ABCMdb

ABCC7 p.Lys593*

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Identification of the cystic fibrosis transmembran... J Biol Chem. 2000 Jun 2;275(22):16697-701. Cahill P, Nason MW Jr, Ambrose C, Yao TY, Thomas P, Egan ME
Identification of the cystic fibrosis transmembrane conductance regulator domains that are important for interactions with ROMK2.
J Biol Chem. 2000 Jun 2;275(22):16697-701., 2000-06-02 [PMID:10748197]

Abstract [show]
In addition to functioning as a cAMP-activated chloride channel, the cystic fibrosis transmembrane conductance regulator (CFTR) plays an important role in conferring regulatory properties on other ion channels. It is known, with respect to CFTR regulation of ROMK2 (renally derived K(ATP) channel), that the first transmembrane domain and the first nucleotide binding fold domain (NBF1) of CFTR are necessary for this interaction to occur. It has been shown that under conditions that promote phosphorylation, the ROMK2-CFTR interaction is attenuated. To elucidate the complex nature of this interaction, CFTR constructs were co-expressed with ROMK2 in Xenopus oocytes, and two microelectrode voltage clamp experiments were performed. Although the second half of CFTR can act as a functional chloride channel, our results suggest that it does not confer glibenclamide sensitivity on ROMK2, as does the first half of CFTR. The attenuation of the ROMK2-CFTR interaction under conditions that promote phosphorylation is dependent on at least the presence of the R domain of CFTR. We conclude that transmembrane domain 1, NBF1, and the R domain are the CFTR domains involved in the ROMK2-CFTR interaction and that NBF2 and transmembrane domain 2 are not essential. Lastly, the R domain of CFTR is necessary for the attenuation of the ROMK2-CFTR interaction under conditions that promote phosphorylation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 These experiments were performed on oocytes expressing ROMK2/CFTR-K593X and ROMK2/CFTR-D835X and showed that the current was Ba2ϩ -sensitive Kϩ current and not stimulated Cl- current. Login to comment
58 CFTR Constructs and Method of Mutagenesis-Cells were injected with ROMK2 alone, ROMK2/CFTR-WT, ROMK2/SUR, ROMK2/CFTR-D835X (a CFTR construct with an intact nucleotide binding fold and a functional R domain), ROMK2/CFTR-K593X (a CFTR construct with an intact nucleotide binding fold but no R domain), or ROMK2/ RT2N2CFTR (a CFTR construct containing the R domain, the second nucleotide binding fold domain, the second transmembrane domain, and the first 159 bases of CFTR-WT so as to include the Kozak methionine for translation initiation) (Fig. 1). Login to comment
61 The oligonucleotides used for mutagenesis were CFTR-K593X, 5Ј-CTGTTAACTGATGGCT- AGCAAACTAGG-3Ј and CFTR-D835X, 5ЈCACGAAAAGTGTCACTGG- CCCCTCAGGCAAACTTCGATATATTACTGTCCACAAGAGCTTAAT- TTTGTGC-3Ј. Login to comment
65 CFTR-D835X and CFTR-K593X are expressed at membrane level, in varying expression systems (9, 19). Login to comment
76 When ROMK2 was co-expressed with a CFTR construct containing transmembrane domain 1 and NBF1 without an R domain (CFTR-K593X) and exposed to FSK/IBMX, the resultant Ba2ϩ -sensitive Kϩ current was inFIG. 1. Login to comment
77 Schematic representation of CFTR-WT (A), RT2N2CFTR (B), a CFTR mutant containing the R domain, transmembrane domain 2, NBF2, and the initial 159 bases of CFTR-WT so as to include the Kozak methionone for translation initiation, CFTR-K593X (C), a CFTR mutant truncated at residue 593, with an intact NBF1 and CFTR-D835X (D), a CFTR mutant truncated after the R domain. Login to comment
81 Without cAMP stimulation glibenclamide inhibited 46 Ϯ 4.5% (n ϭ 6) of Kϩ current when ROMK2 and CFTR-K593X were co-expressed, which is similar to previous findings. Login to comment
84 Furthermore, after cAMP stimulation there is a significant enhancement of glibenclamide effect on ROMK2/CFTR-K593X currents (Table I). Login to comment
92 However, in contrast to the ROMK2/CFTR-K593X currents, glibenclamide inhibition is not enhanced after cAMP stimulation. Login to comment
96 Conditions that promote phosphorylation did not alter the glibenclamide insensitive FIG. 2. Effect of glibenclamide on whole cell Ba2ϩ -sensitive Kϩ currents for ROMK2 when co-expressed with CFTR-D835X, CFTR-K593X, or RT2N2CFTR under basal conditions (in the absence of FSK/IBMX) (A, B, and E) in Xenopus oocytes, using two-microelectrode voltage clamp techniques. Login to comment
103 A representative family of whole cell currents from oocytes injected with either ROMK2/CFTR-D835X or ROMK2/ CFTR-K593X, and traces under basal conditions (in the absence of FSK/IBMX) and after stimulation with FSK/IBMX (100 ␮M/1 mM) are compared. Login to comment
105 It demonstrates that in ROMK2/ CFTR-K593X-injected oocytes, glibenclamide inhibition of whole cell Kϩ current remains prominent, despite application of FSK/IBMX, but that in ROMK2/CFTR-D835X-injected oocytes the FSK/IBMX mixture attenuates this inhibitory response. Login to comment
121 e p value Ͻ0.05 when comparing % glibenclamide inhibition of whole cell Kϩ current under basal conditions and after stimulation with FSK/IBMX for R2/K593X where there is a marked enhancement of inhibitory response with FSK/IBMX. Login to comment
122 FIG. 4. Effect of glibenclamide on Ba2؉ -sensitive currents obtained from Xenopus oocytes using two-microelectrode voltage clamp techniques. Summary of data obtained for ROMK2, ROMK2/ CFTR-WT, ROMK2/CFTR-D835X, ROMK2/CFTR-K593X, and ROMK2/SUR, as indicated on the x axis. Represented on the y axis is the percentage of total barium-sensitive Kϩ current inhibited by glibenclamide. Login to comment

