ABCMdb

PMID: 9374850

McNicholas CM, Nason MW Jr, Guggino WB, Schwiebert EM, Hebert SC, Giebisch G, Egan ME
A functional CFTR-NBF1 is required for ROMK2-CFTR interaction.
Am J Physiol. 1997 Nov;273(5 Pt 2):F843-8., [PubMed]

Sentences

No. Mutations Sentence Comment

7 ABCC7 p.Lys593* In oocytes coinjected with ROMK2 and a truncated construct of CFTR with an intact NBF1 (CFTR-K593X), glibenclamide inhibited K1 currents by 46%. Login to comment 8 ABCC7 p.Lys370* However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited K1 currents by 12%. Login to comment 9 ABCC7 p.Ala455Glu Also, oocytes expressing both ROMK2 and CFTR mutants with naturally occurring NBF1 point mutations, CFTRG551D or CFTR-A455E, display glibenclamide-inhibitable K1 currents of only 14 and 25%, respectively. Login to comment 13 ABCC7 p.Lys593* In oocytes coinjected with ROMK2 and a truncated construct of CFTR with an intact NBF1 (CFTR-K593X), glibenclamide inhibited Kϩ currents by 46%. Login to comment 14 ABCC7 p.Lys370* However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited Kϩ currents by 12%. Login to comment 15 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu Also, oocytes expressing both ROMK2 and CFTR mutants with naturally occurring NBF1 point mutations, CFTR-G551D or CFTR-A455E, display glibenclamide-inhibitable Kϩ currents of only 14 and 25%, respectively. Login to comment 62 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys370* The oligonucleotides used for mutagenesis were CFTR-G551D:58 GAGTGGAGAT- CAACGAG 38, CFTR-A455E:58 GTTGTTGGAGGTTGCTGG 38, CFTR-K370X:58 GCAATAAACTAAATACAGGATATCTTAC 38, and CFTR-K593X:58 CTGTTAACTGATGGCTAGCAAACTAGG 38. Login to comment 69 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys370* The oligonucleotides used for mutagenesis were CFTR-G551D:5Ј GAGTGGAGAT- CAACGAG 3Ј, CFTR-A455E:5Ј GTTGTTGGAGGTTGCTGG 3Ј, CFTR-K370X:5Ј GCAATAAACTAAATACAGGATATCTTAC 3Ј, and CFTR-K593X:5Ј CTGTTAACTGATGGCTAGCAAACTAGG 3Ј. Login to comment 77 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys370* To test our hypothesis, we measured the glibenclamide sensitivity of the K1 currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment 80 ABCC7 p.Lys593* ABCC7 p.Lys370* In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment 81 ABCC7 p.Lys593* Similar to the effect observed with the coexpression of wild-type CFTR and ROMK2, coexpressing ROMK2:CFTR-K593X elicited Ba21-sensitive currents that were decreased by 45.8 6 8.1% (n 5 8) after the oocytes were exposed to glibenclamide (Figs. 3A and 4). Login to comment 84 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys593* ABCC7 p.Lys370* To test our hypothesis, we measured the glibenclamide sensitivity of the Kϩ currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment 85 ABCC7 p.Lys593* Because mutant CFTR-K593X is a truncated version of CFTR-WT that lacks the latter half of the protein [including the regulatory (R) and NBF2 domains, as well as transmembrane regions 7-12 (see Fig. 2)], this portion of the Fig. 2. Login to comment 87 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys370* In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment 88 ABCC7 p.Lys593* ABCC7 p.Lys593* Similar to the effect observed with the coexpression of wild-type CFTR and ROMK2, coexpressing ROMK2:CFTR-K593X elicited Ba2ϩ-sensitive currents that were decreased by 45.8 Ϯ 8.1% (n ϭ 8) after the oocytes were exposed to glibenclamide (Figs. Login to comment 89 ABCC7 p.Lys370* C: CFTR-K370X is truncated at residue 370 prior to NBF1. Login to comment 92 ABCC7 p.Lys593* ABCC7 p.Lys370* Therefore, the mutant CFTR-K593X is similar to CFTR-WT in conferring glibenclamide sensitivity on ROMK2. Login to comment 93 ABCC7 p.Lys593* Because mutant CFTR-K593X is a truncated version of CFTR-WT that lacks the latter half of the protein [including the regulatory (R) and NBF2 domains, as well as transmembrane regions 7-12 (see Fig. 2)], this portion of the Fig. 2. Login to comment 94 ABCC7 p.Lys370* When ROMK2 and CFTR-K370X were coexpressed, the observed Ba21-sensitive K1 currents decreased by only 12.3 6 3.3% (n 5 12) after oocytes were exposed to glibenclamide. Login to comment 95 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu A: two naturally occurring first nucleotide binding folds (NBF1) mutants, CFTR-G551D and CFTR-A455E. Login to comment 96 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* B: CFTR-K593X, a mutant truncated at residue 593, has an intact NBF1. Login to comment 97 ABCC7 p.Gly551Asp ABCC7 p.Lys370* C: CFTR-K370X is truncated at residue 370 prior to NBF1. Login to comment 99 ABCC7 