ABCMdb

PMID: 20622991

Ni Z, Mark ME, Cai X, Mao Q
Fluorescence resonance energy transfer (FRET) analysis demonstrates dimer/oligomer formation of the human breast cancer resistance protein (BCRP/ABCG2) in intact cells.
Int J Biochem Mol Biol. 2010;1(1):1-11., [PubMed]

Sentences

No. Mutations Sentence Comment

4 ABCG2 p.Cys603Ala Wild-type BCRP and the mutant C603A were attached to cyan or yellow fluorescence protein and expressed in HEK293 cells by transient transfection. Login to comment 7 ABCG2 p.Cys603Ala Wild-type BCRP and C603A were expressed in HEK293 cells at comparable levels. Login to comment 8 ABCG2 p.Cys603Ala C603A was predominantly expressed in the plasma membrane as was wild-type protein. Login to comment 9 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Furthermore, C603A retained the same mitoxantrone efflux activity and the ability of dimer/oligmer formation as wild-type BCRP. Login to comment 12 ABCG2 p.Cys603Ala Wild-type BCRP and C603A were expressed in HEK293 cells at comparable levels. Login to comment 13 ABCG2 p.Cys603Ala C603A was predominantly expressed in the plasma membrane as was wild-type protein. Login to comment 14 ABCG2 p.Cys603Ala Furthermore, C603A retained the same mitoxantrone efflux activity and the ability of dimer/ oligmer formation as wild-type BCRP. Login to comment 33 ABCG2 p.Cys603Ala In the present study, we used FRET microscopy to elucidate dimer/oligomer formation of BCRP in HEK293 cells, a method that avoids artificial alterations (e.g., formation or breakdown of disulfide bonds) during biochemical sample preparation. To further understand whether Cys603 plays an important role in dimer/oligomer formation of BCRP, we generated the mutant C603A and investigated the effect of the mutation of Cys603 on dimer/oligomer formation and activity of BCRP. Login to comment 38 ABCG2 p.Cys603Ala In the present study, we used FRET microscopy to elucidate dimer/oligomer formation of BCRP in HEK293 cells, a method that avoids artificial alterations (e.g., formation or breakdown of disulfide bonds) during biochemical sample preparation. To further understand whether Cys603 plays an important role in dimer/oligomer formation of BCRP, we generated the mutant C603A and investigated the effect of the mutation of Cys603 on dimer/oligomer formation and activity of BCRP. Login to comment 49 ABCG2 p.Cys603Ala Construction of CFP- or YFP-tagged wild-type BCRP or C603A The full length BCRP cDNA fragment was amplified using the pcDNA3.1 plasmid containing full length wild-type BCRP cDNA as a template with a forward primer containing a XhoI site (5`- CTTCGGCTCGAGCTATGTCTTCCAGTAATGTCGAA G-3`) and a reverse primer (5' GTCAGAATCTA- GACAAGCTTGGTACCGAGCTCGGATCC-3'). Login to comment 51 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala The resultant YFP-BCRP plasmid was used as a template for PCR mutagenesis to generate the C603A mutant in which Cys603 was replaced with Ala. Login to comment 52 ABCG2 p.Cys603Ala The primers used to generate C603A were 5`-GCAACAGGAAACAATCCTGCTAACTATGCA ACATGTAC-3` and 5`-GTACATGTTGCATAGTTAGCA GGATTGTTTCCTGTTGC-3`. Login to comment 53 ABCG2 p.Cys603Ala To generate CFP-tagged wild-type BCRP or C603A, the YFP-BCRP plasmids were digested with XhoI and BamHI, and the DNA fragments containing wild-type and mutant BCRP cDNAs were subcloned into the pECFP-C1 plasmid. Login to comment 54 ABCG2 p.Cys603Ala Construction of CFP- or YFP-tagged wild-type BCRP or C603A The full length BCRP cDNA fragment was amplified using the pcDNA3.1 plasmid containing full length wild-type BCRP cDNA as a template with a forward primer containing a XhoI site (5`-CTTCGGCTCGAGCTATGTCTTCCAGTAATGTCGAA G-3`) and a reverse primer (5' GTCAGAATCTAGACAAGCTTGGTACCGAGCTCGGATCC-3'). Login to comment 55 ABCG2 p.Cys603Ala In these constructs, CFP or YFP was attached to the N-terminus of wild-type BCRP or C603A. Login to comment 56 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala The resultant YFP-BCRP plasmid was used as a template for PCR mutagenesis to generate the C603A mutant in which Cys603 was replaced with Ala. Login to comment 57 ABCG2 p.Cys603Ala The primers used to generate C603A were 5`- GCAACAGGAAACAATCCTGCTAACTATGCAACATGTAC-3` and 5`- GTACATGTTGCATAGTTAGCAGGATTGTTTCCTGTTGC-3`. Login to comment 58 ABCG2 p.Cys603Ala To generate CFP-tagged wild-type BCRP or C603A, the YFP-BCRP plasmids were digested with XhoI and BamHI, and the DNA fragments containing wild-type and mutant BCRP cDNAs were subcloned into the pECFP-C1 plasmid. Login to comment 60 ABCG2 p.Cys603Ala In these constructs, CFP or YFP was attached to the N-terminus of wild-type BCRP or C603A. Login to comment 65 ABCG2 p.Cys603Ala In this 4 µg of cDNA, an equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs were used at a 1:1 ratio. Login to comment 68 ABCG2 p.Cys603Ala Detection of cell surface expression of wild-type BCRP or C603A The 5D3 antibody recognizes a conformation-sensitive extracellular epitope in BCRP [32]. Login