABCG2 p.Cys603Ala 25036722:226:20
status: NEW
Login to comment