[hide] R-domain interactions with distal regions of CFTR ... Biochemistry. 2000 Aug 15;39(32):9868-75. King SA, Sorscher EJ
R-domain interactions with distal regions of CFTR lead to phosphorylation and activation.
Biochemistry. 2000 Aug 15;39(32):9868-75., 2000-08-15 [PMID:10933805]

Abstract [show]
Cystic fibrosis is caused by the aberrant function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. We examined whether intramolecular binding interactions involving the regulatory (R) domain contributed to CFTR regulation and function. When the R-domain (amino acids 596-836) was coexpressed with Delta1-836 CFTR (a carboxyl hemi-CFTR beginning immediately after the R-domain), strong binding between the two polypeptides was exhibited. The R-domain that co-immunoprecipitated with Delta1-836 exhibited a slower mobility on SDS-PAGE that resulted from phosphorylation of the protein. A larger CFTR polypeptide that included the R-domain (M837X) also exhibited a phosphorylation-dependent mobility shift when coexpressed with Delta1-836. Moreover, coexpression of M837X and Delta1-836 led to enhanced halide permeability in living cells. The activity, unlike in full-length CFTR, was present without forskolin activation, but still sensitive to the PKA inhibitor, Rp-8-CPT-cAMPS. This PKA inhibition of activity was found to be dependent on the carboxy region of the R-domain, amino acids 723-836. Our results indicate that the R-domain binds CFTR residues after amino acid 836 and that this binding facilitates phosphorylation and CFTR activation. We have also characterized a subdomain within CFTR (residues 723-837) that is necessary for PKA-dependent constitutive activation. Finally, these experiments demonstrate that constitutive CFTR activity can be accomplished by at least two mechanisms: (1) direct modulation of the R-domain to abrogate PKA regulation and (2) modifications that increase R-domain susceptibility to steady-state phosphorylation through PKA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 1 Abbreviations: CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator; ABC, ATP binding cassette; NBD, nucleotide binding domain; TMD, transmembrane domain; R-domain, regulatory domain; PKA, cyclic AMP-dependent protein kinase A; His P, NBD of histidine permease; His Q and His M, TMDs of histidine permease; Mal K, NBD region of the maltose transport system; Mal F, integral membrane protein of the maltose transport system; AMP, adenosine monophosphate; ∆R-CFTR, CFTR lacking amino acids 708-835; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; DMEM, Dulbecco`s Modified Eagle`s Medium; FBS, fetal bovine serum; vTF7.3, vaccina virus encoding the T7 polymerase; MOI, multiplicity of infection; DOC, deoxycholic acid; PVDF, poly- (vinylidene difluoride); NBT, 4-nitroblue tetrazolium chloride; SPQ, 6-methoxy-N-(3-sulfopropyl)quinolonium; BCIP, 5-bromo-4-chloro-3-indolyl phosphate; -gal, -galactosidase; ∆1-836, carboxy hemi-CFTR beginning immediately after the R-domain; M837X, CFTR truncation that ends at CFTR position 836, after the R-domain; G723X, CFTR truncation ending at residue 722 within the R-domain; K593X, CFTR truncation ending immediately before the R-domain at position 592. Login to comment
179 K593X (CFTR truncated immediately before the R-domain, Table 1) co-immunoprecipitated with ∆1-836 in a manner similar to that of M837X or G723X (data not shown), but coexpression of K593X with ∆1-836 failed to produce enhanced halide efflux (Figure 8A). Login to comment
228 FIGURE 8: G723X coexpression with ∆1-836 produces enhanced halide efflux, while K593X does not. Login to comment
229 (A) G723X and ∆1-836 (9) or K593X and ∆1-836 (b) were expressed in COS7 cells, and halide efflux was assayed as described in the legend of Figure 5. Login to comment
231 K593X, missing the complete R-domain, failed to increase halide permeability when coexpressed with ∆1-836. Login to comment