to comment 69 ABCG2 p.Cys603Ala Binding of the 5D3 antibody to the surface of cells expressing wild-type BCRP or C603A was examined using flow cytometry as previously described [33]. Login to comment 73 ABCG2 p.Cys603Ala Detection of cell surface expression of wild-type BCRP or C603A The 5D3 antibody recognizes a conformation-sensitive extracellular epitope in BCRP [32]. Login to comment 74 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Binding of the 5D3 antibody to the surface of cells expressing wild-type BCRP or C603A was examined using flow cytometry as previously described [33]. Login to comment 77 ABCG2 p.Cys603Ala Then, MX efflux activity of cells expressing wild-type BCRP or C603A was determined as previously described [22]. Login to comment 79 ABCG2 p.Cys603Ala Flow cytometric efflux assay MX efflux activity of wild-type BCRP or C603A was determined using flow cytometry as previously described [22]. Login to comment 80 ABCG2 p.Cys603Ala FRET microscopy and data analysis HEK293 cells were grown in polystyrene vessels and transiently co-transfected with a total of 1 µg of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors at a 1:1 ratio as described above. Login to comment 82 ABCG2 p.Cys603Ala Then, MX efflux activity of cells expressing wild-type BCRP or C603A was determined as previously described [22]. Login to comment 85 ABCG2 p.Cys603Ala FRET microscopy and data analysis HEK293 cells were grown in polystyrene vessels and transiently co-transfected with a total of 1 µg of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors at a 1:1 ratio as described above. Login to comment 102 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Results Expression of wild-type BCRP and C603A in HEK293 cells An equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/YFP control vectors were co-transfected into HEK293 cells, and the expression levels of wild-type and mutant BCRP were examined by immunobloting of whole cell lysates. Login to comment 103 ABCG2 p.Cys603Ala The expression levels of wild-type BCRP and C603A were comparable (Figure 1A), indicating that the expression and/ or stability of BCRP was not affected by the mutation of Cys603. Login to comment 105 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Cell surface expression of wild-type BCRP and C603A We next determined cell surface expression of wild-type BCRP and C603A by measuring binding of the phycoerythrin-conjugated 5D3 to the surface of cells expressing these proteins. Login to comment 107 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Results Expression of wild-type BCRP and C603A in HEK293 cells An equal amount of CFP- and YFP-tagged wild-type BCRP or C603A cDNAs or the CFP/ YFP control vectors were co-transfected into HEK293 cells, and the expression levels of wild-type and mutant BCRP were examined by immunobloting of whole cell lysates. Login to comment 108 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala The expression levels of wild-type BCRP and C603A were comparable (Figure 1A), indicating that the expression and/or stability of BCRP was not affected by the mutation of Cys603. Login to comment 109 ABCG2 p.Cys603Ala A, whole cell lysates (20 μg of protein each lane) prepared from HEK293 cells transiently transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors were immunoblotted as described. Login to comment 110 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Cell surface expression of wild-type BCRP and C603A We next determined cell surface expression of wild-type BCRP and C603A by measuring binding of the phycoerythrin-conjugated 5D3 to the surface of cells expressing these proteins. Login to comment 112 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala However, cells expressing wild-type BCRP or C603A demonstrated a significant shift in phycoerythrin fluorescence between the 5D3 and IgG2b treatments (Figure 1B), supporting cell surface expression of wild-type BCRP or C603A, respectively. Login to comment 113 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Cellular localization of wild-type BCRP or C603A To determine whether the mutation of Cys603 could affect the plasma membrane localization of BCRP, transfected cells were analyzed using confocal fluorescence microscopy. Login to comment 115 ABCG2 p.Cys603Ala The histograms for CFP/YFP, wild-type BCRP, and C603A are indicated above the graphs. Login to comment 116 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Thus, in the case of wild-type BCRP or C603A, a strong CFP or YFP fluorescence signal or the signal in the merged image was observed primarily on the plasma membrane (Figure 2), suggesting that wild-type BCRP or C603A was predominantly targeted to the plasma membrane of HEK293 cells. Login to comment 117 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala MX efflux activity of wild-type BCRP or C603A We next determined if the mutation of Cys603 affects BCRP efflux activity using a model fluorescent substrate MX. Login