ABCMdb

ABCC2 p.Ala1450Thr

Predicted by SNAP2:	C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (91%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (91%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: N (87%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
859 Other non-synonymous variants such as 2302C>T (A768W) and 2366C>T (S789F) in exon 18, as well as 4348G>A (A1450T) in exon 31, were found with a frequency of about only 1%. Login to comment
867 Whereas the transport activity of the wild-type, V417I, and A1450T were similar towards the substrates LTC4, 17β estradiol-D-17β-glucuronide (E217βG), and dinitrophenyl-labeled surfactant protein C (DNP-SP), the transport activity of S789F was slightly higher. Login to comment
868 However, this variant and A1450T were also located in intracellular compartments and had a lower apical expression. Login to comment
882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment
147 For example, Hirouchi et al. (2004) found lower MRP2 expression and impaired membrane localization in cells transfected with the ABCC2 variants 2366C>T (Ser789Phe) and 4348G>A (Ala1450Thr), whereas in vivo, Ser789Phe was not associated with changes in plasma conjugated bilirubin levels (Ieiri et al., 2004). Login to comment

[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]

Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Hirouchi and colleagues evaluated the cellular location and function of ABCC2 Val417Ile (1249G>A), Arg768Trp (2302C>T), Ser789Phe (2366C>T), and Ala1450Thr (4348G>A) variants in LLC-PK1 cells, finding that Ser789Phe and Ala1450Thr mutations caused less expression and mislocation [51]. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment

[hide] Polymorphism of the ABC transporter genes, MDR1, M... Pharmacogenetics. 2001 Mar;11(2):175-84. Ito S, Ieiri I, Tanabe M, Suzuki A, Higuchi S, Otsubo K
Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects.
Pharmacogenetics. 2001 Mar;11(2):175-84., [PMID:11266082]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Four were associated with an amino acid substitution; G to A transversion at position 1249 (G1249A, Val to Ile at codon 417) in exon 10, C to T at 2302 (C2302T, Arg to Trp at 768) and C to T at 2366 (C2366T, Ser to Phe at 789) in exon 18, and G to A at 4348 (G4348A, Ala to Thr at 1450) in exon 31 (position numbering: Taniguchi et al., 1996; Toh et al., 1999) (Fig. 3). Login to comment

[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 In the kidney, glomeruli and distal collecting tubules express MRP1, and, in the brain, MRP1 appears to form part of the drug permeability barrier Fig. 1 CF (CFTR/ABCC7) Q1291R E1228G Q1238R G1244E/V G1247R G1249R S1251N S1255P/L W1282G/R/C R1283K/M N1303K Y1307C E1321Q K1351E Q1352H R1268Q V1298F T1301I G1302R A1303P R1314W/Q G1321S R1339C Q1347H I1350L G1354R D1361N Q1382R A1450T R1347E R1351P V1359G/M S1368A G1377R G1382S R1392H R1419C R1435Q G1477R G1479R R1492W E1505K DJS (MRP2/ABCC2) NBD1 NBD2 COOH MEMBRANE MSD MSD MSD 12131415161710116 7 8 91 23 4 5TM H2 N Extracellular Intracellular PXE (ABCC6) PHHI (SUR1/ABCC8) Two-dimensional structure of MRP-related proteins. Login to comment
162 Two other missense variants that affect conserved residues in the NBDs of MRP2 are Ser789Phe (exon 18 C2366T) and Ala1450Thr (exon 31 G4348A) [30,31]. Login to comment

[hide] Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplot... Pharmacogenet Genomics. 2005 Sep;15(9):599-608. Colombo S, Soranzo N, Rotger M, Sprenger R, Bleiber G, Furrer H, Buclin T, Goldstein D, Decosterd L, Telenti A
Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo.
Pharmacogenet Genomics. 2005 Sep;15(9):599-608., [PMID:16041239]