[hide] CFTR is a conductance regulator as well as a chlor... Physiol Rev. 1999 Jan;79(1 Suppl):S145-66. Schwiebert EM, Benos DJ, Egan ME, Stutts MJ, Guggino WB
CFTR is a conductance regulator as well as a chloride channel.
Physiol Rev. 1999 Jan;79(1 Suppl):S145-66., [PMID:9922379]

Abstract [show]
CFTR Is a Conductance Regulator as well as a Chloride Channel. Physiol. Rev. 79, Suppl.: S145-S166, 1999. - Cystic fibrosis transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette (ABC) transporter gene family. Although CFTR has the structure of a transporter that transports substrates across the membrane in a nonconductive manner, CFTR also has the intrinsic ability to conduct Cl- at much higher rates, a function unique to CFTR among this family of ABC transporters. Because Cl- transport was shown to be lost in cystic fibrosis (CF) epithelia long before the cloning of the CF gene and CFTR, CFTR Cl- channel function was considered to be paramount. Another equally valid perspective of CFTR, however, derives from its membership in a family of transporters that transports a multitude of different substances from chemotherapeutic drugs, to amino acids, to glutathione conjugates, to small peptides in a nonconductive manner. Moreover, at least two members of this ABC transporter family (mdr-1, SUR) can regulate other ion channels in the membrane. More simply, ABC transporters can regulate somehow the function of other cellular proteins or cellular functions. This review focuses on a plethora of studies showing that CFTR also regulates other ion channel proteins. It is the hope of the authors that the reader will take with him or her the message that CFTR is a conductance regulator as well as a Cl- channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
416 Cystic fibrosis transmembrane con- when a truncated CFTR construct that contains a functioning NBF1 (K593X) was expressed with ROMK2, Ç50%ductance regulator could be coupled with either ROMK1 or ROMK2 in the cell membrane, providing a missing of K/ current was glibenclamide sensitive, demonstrating a significant but not complete inhibition (130). Login to comment
418 Alternatively, the mechanism that con- ROMK2 and K593X/ROMK2 data suggest that the interaction between CFTR and ROMK2 may require a functionaltrols the CFTR-ROMK2 interaction could involve a regulatory protein or a cytoskeletal element. Login to comment

[hide] A functional CFTR-NBF1 is required for ROMK2-CFTR ... Am J Physiol. 1997 Nov;273(5 Pt 2):F843-8. McNicholas CM, Nason MW Jr, Guggino WB, Schwiebert EM, Hebert SC, Giebisch G, Egan ME
A functional CFTR-NBF1 is required for ROMK2-CFTR interaction.
Am J Physiol. 1997 Nov;273(5 Pt 2):F843-8., [PMID:9374850]