to comment 118 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Incubation of cells expressing wild-type BCRP or C603A with the BCRP-specific inhibitor FTC resulted in a similarly significant increase in the intracellular MX accumulation compared to that without FTC treatment (data not shown), suggesting that MX is actively effluxed by wild-type BCRP or C603A. Login to comment 119 ABCG2 p.Cys603Ala Thus, the FTC-inhibitable MX efflux activities of wild-type BCRP and C603A were comparable (Figure 3). Login to comment 120 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala The FTC-inhibitable MX efflux activities of cells expressing only the CFP/YFP pair control were significantly lower than those of the cells expressing wild-type BCRP or C603A (Figure 3). Login to comment 121 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala These results suggest that C603A fully retains MX efflux activity comparable to wild-type protein. Login to comment 122 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Detection of dimer/oligomer formation of wild-type BCRP or C603A by FRET analysis We then determined the effect of the mutation of Cys603 on dimer/oligmer formation of BCRP in intact cells using FRET microscopy. Login to comment 123 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala FRET analysis was performed for cells expressing the CFP/YFP pair control, the CFP/YFP-tagged wild-type BCRP or C603A, or CFP alone. Login to comment 125 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Confocal fluorescence images of HEK293 cells co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNAs. HEK293 cells were co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors and processed for confocal fluorescence microscope analysis as described. Login to comment 127 ABCG2 p.Cys603Ala Images for CFP/YFP, wild-type BCRP, and C603A are indicated on the left. Login to comment 128 ABCG2 p.Cys603Ala the cells expressing wild-type BCRP or C603A (Figure 3). Login to comment 129 ABCG2 p.Cys603Ala These results suggest that C603A fully retains MX efflux activity comparable to wild-type protein. Login to comment 130 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala The FRET efficiencies of cells expressing CFP/YFP-tagged C603A were comparable to those of cells expressing CFP/YFP-tagged wild-type BCRP, suggesting that C603A retained the same ability to form a dimer/ oligomer as wild-type protein. Login to comment 131 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Chemical cross-linking To further confirm if the monomers of wild-type BCRP or C603A exist in close proximity in intact cells, we performed chemical cross-linking experiments using the homobifunctional amine-reactive cross-linker DSS (11.4 Å arm length) on intact cells expressing these proteins. Login to comment 132 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala Either wild-type BCRP or C603A could be cross-linked as indicated by the appearance of higher molecule mass bands corresponding to dimers and oligomers of the 95 kDa CFP/YFP-tagged BCRP or C603A (Figure 5). Login to comment 135 ABCG2 p.Cys603Ala This approach allows us to elucidate dimer/ oligomer formation of BCRP in a native cellular membrane environment without the need of biochemical sample preparation. To perform the FRET assay, the fluorescent protein CFP or YFP was attached to the N-terminal end of wild-type BCRP or the mutant C603A. Login to comment 138 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala The FRET efficiencies of cells expressing CFP/ YFP-tagged C603A were comparable to those of cells expressing CFP/YFP-tagged wild-type BCRP, suggesting that C603A retained the same ability to form a dimer/oligomer as wild-type protein. Login to comment 139 ABCG2 p.Cys603Ala Chemical cross-linking To further confirm if the monomers of wild-type BCRP or C603A exist in close proximity in intact cells, we performed chemical cross-linking experiments using the homobifunctional amine-reactive cross-linker DSS (11.4 Å arm length) on intact cells expressing these proteins. Login to comment 140 ABCG2 p.Cys603Ala Either wild-type BCRP or C603A could be cross-linked as indicated by the appearance of higher mole- Figure 3. Login to comment 141 ABCG2 p.Cys603Ala FTC-inhibitable MX efflux activities of wild-type BCRP and C603A. Login to comment 142 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala With this method, we estimated the FRET efficiencies of intact cells expressing CFP/YFP-tagged wild-type BCRP or C603A, the CFP/YFP pair control or CFP alone. Login to comment 147 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala FRET efficiencies of cells co-transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNAs. HEK293 cells were co-transfected with CFP/ YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors or the CFP vector alone and processed for determining FRET efficiencies as described. Login to comment 148 ABCG2 p.Cys603Ala Ala substitution of Cys603 did not deteriorate