Abstract [show]
OBJECTIVES: The human immunodeficiency virus protease inhibitor nelfinavir is substrate of polyspecific drug transporters encoded by ABCB1 (P-glycoprotein), ABCC1 (MRP1) and ABCC2 (MRP2), and an inhibitor of BCRP, encoded by ABCG2. Genetic polymorphism in these genes may be associated with changes in transport function. METHODS: A comprehensive evaluation of single nucleotide polymorphisms (39 SNPs in ABCB1, 7 in ABCC1, 27 in ABCC2, and 16 in ABCG2), and inferred haplotypes was done to assess possible associations of genetic variants with cellular exposure of nelfinavir in vivo. Analysis used peripheral mononuclear cells from individuals receiving nelfinavir (n=28). Key results were re-examined in a larger sample size (n=129) contributing data on plasma drug levels. RESULTS AND CONCLUSIONS: There was no significant association between cellular nelfinavir area under the curve (AUC) and SNPs or haplotypes at ABCC1, ABCC2, ABCG2. There was an association with cellular exposure for two loci in strong linkage disequilibrium: ABCB1 3435C>T; AUCTT>AUCCT>AUCCC (ratio 2.1, 1.4, 1, Ptrend=0.01), and intron 26 +80T>C; AUCCC> AUCCT > AUCTT (ratio 2.4, 1.3, 1, Ptrend=0.006). Haplotypic analysis using tagging SNPs did not improve the single SNP association values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 - 24C > T exon 1 Itoda et al., 2002 mp-v-004 rs717620 IVS 6-30 G > T intron 6 Epidauros mp-v-051 rs8187666 c.842G > A exon 7 p.S281N Epidauros mp-v-115 c.998G > A intron 7 Epidauros mp-v-083 c.1219C > T exon 10 synonymous (p.L407L) Epidauros mp-v-007 rs8187669 c.1249G > A exon 10 p.V417I Itoda et al., 2002 mp-v-008 rs2273697 c.1346C > G exon 10 synonymous (p.T482T) Epidauros mp-v-114 c.1457C > T exon 10 p.T486I Epidauros mp-v-055 rs8187670 IVS 16 - 47 G > A intron 16 Epidauros mp-v-118 IVS 16 - 30 T > A intron 16 Epidauros mp-v-119 c.2153A > G exon 17 p.N718S Epidauros mp-v-093 rs3740072 c.2216T > C exon 17 p.L739P Epidauros mp-v-108 c.3449G > A exon 25 p.R1150H Mor-Cohen et al., 2001 mp-v-085 c.3517A > T exon 25 p.I1173F Keitel et al., 2003 mp-v-096 c.3521G > A exon 25 p.R1174H Epidauros mp-v-068 c.3542G > T exon 25 p.R1181L Epidauros mp-v-069 rs8187692 c.3563T > A exon 25 p.V1188E Epidauros mp-v-025 rs8187694 IVS 30 - 53 C > T intron 30 Epidauros mp-v-105 rs3824610 c.4348G > A exon 31 p.A1450T Suzuki et al. 2002 mp-v-106 c.4410G > A exon 31 synonymous (p.E1470E) Epidauros mp-v-077 rs8187706 c.4488C > T exon 31 synonymous (p.H1496H) Epidauros mp-v-038 rs8187707 IVS 31 + 12 G > A intron 31 Epidauros mp-v-039 rs8187708 IVS 31 + 74 C > T intron 31 Epidauros mp-v-040 IVS 31 - 9 T > C intron 31 Epidauros mp-v-042 c 4527C > T exon 32 synonymous (p.A1509A) Epidauros mp-v-048 rs8187709 c.4544G > A exon 32 p.C1515Y Epidauros mp-v-043 rs8187710 + 259 G > T 30 flanking Epidauros mp-v-120 Transporter polymorphisms and HIV treatment Colombo et al. 601 BCRP (ABCG2) g. Login to comment

[hide] Multidrug resistance associated proteins as determ... Curr Drug Metab. 2007 Dec;8(8):787-802. Yu XQ, Xue CC, Wang G, Zhou SF
Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs.
Curr Drug Metab. 2007 Dec;8(8):787-802., [PMID:18220559]

Abstract [show]
The multidrug resistance associated proteins (MRP1, MRP2, MRP3, MRP4, MRP5, MRP6, MRP7, MRP8 and MRP9) belong to the ATP-binding cassette superfamily (ABCC family) of transporters. They are expressed differentially in the liver, kidney, intestine, brain and other tissues. These transporters are localized to the apical and/or basolateral membrane of the hepatocytes, enterocytes, renal proximal tubule cells and endothelial cells of the blood-brain barrier. Several MRPs (mainly MRP1-3) are associated with tumor resistance which is often caused by an increased efflux and decreased intracellular accumulation of natural product anticancer drugs and other anticancer agents. MRPs transport a structurally diverse array of important endogenous substances and xenobiotics and their metabolites (in particular conjugates) with different substrate specificity and transport kinetics. Most MRPs are subject to induction and inhibition by a variety of compounds. Several nuclear receptors, including pregnane X receptor (PXR), liver X receptor (LXR), and farnesoid receptor (FXR) participate in the regulation of MRPs. MRPs play an important role in the absorption, distribution and elimination of various drugs in the body and thus may affect their efficacy and toxicity and cause drug-drug interactions. MRPs located in the blood-brain barrier can restrict the penetration of compounds into the central nervous system. Mutation of MRP2 causes Dubin-Johnson syndrome, while mutations in MRP6 are responsible for pseudoxanthoma elasticum. More recently, mutations in mouse Mrp6/Abcc6 gene is associated with dystrophic cardiac calcification (DCC), a disease characterized by hydroxyapatite deposition in necrotic myocytes. A single nucleotide polymorphism, 538G>A in the MRP8/ABCC11 gene, is responsible for determination of earwax type. A better understanding of the function and regulating mechanism of MRPs can help minimize and avoid drug toxicity, unfavourable drug-drug interactions, and to overcome drug resistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
405 Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd…. Login to comment

