PMID: 20622991

Ni Z, Mark ME, Cai X, Mao Q
Fluorescence resonance energy transfer (FRET) analysis demonstrates dimer/oligomer formation of the human breast cancer resistance protein (BCRP/ABCG2) in intact cells.
Int J Biochem Mol Biol. 2010;1(1):1-11., [PubMed]
Sentences
No. Mutations Sentence Comment
4 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:4:30
status: VERIFIED
view ABCG2 p.Cys603Ala details
Wild-type BCRP and the mutant C603A were attached to cyan or yellow fluorescence protein and expressed in HEK293 cells by transient transfection. Login to comment
7 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:7:19
status: VERIFIED
view ABCG2 p.Cys603Ala details
Wild-type BCRP and C603A were expressed in HEK293 cells at comparable levels. Login to comment
8 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:8:0
status: VERIFIED
view ABCG2 p.Cys603Ala details
C603A was predominantly expressed in the plasma membrane as was wild-type protein. Login to comment
9 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:9:13
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:9:30
status: NEW
view ABCG2 p.Cys603Ala details
Furthermore, C603A retained the same mitoxantrone efflux activity and the ability of dimer/oligmer formation as wild-type BCRP. Login to comment
12 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:12:19
status: NEW
view ABCG2 p.Cys603Ala details
Wild-type BCRP and C603A were expressed in HEK293 cells at comparable levels. Login to comment
13 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:13:0
status: NEW
view ABCG2 p.Cys603Ala details
C603A was predominantly expressed in the plasma membrane as was wild-type protein. Login to comment
14 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:14:13
status: NEW
view ABCG2 p.Cys603Ala details
Furthermore, C603A retained the same mitoxantrone efflux activity and the ability of dimer/ oligmer formation as wild-type BCRP. Login to comment
33 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:33:364
status: NEW
view ABCG2 p.Cys603Ala details
In the present study, we used FRET microscopy to elucidate dimer/oligomer formation of BCRP in HEK293 cells, a method that avoids artificial alterations (e.g., formation or breakdown of disulfide bonds) during biochemical sample preparation. To further understand whether Cys603 plays an important role in dimer/oligomer formation of BCRP, we generated the mutant C603A and investigated the effect of the mutation of Cys603 on dimer/oligomer formation and activity of BCRP. Login to comment
38 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:38:364
status: VERIFIED
view ABCG2 p.Cys603Ala details
In the present study, we used FRET microscopy to elucidate dimer/oligomer formation of BCRP in HEK293 cells, a method that avoids artificial alterations (e.g., formation or breakdown of disulfide bonds) during biochemical sample preparation. To further understand whether Cys603 plays an important role in dimer/oligomer formation of BCRP, we generated the mutant C603A and investigated the effect of the mutation of Cys603 on dimer/oligomer formation and activity of BCRP. Login to comment
49 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:49:53
status: NEW
view ABCG2 p.Cys603Ala details
Construction of CFP- or YFP-tagged wild-type BCRP or C603A The full length BCRP cDNA fragment was amplified using the pcDNA3.1 plasmid containing full length wild-type BCRP cDNA as a template with a forward primer containing a XhoI site (5`- CTTCGGCTCGAGCTATGTCTTCCAGTAATGTCGAA G-3`) and a reverse primer (5' GTCAGAATCTA- GACAAGCTTGGTACCGAGCTCGGATCC-3'). Login to comment
51 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:51:90
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:51:112
status: NEW
view ABCG2 p.Cys603Ala details
The resultant YFP-BCRP plasmid was used as a template for PCR mutagenesis to generate the C603A mutant in which Cys603 was replaced with Ala. Login to comment
52 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:52:29
status: NEW
view ABCG2 p.Cys603Ala details
The primers used to generate C603A were 5`-GCAACAGGAAACAATCCTGCTAACTATGCA ACATGTAC-3` and 5`-GTACATGTTGCATAGTTAGCA GGATTGTTTCCTGTTGC-3`. Login to comment
53 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:53:41
status: NEW
view ABCG2 p.Cys603Ala details
To generate CFP-tagged wild-type BCRP or C603A, the YFP-BCRP plasmids were digested with XhoI and BamHI, and the DNA fragments containing wild-type and mutant BCRP cDNAs were subcloned into the pECFP-C1 plasmid. Login to comment
54 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:54:53
status: VERIFIED
view ABCG2 p.Cys603Ala details