p.Lys593* This minimal reduction in the Ba21-sensitive current following glibenclamide treatment was significantly less than that observed when ROMK2 was coexpressed with CFTR-WT (P 5 0.013, Fig. 1) or with CFTR-K593X (P 5 0.013, Fig. 3A) but similar to that observed when ROMK2 was expressed alone (P 5 0.73, Fig. 4). Login to comment 100 ABCC7 p.Lys370* To examine whether CFTR-NBF1 is the important region for this interaction and not the transmembrane domains, we coexpressed ROMK2 with CFTR-K370X (Fig. 2). Login to comment 101 ABCC7 p.Gly551Asp To determine whether the change in CFTR-ROMK2 interaction was specific to the CFTR-G551D mutation or whether other CFTR-NBF1 mutations would produce a similar response, we examined the effect of coexpressing ROMK2 with another naturally occurring disease-causing NBF1-CFTR mutant construct, CFTR- Table 1. Login to comment 102 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys370* ABCC7 p.Lys370* When ROMK2 and CFTR-K370X were coexpressed, the observed Ba2ϩ- sensitive Kϩ currents decreased by only 12.3 Ϯ 3.3% (n ϭ 12) after oocytes were exposed to glibenclamide. Login to comment 104 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu Next, we coexpressed ROMK2 with naturally occurring CFTR mutations within NBF1 (CFTR-G551D or CFTR-A455E). Login to comment 105 ABCC7 p.Gly551Asp As shown in Fig. 3B, coexpressing ROMK2 with CFTR-G551D resulted in Ba2ϩ-sensitive outward currents both before and after the oocyte was exposed to 0.5 mM glibenclamide for 15 min. Login to comment 107 ABCC7 p.Lys593* This minimal reduction in the Ba2ϩ-sensitive current following glibenclamide treatment was significantly less than that observed when ROMK2 was coexpressed with CFTR-WT (P ϭ 0.013, Fig. 1) or with CFTR-K593X (P ϭ 0.013, Fig. 3A) but similar to that observed when ROMK2 was expressed alone (P ϭ 0.73, Fig. 4). Login to comment 109 ABCC7 p.Gly551Asp To determine whether the change in CFTR-ROMK2 interaction was specific to the CFTR-G551D mutation or whether other CFTR-NBF1 mutations would produce a similar response, we examined the effect of coexpressing ROMK2 with another naturally occurring disease-causing NBF1-CFTR mutant construct, CFTR- Table 1. Login to comment 110 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys370* Sensitivity of CFTR Cl- currents to glibenclamide Construct Whole Cell Current, nA %Inhibition By Glibenclamide n P CFTR-WT 560Ϯ150 51.9 9 CFTR-K593X 190Ϯ31 50.1 8 NS CFTR-K370X 183Ϯ85 44.1 5 NS CFTR-G551D 334Ϯ80 49.6 7 NS CFTR-A455E 299Ϯ27 63.2 5 NS Uninjected 26Ϯ10 0 5 0.02 Values are means Ϯ SE; n is no. of experiments. Login to comment 112 ABCC7 p.Gly551Asp ABCC7 p.Lys593* Effect of glibenclamide on Ba21-sensitive currents for ROMK2 coexpressed with CFTR mutants CFTR-K593X and CFTR-G551D. Login to comment 113 ABCC7 p.Gly551Asp ABCC7 p.Lys593* Time course showing whole cell currents at Vhold 5 260 mV for Xenopus oocytes expressing ROMK2:CFTR-K593X (A) and ROMK2: CFTR-G551D (B) obtained using 2-microelectrode voltage-clamp techniques. Login to comment 120 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Ala455Glu ABCC7 p.Lys593* ABCC7 p.Lys593* Effect of glibenclamide on Ba2ϩ-sensitive currents for ROMK2 coexpressed with CFTR mutants CFTR-K593X and CFTR-G551D. Login to comment 121 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Lys593* Time course showing whole cell currents at Vhold ϭ -60 mV for Xenopus oocytes expressing ROMK2:CFTR-K593X (A) and ROMK2: CFTR-G551D (B) obtained using 2-microelectrode voltage-clamp techniques. Login to comment 123 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu The data from oocytes coexpressed with ROMK2 and either CFTR-G551D or CFTR-A455E demonstrate that at least two amino acids in NBF1 are necessary for the ROMK2-CFTR interaction. Login to comment 128 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu ABCC7 p.Ala455Glu ABCC7 p.Lys593* Average Ba2ϩ-sensitive whole cell currents for each condition are as follows: ROMK2 alone ϭ 11.35 Ϯ 3.3 µA, ROMK2:CFTR-WT ϭ 8.29 Ϯ 0.9 µA, ROMK2:CFTR-G551D ϭ 5.57 Ϯ 0.66 µA, ROMK2:CFTR-K593X ϭ 2.37 Ϯ 0.7 µA, ROMK2: A455E ϭ 6.26 Ϯ 1.39 µA, and ROMK2:K370X ϭ 5.57 Ϯ 0.66 µA. A455E (Fig. 2). Login to comment 129 ABCC7 p.Ala455Glu Coexpressing ROMK2 with CFTR-A455E resulted in Ba2ϩ-sensitive outward currents that were not significantly inhibited by glibenclamide (n ϭ 10) (Fig. 4). Login to comment 131 ABCC7 p.Gly551Asp ABCC7 p.Ala455Glu The data from oocytes coexpressed with ROMK2 and either CFTR-G551D or CFTR-A455E demonstrate that at least two amino acids in NBF1 are necessary for the ROMK2-CFTR interaction. Login to comment