ABCMdb

ABCC7 p.Lys370*

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Cystic fibrosis transmembrane conductance regulato... J Cell Biol. 1998 Nov 2;143(3):645-57. Jiang Q, Mak D, Devidas S, Schwiebert EM, Bragin A, Zhang Y, Skach WR, Guggino WB, Foskett JK, Engelhardt JF
Cystic fibrosis transmembrane conductance regulator-associated ATP release is controlled by a chloride sensor.
J Cell Biol. 1998 Nov 2;143(3):645-57., 1998-11-02 [PMID:9813087]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that is defective in cystic fibrosis, and has also been closely associated with ATP permeability in cells. Using a Xenopus oocyte cRNA expression system, we have evaluated the molecular mechanisms that control CFTR-modulated ATP release. CFTR-modulated ATP release was dependent on both cAMP activation and a gradient change in the extracellular chloride concentration. Activation of ATP release occurred within a narrow concentration range of external Cl- that was similar to that reported in airway surface fluid. Mutagenesis of CFTR demonstrated that Cl- conductance and ATP release regulatory properties could be dissociated to different regions of the CFTR protein. Despite the lack of a need for Cl- conductance through CFTR to modulate ATP release, alterations in channel pore residues R347 and R334 caused changes in the relative ability of different halides to activate ATP efflux (wtCFTR, Cl >> Br; R347P, Cl >> Br; R347E, Br >> Cl; R334W, Cl = Br). We hypothesize that residues R347 and R334 may contribute a Cl- binding site within the CFTR channel pore that is necessary for activation of ATP efflux in response to increases of extracellular Cl-. In summary, these findings suggest a novel chloride sensor mechanism by which CFTR is capable of responding to changes in the extracellular chloride concentration by modulating the activity of an unidentified ATP efflux pathway. This pathway may play an important role in maintaining fluid and electrolyte balance in the airway through purinergic regulation of epithelial cells. Insight into these molecular mechanisms enhances our understanding of pathogenesis in the cystic fibrosis lung.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 The COOH-terminal truncation mutant, TMD1 CFTR, was constructed by introducing a stop codon at K370X followed by an EcoRV restriction site using the mutagenic oligonucleotide 5Ј-GCAATAAACTAAATACAG- GATATCTTAC-3Ј. Login to comment

[hide] Chloride channel and chloride conductance regulato... Proc Natl Acad Sci U S A. 1998 Mar 3;95(5):2674-9. Schwiebert EM, Morales MM, Devidas S, Egan ME, Guggino WB
Chloride channel and chloride conductance regulator domains of CFTR, the cystic fibrosis transmembrane conductance regulator.
Proc Natl Acad Sci U S A. 1998 Mar 3;95(5):2674-9., [PMID:9482946]