Construction of CFP- or YFP-tagged wild-type BCRP or C603A The full length BCRP cDNA fragment was amplified using the pcDNA3.1 plasmid containing full length wild-type BCRP cDNA as a template with a forward primer containing a XhoI site (5`-CTTCGGCTCGAGCTATGTCTTCCAGTAATGTCGAA G-3`) and a reverse primer (5' GTCAGAATCTAGACAAGCTTGGTACCGAGCTCGGATCC-3'). Login to comment
55 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:55:84
status: NEW
view ABCG2 p.Cys603Ala details
In these constructs, CFP or YFP was attached to the N-terminus of wild-type BCRP or C603A. Login to comment
56 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:56:90
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:56:112
status: VERIFIED
view ABCG2 p.Cys603Ala details
The resultant YFP-BCRP plasmid was used as a template for PCR mutagenesis to generate the C603A mutant in which Cys603 was replaced with Ala. Login to comment
57 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:57:29
status: VERIFIED
view ABCG2 p.Cys603Ala details
The primers used to generate C603A were 5`- GCAACAGGAAACAATCCTGCTAACTATGCAACATGTAC-3` and 5`- GTACATGTTGCATAGTTAGCAGGATTGTTTCCTGTTGC-3`. Login to comment
58 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:58:41
status: VERIFIED
view ABCG2 p.Cys603Ala details
To generate CFP-tagged wild-type BCRP or C603A, the YFP-BCRP plasmids were digested with XhoI and BamHI, and the DNA fragments containing wild-type and mutant BCRP cDNAs were subcloned into the pECFP-C1 plasmid. Login to comment
60 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:60:84
status: VERIFIED
view ABCG2 p.Cys603Ala details
In these constructs, CFP or YFP was attached to the N-terminus of wild-type BCRP or C603A. Login to comment
65 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:65:84
status: VERIFIED
view ABCG2 p.Cys603Ala details
In this 4 µg of cDNA, an equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs were used at a 1:1 ratio. Login to comment
68 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:68:58
status: NEW
view ABCG2 p.Cys603Ala details
Detection of cell surface expression of wild-type BCRP or C603A The 5D3 antibody recognizes a conformation-sensitive extracellular epitope in BCRP [32]. Login to comment
69 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:69:81
status: NEW
view ABCG2 p.Cys603Ala details
Binding of the 5D3 antibody to the surface of cells expressing wild-type BCRP or C603A was examined using flow cytometry as previously described [33]. Login to comment
73 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:73:58
status: VERIFIED
view ABCG2 p.Cys603Ala details
Detection of cell surface expression of wild-type BCRP or C603A The 5D3 antibody recognizes a conformation-sensitive extracellular epitope in BCRP [32]. Login to comment
74 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:74:69
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:74:81
status: VERIFIED
view ABCG2 p.Cys603Ala details
Binding of the 5D3 antibody to the surface of cells expressing wild-type BCRP or C603A was examined using flow cytometry as previously described [33]. Login to comment
77 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:77:63
status: NEW
view ABCG2 p.Cys603Ala details
Then, MX efflux activity of cells expressing wild-type BCRP or C603A was determined as previously described [22]. Login to comment
79 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:79:69
status: VERIFIED
view ABCG2 p.Cys603Ala details
Flow cytometric efflux assay MX efflux activity of wild-type BCRP or C603A was determined using flow cytometry as previously described [22]. Login to comment
80 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:80:179
status: NEW
view ABCG2 p.Cys603Ala details
FRET microscopy and data analysis HEK293 cells were grown in polystyrene vessels and transiently co-transfected with a total of 1 µg of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors at a 1:1 ratio as described above. Login to comment
82 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:82:63
status: VERIFIED
view ABCG2 p.Cys603Ala details
Then, MX efflux activity of cells expressing wild-type BCRP or C603A was determined as previously described [22]. Login to comment
85 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:85:179
status: VERIFIED
view ABCG2 p.Cys603Ala details
FRET microscopy and data analysis HEK293 cells were grown in polystyrene vessels and transiently co-transfected with a total of 1 µg of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors at a 1:1 ratio as described above. Login to comment
102 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:102:41
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:102:120