[hide] Does the A118G polymorphism at the mu-opioid recep... Anesthesiology. 2002 Oct;97(4):814-9. Lotsch J, Zimmermann M, Darimont J, Marx C, Dudziak R, Skarke C, Geisslinger G
Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?
Anesthesiology. 2002 Oct;97(4):814-9., [PMID:12357145]

Abstract [show]
BACKGROUND: Some, but not all, patients with renal dysfunction suffer from side effects after morphine administration because of accumulation of the active metabolite morphine-6-glucuronide (M6G). The current study aims to identify genetic causes that put patients at risk for, or protect them from, opioid side effects related to high plasma M6G. Candidate genetic causes are the single nucleotide polymorphism (SNP) A118G of the mu-opioid-receptor gene (OPRM1), which has recently been identified to result in decreased potency of M6G, and mutations in the MDR1-gene coding P-glycoprotein, of which morphine and M6G might be a substrate. METHODS: Two men, aged 87 and 65 yr, with renal failure (creatinine clearance of 6 and 9 ml/min) received 30 mg/day oral morphine for pain treatment. Both patients had sufficient analgesia from morphine. However, while one patient tolerated morphine well despite high plasma M6G of 1735 nM, in the patient with M6G plasma concentrations of 941 nM it caused severe sleepiness and drowsiness. Patients were genotyped for known SNPs of the OPRM1 and MDR1 genes. RESULTS: The patient who tolerated morphine well despite high plasma M6G was a homozygous carrier of the mutated G118 allele of the mu-opioid-receptor gene, which has been previously related to decreased M6G potency. In contrast, the patient who suffered from side effects was "wild-type" for this mutation. No other differences were found between the OPRM1 and MDR1 genes. CONCLUSIONS: The authors hypothesize that the A118G single nucleotide polymorphism of the mu-opioid-receptor is among the protective factors against M6G-related opioid toxicity. The observation encourages the search for pharmacogenetic reasons that cause interindividual variability of the clinical effects of morphine.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

[hide] Influence of polymorphisms of ABCB1 and ABCC2 on m... Pharmacogenomics J. 2007 Feb;7(1):56-65. Epub 2006 Jun 20. Haenisch S, Zimmermann U, Dazert E, Wruck CJ, Dazert P, Siegmund W, Kroemer HK, Warzok RW, Cascorbi I
Influence of polymorphisms of ABCB1 and ABCC2 on mRNA and protein expression in normal and cancerous kidney cortex.
Pharmacogenomics J. 2007 Feb;7(1):56-65. Epub 2006 Jun 20., [PMID:16788565]

Abstract [show]
There is increasing evidence that polymorphisms of the adenosine 5' triphosphate membrane transporters ABCB1 (P-glycoprotein, MDR1) may affect expression and function, whereas less information is available about the impact of ABCC2 (multidrug resistance-associated protein (MRP2)) single-nucleotide polymorphisms . Particularly, their role in human kidney for drug elimination and in the etiology of renal cell carcinoma is poorly understood. ABCB1 and ABCC2 mRNA and protein expression levels were determined by real-time polymerase chain reaction or immunohistochemistry in kidney cancer and adjacent unaffected cortex tissue of 82 nephrectomized renal cell cancer (RCC) patients (63 clear-cell RCC (CCRCC), 19 non-CCRCC). The DNA of all patients was genotyped for ABCB1 -2352G>A, -692T>C, 2677G>T/A (Ala893Ser/Thr), and 3435C>T, and ABCC2 -24C>T, 1249G>A (Val417Ile) and 3972C>T. ABCB1 and ABCC2 were less expressed in CCRCC than in normal cortex on mRNA as well as on protein level. Although the overall genotype frequency distribution did not differ between the patients and a matched control group, ABCB1 2677T/A and 3435T genotypes were associated with higher (P=0.02 and P=0.04) and ABCC2 -24 T with lower mRNA levels in normal tissues (0.03). The expression of ABCB1 and ABCC2 was not related to genetic variants in RCC tissue. In a reporter gene assay in HepG2 cells, the ABCC2 -24T construct showed an 18.7% reduced activity (P=0.003). In conclusion, ABCB1 and ABCC2 genotypes modulate the expression in the unaffected renal cortex of RCC patients, possibly contributing to inter-individual differences in drug and xenobiotics elimination. Their role in RCC cancer susceptibility or chemotherapy resistance needs further elucidation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 The earlier described ABCC2 SNPs, namely 2302C4T (Arg768Trp), 2366C4T (Ser789Phe) and 4348G4A (Ala1450Thr),43 could not be found in our Caucasian volunteers (data not shown). Login to comment