Abstract [show]
CFTR is a cyclic AMP (cAMP)-activated chloride (Cl-) channel and a regulator of outwardly rectifying Cl- channels (ORCCs) in airway epithelia. CFTR regulates ORCCs by facilitating the release of ATP out of cells. Once released from cells, ATP stimulates ORCCs by means of a purinergic receptor. To define the domains of CFTR important for Cl- channel function and/or ORCC regulator function, mutant CFTRs with N- and C-terminal truncations and selected individual amino acid substitutions were created and studied by transfection into a line of human airway epithelial cells from a cystic fibrosis patient (IB3-1) or by injection of in vitro transcribed complementary RNAs (cRNAs) into Xenopus oocytes. Two-electrode voltage clamp recordings, 36Cl- efflux assays, and whole cell patch-clamp recordings were used to assay for the Cl- channel function of CFTR and for its ability to regulate ORCCs. The data showed that the first transmembrane domain (TMD-1) of CFTR, especially predicted alpha-helices 5 and 6, forms an essential part of the Cl- channel pore, whereas the first nucleotide-binding and regulatory domains (NBD1/R domain) are essential for its ability to regulate ORCCs. Finally, the data show that the ability of CFTR to function as a Cl- channel and a conductance regulator are not mutually exclusive; one function could be eliminated while the other was preserved.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
172 More importantly, results with T-N-R CFTR suggest that the region of CFTR important for regulatory interaction with ORCCs lies Table 2. cAMP-stimulated Cl- efflux in CFTR cDNA-transfected IB3-1 CF cells cDNA transfected n Cl- efflux, % lost per min Paired P valueBefore agonists After agonists Mock 42 33.01 Ϯ 3.12 29.53 Ϯ 2.22 NS Wild-type 37 22.99 Ϯ 1.47 46.51 Ϯ 6.53* Ͻ0.005 ⌬259-M265 30 21.85 Ϯ 1.43 47.67 Ϯ 5.95* Ͻ0.005 ⌬259-M265V 18 24.55 Ϯ 1.17 29.25 Ϯ 2.23** Ͻ0.05 TMD-1 (K370X) 24 16.63 Ϯ 1.80 53.51 Ϯ 9.50* Ͻ0.005 TMD-1 (K370EcoRV) 24 19.54 Ϯ 1.67 41.27 Ϯ 5.22* Ͻ0.005 T-N-R 18 19.21 Ϯ 1.89 28.05 Ϯ 3.35** Ͻ0.05 R334W-R347P 18 19.85 Ϯ 3.20 31.16 Ϯ 6.79** Ͻ0.05 R334W-R347P-TMD-1 18 23.12 Ϯ 2.60 26.26 Ϯ 3.42 NS The Before agonists value is the rate of 36Cl- efflux immediately prior to stimulation with cAMP agonists (2.5 ␮M forskolin, 250 ␮M CPT-cAMP, and 250 ␮M 8-bromo-cAMP). Login to comment
174 For mutants ⌬259-M265V, T-N-R, and R334W-R347P, the magnitude of cAMP stimulation is significantly less (P Ͻ 0.05, versus paired control value as denoted by two asterisks) than that for the wild type and other responding mutants [⌬259-M265, TMD-1 (K370X), TMD-1 (K370EcoRV), P Ͻ 0.005 as denoted by one asterisk], as determined by ANOVA followed by the Bonferroni ad hoc test. Login to comment
171 More importantly, results with T-N-R CFTR suggest that the region of CFTR important for regulatory interaction with ORCCs lies Table 2. cAMP-stimulated Cl2 efflux in CFTR cDNA-transfected IB3-1 CF cells cDNA transfected n Cl2 efflux, % lost per min Paired P value Before agonists After agonists Mock 42 33.01 6 3.12 29.53 6 2.22 NS Wild-type 37 22.99 6 1.47 46.51 6 6.53* ,0.005 D259-M265 30 21.85 6 1.43 47.67 6 5.95* ,0.005 D259-M265V 18 24.55 6 1.17 29.25 6 2.23** ,0.05 TMD-1 (K370X) 24 16.63 6 1.80 53.51 6 9.50* ,0.005 TMD-1 (K370EcoRV) 24 19.54 6 1.67 41.27 6 5.22* ,0.005 T-N-R 18 19.21 6 1.89 28.05 6 3.35** ,0.05 R334W-R347P 18 19.85 6 3.20 31.16 6 6.79** ,0.05 R334W-R347P-TMD-1 18 23.12 6 2.60 26.26 6 3.42 NS The Before agonists value is the rate of 36Cl2 efflux immediately prior to stimulation with cAMP agonists (2.5 mM forskolin, 250 mM CPT-cAMP, and 250 mM 8-bromo-cAMP). Login to comment
173 For mutants D259-M265V, T-N-R, and R334W-R347P, the magnitude of cAMP stimulation is significantly less (P , 0.05, versus paired control value as denoted by two asterisks) than that for the wild type and other responding mutants [D259-M265, TMD-1 (K370X), TMD-1 (K370EcoRV), P , 0.005 as denoted by one asterisk], as determined by ANOVA followed by the Bonferroni ad hoc test. Login to comment

[hide] A functional CFTR-NBF1 is required for ROMK2-CFTR ... Am J Physiol. 1997 Nov;273(5 Pt 2):F843-8. McNicholas CM, Nason MW Jr, Guggino WB, Schwiebert EM, Hebert SC, Giebisch G, Egan ME
A functional CFTR-NBF1 is required for ROMK2-CFTR interaction.
Am J Physiol. 1997 Nov;273(5 Pt 2):F843-8., [PMID:9374850]