status: NEW
view ABCG2 p.Cys603Ala details
Results Expression of wild-type BCRP and C603A in HEK293 cells An equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors were co-transfected into HEK293 cells, and the expression levels of wild-type and mutant BCRP were examined by immunobloting of whole cell lysates. Login to comment
103 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:103:44
status: NEW
view ABCG2 p.Cys603Ala details
The expression levels of wild-type BCRP and C603A were comparable (Figure 1A), indicating that the expression and/ or stability of BCRP was not affected by the mutation of Cys603. Login to comment
105 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:105:46
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:105:117
status: NEW
view ABCG2 p.Cys603Ala details
Cell surface expression of wild-type BCRP and C603A We next determined cell surface expression of wild-type BCRP and C603A by measuring binding of the phycoerythrin-conjugated 5D3 to the surface of cells expressing these proteins. Login to comment
107 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:107:41
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:107:44
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:107:120
status: VERIFIED
view ABCG2 p.Cys603Ala details
Results Expression of wild-type BCRP and C603A in HEK293 cells An equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/ YFP control vectors were co-transfected into HEK293 cells, and the expression levels of wild-type and mutant BCRP were examined by immunobloting of whole cell lysates. Login to comment
108 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:108:44
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:108:80
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:108:145
status: NEW
view ABCG2 p.Cys603Ala details
The expression levels of wild-type BCRP and C603A were comparable (Figure 1A), indicating that the expression and/or stability of BCRP was not affected by the mutation of Cys603. Login to comment
109 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:109:146
status: NEW
view ABCG2 p.Cys603Ala details
A, whole cell lysates (20 μg of protein each lane) prepared from HEK293 cells transiently transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors were immunoblotted as described. Login to comment
110 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:110:46
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:110:117
status: VERIFIED
view ABCG2 p.Cys603Ala details
Cell surface expression of wild-type BCRP and C603A We next determined cell surface expression of wild-type BCRP and C603A by measuring binding of the phycoerythrin-conjugated 5D3 to the surface of cells expressing these proteins. Login to comment
112 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:112:44
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:112:45
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:112:219
status: VERIFIED
view ABCG2 p.Cys603Ala details
However, cells expressing wild-type BCRP or C603A demonstrated a significant shift in phycoerythrin fluorescence between the 5D3 and IgG2b treatments (Figure 1B), supporting cell surface expression of wild-type BCRP or C603A, respectively. Login to comment
113 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:113:43
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:113:45
status: NEW
view ABCG2 p.Cys603Ala details
Cellular localization of wild-type BCRP or C603A To determine whether the mutation of Cys603 could affect the plasma membrane localization of BCRP, transfected cells were analyzed using confocal fluorescence microscopy. Login to comment
115 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:115:48
status: NEW
view ABCG2 p.Cys603Ala details
The histograms for CFP/YFP, wild-type BCRP, and C603A are indicated above the graphs. Login to comment
116 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:116:39
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:116:169
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:116:213
status: VERIFIED
view ABCG2 p.Cys603Ala details
Thus, in the case of wild-type BCRP or C603A, a strong CFP or YFP fluorescence signal or the signal in the merged image was observed primarily on the plasma membrane (Figure 2), suggesting that wild-type BCRP or C603A was predominantly targeted to the plasma membrane of HEK293 cells. Login to comment
117 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:117:40
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:117:43
status: NEW
view ABCG2 p.Cys603Ala details
MX efflux activity of wild-type BCRP or C603A We next determined if the mutation of Cys603 affects BCRP efflux activity using a model fluorescent substrate MX. Login to comment