Abstract [show]
In a previous study on inside-out patches of Xenopus oocytes, we demonstrated that the cystic fibrosis transmembrane conductance regulator (CFTR) enhances the glibenclamide sensitivity of a coexpressed inwardly rectifying K+ channel, ROMK2 (C. M. McNicholas, W. B. Guggino, E. M. Schwiebert, S. C. Hebert, G. Giebisch, and M. E. Egan. Proc. Natl. Acad. Sci. USA 93: 8083-8088, 1996). In the present study, we used the two-microelectrode voltage-clamp technique to measure whole cell K+ currents in Xenopus oocytes, and we further characterized the enhanced sensitivity of ROMK2 to glibenclamide by CFTR. Glibenclamide inhibited K+ currents by 56% in oocytes expressing both ROMK2 and CFTR but only 11% in oocytes expressing ROMK2 alone. To examine the role of the first nucleotide binding fold (NBF1) of CFTR in the ROMK2-CFTR interaction, we studied the glibenclamide sensitivity of ROMK2 when coexpressed with CFTR constructs containing mutations in or around the NBF1 domain. In oocytes coinjected with ROMK2 and a truncated construct of CFTR with an intact NBF1 (CFTR-K593X), glibenclamide inhibited K+ currents by 46%. However, in oocytes coinjected with ROMK2 and a CFTR mutant truncated immediately before NBF1 (CFTR-K370X), glibenclamide inhibited K+ currents by 12%. Also, oocytes expressing both ROMK2 and CFTR mutants with naturally occurring NBF1 point mutations, CFTR-G551D or CFTR-A455E, display glibenclamide-inhibitable K+ currents of only 14 and 25%, respectively. Because CFTR mutations that alter the NBF1 domain reduce the glibenclamide sensitivity of the coexpressed ROMK2 channel, we conclude that the NBF1 motif is necessary for the CFTR-ROMK2 interaction that confers sulfonylurea sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 In oocytes coinjected with ROMK2 and a truncated construct of CFTR with an intact NBF1 (CFTR-K593X), glibenclamide inhibited Kϩ currents by 46%. Login to comment
69 The oligonucleotides used for mutagenesis were CFTR-G551D:5Ј GAGTGGAGAT- CAACGAG 3Ј, CFTR-A455E:5Ј GTTGTTGGAGGTTGCTGG 3Ј, CFTR-K370X:5Ј GCAATAAACTAAATACAGGATATCTTAC 3Ј, and CFTR-K593X:5Ј CTGTTAACTGATGGCTAGCAAACTAGG 3Ј. Login to comment
84 To test our hypothesis, we measured the glibenclamide sensitivity of the Kϩ currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment
87 In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment
88 Similar to the effect observed with the coexpression of wild-type CFTR and ROMK2, coexpressing ROMK2:CFTR-K593X elicited Ba2ϩ-sensitive currents that were decreased by 45.8 Ϯ 8.1% (n ϭ 8) after the oocytes were exposed to glibenclamide (Figs. Login to comment
92 Therefore, the mutant CFTR-K593X is similar to CFTR-WT in conferring glibenclamide sensitivity on ROMK2. Login to comment
93 Because mutant CFTR-K593X is a truncated version of CFTR-WT that lacks the latter half of the protein [including the regulatory (R) and NBF2 domains, as well as transmembrane regions 7-12 (see Fig. 2)], this portion of the Fig. 2. Login to comment
96 B: CFTR-K593X, a mutant truncated at residue 593, has an intact NBF1. Login to comment
102 When ROMK2 and CFTR-K370X were coexpressed, the observed Ba2ϩ- sensitive Kϩ currents decreased by only 12.3 Ϯ 3.3% (n ϭ 12) after oocytes were exposed to glibenclamide. Login to comment
