ABCMdb

PMID: 21991363

Haider AJ, Briggs D, Self TJ, Chilvers HL, Holliday ND, Kerr ID
Dimerization of ABCG2 analysed by bimolecular fluorescence complementation.
PLoS One. 2011;6(10):e25818. Epub 2011 Oct 3., [PubMed]

Sentences

No. Mutations Sentence Comment

86 ABCG2 p.Cys603Ala ABCG2 p.Glu211Gln Primer Sequence 59-39 Restriction site Purpose EYFPG2F CCTGTATTTTCAGGAATTCTATGTCTTCCAG EcoRI Generation of ABCG2 tagged N-terminally with complete eYFP YFPG2R GCTTGGTACCGATCTAGAATCCAATTTAAGAATA XbaI Common reverse primer for tagging ABCG2 N-terminally with fragments of vYFP or with complete eYFP VYFPG2F CCTGTATTTTCAGGAATTCATGTCTTCCAG EcoRI Generation of ABCG2 tagged N-terminally with vYFP fragments G2YFPF CCTGTATTTTCAGGGATCCATGTCTTCCAG BamHI Generation of ABCG2 with C-terminal vYFP fragments G2YFPR GAGCTCGGATCCCTCGAGAGAATATTTTTTAAG XhoI Generation of ABCG2 with C-terminal vYFP fragments E211QF ATCTTGTTCTTGGATCAACCTACAACAGGCTTAGACTCAAG n/a Mutating E211Q C603AF ACAGGAAACAATCCGGCCAACTATGCAACATGTACT n/a Mutating C603A doi:10.1371/journal.pone.0025818.t001 USA, [23]). Login to comment 141 ABCG2 p.Glu211Gln Mutation of the conserved Walker-B glutamate residues (in ABCG2 this corresponds to the mutation E211Q) has been shown in numerous in vitro and structural investigations of other ABC proteins to result in the tighter apposition of the 2 NBDs with concomitant, irreversible Figure 4. Login to comment 151 ABCG2 p.Cys603Ala A second mutation, C603A, was introduced to prevent the inter-dimer disulphide bond that has been shown to be necessary for homodimer formation on non-denaturing SDS-PAGE, but which is not required for function [13,15]. Login to comment 153 ABCG2 p.Cys603Ala ABCG2 p.Glu211Gln All three constructs (WT, E211Q and C603A) showed BiFC (Figure 6B-D respectively) producing a fluorescence signal far in excess of the background observed with a single transfection (Figure 6A). Login to comment 156 ABCG2 p.Glu211Gln Although the percentage of cells showing BiFC was greater for the E211Q mutant - which might be expected to form a stronger dimer - this was not statistically significant by ANOVA. Login to comment 164 ABCG2 p.Gly406Leu ABCG2 p.Gly410Leu ABCG2 p.Thr402Leu However, it remains possible that the effects of multiple mutations to a predicted interfacial site could be detected by BiFC, e.g. the surface of helix TM1 which contains a T402L/G406L/G410L dimerization motif [17]. Login to comment