118 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:118:49
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:118:292
status: VERIFIED
view ABCG2 p.Cys603Ala details
Incubation of cells expressing wild-type BCRP or C603A with the BCRP-specific inhibitor FTC resulted in a similarly significant increase in the intracellular MX accumulation compared to that without FTC treatment (data not shown), suggesting that MX is actively effluxed by wild-type BCRP or C603A. Login to comment
119 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:119:69
status: VERIFIED
view ABCG2 p.Cys603Ala details
Thus, the FTC-inhibitable MX efflux activities of wild-type BCRP and C603A were comparable (Figure 3). Login to comment
120 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:120:39
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:120:169
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:120:212
status: NEW
view ABCG2 p.Cys603Ala details
The FTC-inhibitable MX efflux activities of cells expressing only the CFP/YFP pair control were significantly lower than those of the cells expressing wild-type BCRP or C603A (Figure 3). Login to comment
121 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:121:27
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:121:40
status: NEW
view ABCG2 p.Cys603Ala details
These results suggest that C603A fully retains MX efflux activity comparable to wild-type protein. Login to comment
122 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:122:49
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:122:59
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:122:292
status: NEW
view ABCG2 p.Cys603Ala details
Detection of dimer/oligomer formation of wild-type BCRP or C603A by FRET analysis We then determined the effect of the mutation of Cys603 on dimer/oligmer formation of BCRP in intact cells using FRET microscopy. Login to comment
123 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:123:69
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:123:112
status: VERIFIED
view ABCG2 p.Cys603Ala details
FRET analysis was performed for cells expressing the CFP/YFP pair control, the CFP/YFP-tagged wild-type BCRP or C603A, or CFP alone. Login to comment
125 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:125:98
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:125:182
status: NEW
view ABCG2 p.Cys603Ala details
Confocal fluorescence images of HEK293 cells co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNAs. HEK293 cells were co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors and processed for confocal fluorescence microscope analysis as described. Login to comment
127 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:127:40
status: NEW
view ABCG2 p.Cys603Ala details
Images for CFP/YFP, wild-type BCRP, and C603A are indicated on the left. Login to comment
128 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:128:39
status: NEW
view ABCG2 p.Cys603Ala details
the cells expressing wild-type BCRP or C603A (Figure 3). Login to comment
129 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:129:27
status: NEW
view ABCG2 p.Cys603Ala details
These results suggest that C603A fully retains MX efflux activity comparable to wild-type protein. Login to comment
130 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:130:57
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:130:59
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:130:155
status: VERIFIED
view ABCG2 p.Cys603Ala details
The FRET efficiencies of cells expressing CFP/YFP-tagged C603A were comparable to those of cells expressing CFP/YFP-tagged wild-type BCRP, suggesting that C603A retained the same ability to form a dimer/ oligomer as wild-type protein. Login to comment
131 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:131:79
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:131:113
status: NEW
view ABCG2 p.Cys603Ala details
Chemical cross-linking To further confirm if the monomers of wild-type BCRP or C603A exist in close proximity in intact cells, we performed chemical cross-linking experiments using the homobifunctional amine-reactive cross-linker DSS (11.4 Å arm length) on intact cells expressing these proteins. Login to comment
132 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:132:25
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:132:189
status: VERIFIED
view ABCG2 p.Cys603Ala details
Either wild-type BCRP or C603A could be cross-linked as indicated by the appearance of higher molecule mass bands corresponding to dimers and oligomers of the 95 kDa CFP/YFP-tagged BCRP or C603A (Figure 5). Login to comment