Abstract [show]
In a previous study on inside-out patches of Xenopus oocytes, we demonstrated that the cystic fibrosis transmembrane conductance regulator (CFTR) enhances the glibenclamide sensitivity of a coexpressed inwardly rectifying K+ channel, ROMK2 (C. M. McNicholas, W. B. Guggino, E. M. Schwiebert, S. C. Hebert, G. Giebisch, and M. E. Egan. Proc. Natl. Acad. Sci. USA 93: 8083-8088, 1996). In the present study, we used the two-microelectrode voltage-clamp technique to measure whole cell K+ currents in Xenopus oocytes, and we further characterized the enhanced sensitivity of ROMK2 to glibenclamide by CFTR. Glibenclamide inhibited K+ currents by 56% in oocytes expressing both ROMK2 and CFTR but only 11% in oocytes expressing ROMK2 alone. To examine the role of the first nucleotide binding fold (NBF1) of CFTR in the ROMK2-CFTR interaction, we studied the glibenclamide sensitivity of ROMK2 when coexpressed with CFTR constructs containing mutations in or around the NBF1 domain. In oocytes coinjected with ROMK2 and a truncated construct of CFTR with an intact NBF1 (CFTR-K593X), glibenclamide inhibited K+ currents by 46%. However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited K+ currents by 12%. Also, oocytes expressing both ROMK2 and CFTR mutants with naturally occurring NBF1 point mutations, CFTR-G551D or CFTR-A455E, display glibenclamide-inhibitable K+ currents of only 14 and 25%, respectively. Because CFTR mutations that alter the NBF1 domain reduce the glibenclamide sensitivity of the coexpressed ROMK2 channel, we conclude that the NBF1 motif is necessary for the CFTR-ROMK2 interaction that confers sulfonylurea sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited Kϩ currents by 12%. Login to comment
69 The oligonucleotides used for mutagenesis were CFTR-G551D:5Ј GAGTGGAGAT- CAACGAG 3Ј, CFTR-A455E:5Ј GTTGTTGGAGGTTGCTGG 3Ј, CFTR-K370X:5Ј GCAATAAACTAAATACAGGATATCTTAC 3Ј, and CFTR-K593X:5Ј CTGTTAACTGATGGCTAGCAAACTAGG 3Ј. Login to comment
84 To test our hypothesis, we measured the glibenclamide sensitivity of the Kϩ currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment
87 In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment
92 Therefore, the mutant CFTR-K593X is similar to CFTR-WT in conferring glibenclamide sensitivity on ROMK2. Login to comment
97 C: CFTR-K370X is truncated at residue 370 prior to NBF1. Login to comment
100 To examine whether CFTR-NBF1 is the important region for this interaction and not the transmembrane domains, we coexpressed ROMK2 with CFTR-K370X (Fig. 2). Login to comment
102 When ROMK2 and CFTR-K370X were coexpressed, the observed Ba2ϩ- sensitive Kϩ currents decreased by only 12.3 Ϯ 3.3% (n ϭ 12) after oocytes were exposed to glibenclamide. Login to comment
110 Sensitivity of CFTR Cl- currents to glibenclamide Construct Whole Cell Current, nA %Inhibition By Glibenclamide n P CFTR-WT 560Ϯ150 51.9 9 CFTR-K593X 190Ϯ31 50.1 8 NS CFTR-K370X 183Ϯ85 44.1 5 NS CFTR-G551D 334Ϯ80 49.6 7 NS CFTR-A455E 299Ϯ27 63.2 5 NS Uninjected 26Ϯ10 0 5 0.02 Values are means Ϯ SE; n is no. of experiments. Login to comment
8 However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited K1 currents by 12%. Login to comment
62 The oligonucleotides used for mutagenesis were CFTR-G551D:58 GAGTGGAGAT- CAACGAG 38, CFTR-A455E:58 GTTGTTGGAGGTTGCTGG 38, CFTR-K370X:58 GCAATAAACTAAATACAGGATATCTTAC 38, and CFTR-K593X:58 CTGTTAACTGATGGCTAGCAAACTAGG 38. Login to comment
77 To test our hypothesis, we measured the glibenclamide sensitivity of the K1 currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment
80 In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment
89 C: CFTR-K370X is truncated at residue 370 prior to NBF1. Login to comment
94 When ROMK2 and CFTR-K370X were coexpressed, the observed Ba21-sensitive K1 currents decreased by only 12.3 6 3.3% (n 5 12) after oocytes were exposed to glibenclamide. Login to comment