expression, plasma membrane localization, and activity of BCRP in HEK293 cells (Figs. 1 - 3), which is in good agreement with previous studies [18,24,25]. Login to comment 150 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala This conclusion was obtained by the demonstration that wild-type BCRP migrated as a band of approximately double the size of a BCRP monomer under non-reducing conditions; however, after Cys603 was mutated to Ala, the C603A mutant migrated as a single monomeric band [18,23,24]. Login to comment 151 ABCG2 p.Cys603Ala Nevertheless, at least one study [23] showed that a substantial amount of C603A and other mutants at position Cys603 remained as dimers under non-reducing conditions. It is worth noting that the observation of dimer/oligomer formation of BCRP via intermolecular disulfide bonds has so far been reported all using in vitro biochemical methods such as immunoblotting under nonreducing conditions. It is possible that oxidation during biochemical sample preparation may cause formation of intermolecular disulfide bridges or disulfide bonds may be disrupted in the process of cell lysis or sample preparation involving solubilization of membrane proteins with detergents. Login to comment 153 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala We found that the FRET efficiency of CFP/YFP-tagged C603A was the same as that of CFP/YFP-tagged wild-type BCRP (Figure 4), suggesting that Ala substitution of Cys603 does not affect the ability of BCRP to form a dimer/oligomer. Login to comment 154 ABCG2 p.Cys603Ala Chemical cross-linking experiments also indicate that CFP/YFP-tagged C603A molecules may exist in cells in close proximity (Figure 5). Login to comment 155 ABCG2 p.Cys603Ala Given the fact that C603A retained full expression, plasma membrane targeting, and MX efflux activity comparable to wild-type protein (Figure 1-3), we would argue that the intermolecular disulfide bond formed by Cys603 alone may not be essential for dimerization or oligomerization of BCRP in vivo. Login to comment 160 ABCG2 p.Cys603Ala With this method, we estimated the FRET efficiencies of intact cells expressing CFP/YFP-tagged wild-type BCRP or C603A, the CFP/YFP pair control or CFP alone. Login to comment 166 ABCG2 p.Cys603Ala Ala substitution of Cys603 did not deteriorate expression, plasma membrane localization, and activity of BCRP in HEK293 cells (Figs. 1 - 3), which is in good agreement with previous studies [18, 24, 25]. Login to comment 168 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala This conclusion was obtained by the demonstration that wild-type BCRP migrated as a band of approximately double the size of a BCRP monomer under non-reducing conditions; however, after Cys603 was mutated to Ala, the C603A mutant migrated as a single monomeric band [18, 23, 24]. Login to comment 171 ABCG2 p.Cys603Ala Chemical cross-linking of wild-type BCRP or C603A on intact cells using DSS was described in the Materials and Methods section. Login to comment 172 ABCG2 p.Cys603Ala Whole cell lysates prepared from HEK293 cells transiently transfected with CFP/YFP-tagged wild-type BCRP or C603A cDNA constructs or the CFP/YFP control vectors were immunoblotted using the mAb BXP-21 as described. Login to comment 173 ABCG2 p.Cys603Ala The constructs (CFP/YFP, wild-type BCRP, and C603A) are indicated below the blot. Login to comment 174 ABCG2 p.Cys603Ala As indicated with arrows, the molecular weight of CFP/YFP-tagged wild-type BCRP or C603A monomer is approximately 95 kDa. Login to comment 175 ABCG2 p.Cys603Ala substantial amount of C603A and other mutants at position Cys603 remained as dimers under non-reducing conditions. It is worth noting that the observation of dimer/oligomer formation of BCRP via intermolecular disulfide bonds has so far been reported all using in vitro biochemical methods such as immunoblotting under non-reducing conditions. It is possible that oxidation during biochemical sample preparation may cause formation of intermolecular disulfide bridges or disulfide bonds may be disrupted in the process of cell lysis or sample preparation involving solubilization of membrane proteins with detergents. Login to comment 177 ABCG2 p.Cys603Ala ABCG2 p.Cys603Ala We found that the FRET efficiency of CFP/YFP-tagged C603A was the same as that of CFP/YFP -tagged wild-type BCRP (Figure 4), suggesting that Ala substitution of Cys603 does not affect the ability of BCRP to form a dimer/oligomer. Login to comment 178 ABCG2 p.Cys603Ala Chemical cross-linking experiments also indicate that CFP/YFP-tagged C603A molecules may exist in cells in close proximity (Figure 5). Login to comment 179 ABCG2 p.Cys603Ala Given the fact that C603A retained full expression, plasma membrane targeting, and MX efflux activity comparable to wild-type protein (Figure 1-3), we would argue that the intermolecular disulfide bond formed by Cys603 alone may not be essential for dimerization or oligomerization of BCRP in vivo. Login to comment