135 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:135:294
status: VERIFIED
view ABCG2 p.Cys603Ala details
This approach allows us to elucidate dimer/ oligomer formation of BCRP in a native cellular membrane environment without the need of biochemical sample preparation. To perform the FRET assay, the fluorescent protein CFP or YFP was attached to the N-terminal end of wild-type BCRP or the mutant C603A. Login to comment
138 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:138:58
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:138:156
status: NEW
view ABCG2 p.Cys603Ala details
The FRET efficiencies of cells expressing CFP/ YFP-tagged C603A were comparable to those of cells expressing CFP/YFP-tagged wild-type BCRP, suggesting that C603A retained the same ability to form a dimer/oligomer as wild-type protein. Login to comment
139 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:139:79
status: NEW
view ABCG2 p.Cys603Ala details
Chemical cross-linking To further confirm if the monomers of wild-type BCRP or C603A exist in close proximity in intact cells, we performed chemical cross-linking experiments using the homobifunctional amine-reactive cross-linker DSS (11.4 Å arm length) on intact cells expressing these proteins. Login to comment
140 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:140:25
status: NEW
view ABCG2 p.Cys603Ala details
Either wild-type BCRP or C603A could be cross-linked as indicated by the appearance of higher mole- Figure 3. Login to comment
141 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:141:59
status: NEW
view ABCG2 p.Cys603Ala details
FTC-inhibitable MX efflux activities of wild-type BCRP and C603A. Login to comment
142 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:142:71
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:142:113
status: VERIFIED
view ABCG2 p.Cys603Ala details
With this method, we estimated the FRET efficiencies of intact cells expressing CFP/YFP-tagged wild-type BCRP or C603A, the CFP/YFP pair control or CFP alone. Login to comment
147 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:147:80
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:147:165
status: NEW
view ABCG2 p.Cys603Ala details
FRET efficiencies of cells co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNAs. HEK293 cells were co-transfected with CFP/ YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors or the CFP vector alone and processed for determining FRET efficiencies as described. Login to comment
148 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:148:0
status: VERIFIED
view ABCG2 p.Cys603Ala details
Ala substitution of Cys603 did not deteriorate expression, plasma membrane localization, and activity of BCRP in HEK293 cells (Figs. 1 - 3), which is in good agreement with previous studies [18,24,25]. Login to comment
150 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:150:91
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:150:186
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:150:217
status: VERIFIED
view ABCG2 p.Cys603Ala details
This conclusion was obtained by the demonstration that wild-type BCRP migrated as a band of approximately double the size of a BCRP monomer under non-reducing conditions; however, after Cys603 was mutated to Ala, the C603A mutant migrated as a single monomeric band [18,23,24]. Login to comment
151 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:151:74
status: VERIFIED
view ABCG2 p.Cys603Ala details
Nevertheless, at least one study [23] showed that a substantial amount of C603A and other mutants at position Cys603 remained as dimers under non-reducing conditions. It is worth noting that the observation of dimer/oligomer formation of BCRP via intermolecular disulfide bonds has so far been reported all using in vitro biochemical methods such as immunoblotting under nonreducing conditions. It is possible that oxidation during biochemical sample preparation may cause formation of intermolecular disulfide bridges or disulfide bonds may be disrupted in the process of cell lysis or sample preparation involving solubilization of membrane proteins with detergents. Login to comment
153 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:153:52
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:153:140
status: VERIFIED
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:153:293
status: NEW
view ABCG2 p.Cys603Ala details
We found that the FRET efficiency of CFP/YFP-tagged C603A was the same as that of CFP/YFP-tagged wild-type BCRP (Figure 4), suggesting that Ala substitution of Cys603 does not affect the ability of BCRP to form a dimer/oligomer. Login to comment