107 This minimal reduction in the Ba2ϩ-sensitive current following glibenclamide treatment was significantly less than that observed when ROMK2 was coexpressed with CFTR-WT (P ϭ 0.013, Fig. 1) or with CFTR-K593X (P ϭ 0.013, Fig. 3A) but similar to that observed when ROMK2 was expressed alone (P ϭ 0.73, Fig. 4). Login to comment
110 Sensitivity of CFTR Cl- currents to glibenclamide Construct Whole Cell Current, nA %Inhibition By Glibenclamide n P CFTR-WT 560Ϯ150 51.9 9 CFTR-K593X 190Ϯ31 50.1 8 NS CFTR-K370X 183Ϯ85 44.1 5 NS CFTR-G551D 334Ϯ80 49.6 7 NS CFTR-A455E 299Ϯ27 63.2 5 NS Uninjected 26Ϯ10 0 5 0.02 Values are means Ϯ SE; n is no. of experiments. Login to comment
120 Effect of glibenclamide on Ba2ϩ-sensitive currents for ROMK2 coexpressed with CFTR mutants CFTR-K593X and CFTR-G551D. Login to comment
121 Time course showing whole cell currents at Vhold ϭ -60 mV for Xenopus oocytes expressing ROMK2:CFTR-K593X (A) and ROMK2: CFTR-G551D (B) obtained using 2-microelectrode voltage-clamp techniques. Login to comment
128 Average Ba2ϩ-sensitive whole cell currents for each condition are as follows: ROMK2 alone ϭ 11.35 Ϯ 3.3 µA, ROMK2:CFTR-WT ϭ 8.29 Ϯ 0.9 µA, ROMK2:CFTR-G551D ϭ 5.57 Ϯ 0.66 µA, ROMK2:CFTR-K593X ϭ 2.37 Ϯ 0.7 µA, ROMK2: A455E ϭ 6.26 Ϯ 1.39 µA, and ROMK2:K370X ϭ 5.57 Ϯ 0.66 µA. A455E (Fig. 2). Login to comment
7 In oocytes coinjected with ROMK2 and a truncated construct of CFTR with an intact NBF1 (CFTR-K593X), glibenclamide inhibited K1 currents by 46%. Login to comment
62 The oligonucleotides used for mutagenesis were CFTR-G551D:58 GAGTGGAGAT- CAACGAG 38, CFTR-A455E:58 GTTGTTGGAGGTTGCTGG 38, CFTR-K370X:58 GCAATAAACTAAATACAGGATATCTTAC 38, and CFTR-K593X:58 CTGTTAACTGATGGCTAGCAAACTAGG 38. Login to comment
77 To test our hypothesis, we measured the glibenclamide sensitivity of the K1 currents (using the experimental protocol described above) when ROMK2 was coexpressed with two engineered CFTR-mutant constructs, CFTR-K593X or CFTR-K370X, or two naturally occurring CFTR-mutant constructs, CFTR-G551D or CFTR-A455E (see Fig. 2). Login to comment
80 In our initial experiments with the mutant CFTR constructs, we coexpressed ROMK2 with either CFTR truncated after NBF1 (CFTR-K593X, Fig. 2) or CFTR truncated before NBF1 (CFTR-K370X, Fig. 2). Login to comment
81 Similar to the effect observed with the coexpression of wild-type CFTR and ROMK2, coexpressing ROMK2:CFTR-K593X elicited Ba21-sensitive currents that were decreased by 45.8 6 8.1% (n 5 8) after the oocytes were exposed to glibenclamide (Figs. 3A and 4). Login to comment
85 Because mutant CFTR-K593X is a truncated version of CFTR-WT that lacks the latter half of the protein [including the regulatory (R) and NBF2 domains, as well as transmembrane regions 7-12 (see Fig. 2)], this portion of the Fig. 2. Login to comment
99 This minimal reduction in the Ba21-sensitive current following glibenclamide treatment was significantly less than that observed when ROMK2 was coexpressed with CFTR-WT (P 5 0.013, Fig. 1) or with CFTR-K593X (P 5 0.013, Fig. 3A) but similar to that observed when ROMK2 was expressed alone (P 5 0.73, Fig. 4). Login to comment
112 Effect of glibenclamide on Ba21-sensitive currents for ROMK2 coexpressed with CFTR mutants CFTR-K593X and CFTR-G551D. Login to comment
113 Time course showing whole cell currents at Vhold 5 260 mV for Xenopus oocytes expressing ROMK2:CFTR-K593X (A) and ROMK2: CFTR-G551D (B) obtained using 2-microelectrode voltage-clamp techniques. Login to comment