154 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:154:69
status: VERIFIED
view ABCG2 p.Cys603Ala details
Chemical cross-linking experiments also indicate that CFP/YFP-tagged C603A molecules may exist in cells in close proximity (Figure 5). Login to comment
155 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:155:20
status: VERIFIED
view ABCG2 p.Cys603Ala details
Given the fact that C603A retained full expression, plasma membrane targeting, and MX efflux activity comparable to wild-type protein (Figure 1-3), we would argue that the intermolecular disulfide bond formed by Cys603 alone may not be essential for dimerization or oligomerization of BCRP in vivo. Login to comment
160 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:160:113
status: NEW
view ABCG2 p.Cys603Ala details
With this method, we estimated the FRET efficiencies of intact cells expressing CFP/YFP-tagged wild-type BCRP or C603A, the CFP/YFP pair control or CFP alone. Login to comment
166 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:166:0
status: NEW
view ABCG2 p.Cys603Ala details
Ala substitution of Cys603 did not deteriorate expression, plasma membrane localization, and activity of BCRP in HEK293 cells (Figs. 1 - 3), which is in good agreement with previous studies [18, 24, 25]. Login to comment
168 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:168:186
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:168:217
status: NEW
view ABCG2 p.Cys603Ala details
This conclusion was obtained by the demonstration that wild-type BCRP migrated as a band of approximately double the size of a BCRP monomer under non-reducing conditions; however, after Cys603 was mutated to Ala, the C603A mutant migrated as a single monomeric band [18, 23, 24]. Login to comment
171 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:171:44
status: NEW
view ABCG2 p.Cys603Ala details
Chemical cross-linking of wild-type BCRP or C603A on intact cells using DSS was described in the Materials and Methods section. Login to comment
172 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:172:108
status: NEW
view ABCG2 p.Cys603Ala details
Whole cell lysates prepared from HEK293 cells transiently transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors were immunoblotted using the mAb BXP-21 as described. Login to comment
173 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:173:45
status: NEW
view ABCG2 p.Cys603Ala details
The constructs (CFP/YFP, wild-type BCRP, and C603A) are indicated below the blot. Login to comment
174 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:174:83
status: NEW
view ABCG2 p.Cys603Ala details
As indicated with arrows, the molecular weight of CFP/YFP-tagged wild-type BCRP or C603A monomer is approximately 95 kDa. Login to comment
175 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:175:22
status: NEW
view ABCG2 p.Cys603Ala details
substantial amount of C603A and other mutants at position Cys603 remained as dimers under non-reducing conditions. It is worth noting that the observation of dimer/oligomer formation of BCRP via intermolecular disulfide bonds has so far been reported all using in vitro biochemical methods such as immunoblotting under non-reducing conditions. It is possible that oxidation during biochemical sample preparation may cause formation of intermolecular disulfide bridges or disulfide bonds may be disrupted in the process of cell lysis or sample preparation involving solubilization of membrane proteins with detergents. Login to comment
177 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:177:52
status: NEW
view ABCG2 p.Cys603Ala details
ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:177:141
status: NEW
view ABCG2 p.Cys603Ala details
We found that the FRET efficiency of CFP/YFP-tagged C603A was the same as that of CFP/YFP -tagged wild-type BCRP (Figure 4), suggesting that Ala substitution of Cys603 does not affect the ability of BCRP to form a dimer/oligomer. Login to comment
178 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:178:69
status: NEW
view ABCG2 p.Cys603Ala details
Chemical cross-linking experiments also indicate that CFP/YFP-tagged C603A molecules may exist in cells in close proximity (Figure 5). Login to comment
179 ABCG2 p.Cys603Ala
X
ABCG2 p.Cys603Ala 20622991:179:20
status: NEW
view ABCG2 p.Cys603Ala details
Given the fact that C603A retained full expression, plasma membrane targeting, and MX efflux activity comparable to wild-type protein (Figure 1-3), we would argue that the intermolecular disulfide bond formed by Cys603 alone may not be essential for dimerization or oligomerization of BCRP in vivo. Login to comment