[hide] Pharmacogenetics of drug transporters in the enter... Pharmacogenomics. 2011 May;12(5):611-31. Stieger B, Meier PJ
Pharmacogenetics of drug transporters in the enterohepatic circulation.
Pharmacogenomics. 2011 May;12(5):611-31., [PMID:21619426]

Abstract [show]
This article summarizes the impact of the pharmacogenetics of drug transporters expressed in the enterohepatic circulation on the pharmacokinetics and pharmacodynamics of drugs. The role of pharmacogenetics in the function of drug transporter proteins in vitro is now well established and evidence is rapidly accumulating from in vivo pharmacokinetic studies, which suggests that genetic variants of drug transporter proteins can translate into clinically relevant phenotypes. However, a large amount of conflicting information on the clinical relevance of drug transporter proteins has so far precluded the emergence of a clear picture regarding the role of drug transporter pharmacogenetics in medical practice. This is very well exemplified by the case of P-glycoprotein (MDR1, ABCB1). The challenge is now to develop pharmacogenetic models with sufficient predictive power to allow for translation into drug therapy. This will require a combination of pharmacogenetics of drug transporters, drug metabolism and pharmacodynamics of the respective drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal efflux transporters (cont.) ABCC2 MRP2 c.1249G>A p.V417I N/A Unchanged [221] c.1249G>A p.S789F N/A Reduced transport protein expression, no change in transport activity [221] c.1249G>A p.A1450T N/A Reduced transport protein expression, no change in transport activity [221] ABCC3 MRP3 c.32G>A p.G11D N/A Unchanged [222] c.1037C>T p.S346F N/A Reduced transport activity [222] c.1820G>A p.S607N N/A Reduced transport activity [222] c.2293G>C p.V765L N/A Unchanged [222] c.2758C>T p.P920S N/A Unchanged [222] c.2768G>A p.R923Q N/A Increased transport activity [222] c.3856G>C p.R1286G N/A Unchanged [222] c.3890G>A p.R1297H 52 Unchanged [131] c.4042C>T p.R1348C N/A Increased transport activity [222] c.4094A>G p.Q1365R N/A Unchanged [222] c.4141C>A p.R1381S N/A Unchanged [222] Liver uptake transporters SLCO1B1 OATP1B1 c.218T>C p.F73L N/A Increased Km , reduced protein synthesis and membrane expression [143] c.245T>C p.V82A N/A [143] c.388A>G p.N130D N/A Increased Km [143] c.455G>A p.R152K N/A [143] c.463C>A p.P155T N/A Unchanged [143] c.467A>G p.E156G N/A [143] c.521T>C p.V174A N/A Decreased Vmax , reduced transport protein expression [143] c.721G>A p.D241N N/A [143] c.1058T>C p.I353T N/A Increased Km , reduced transport protein expression [143] c.1294A>G p.N432D N/A Decreased Vmax [143] c.1385A>G p.D462G N/A Decreased Vmax [143] c.1463G>C p.G488A N/A Reduced intrinsic clearance, reduced transport protein expression [143] c.1964A>G p.D655G N/A Increased Km [143] c.2000A>G p.E667G N/A Unchanged [143] SLCO1B3 OATP1B3 c.334T>G p.S112A N/A Unchanged [223,224] c.439A>G p.T147A N/A Unchanged [223] c.699G>A p.M233I N/A Reduced transport activity, substrate-dependent alteration of Km [223,224] c.767G>C p.G256A N/A Unchanged [223] c.1559A>G p.H520P N/A Reduced transport activity [223] c.1564G>T p.G522C N/A Reduced transport activity [224] c.1679T>C p.V560A N/A Reduced transport activity [223] SLCO2B1 OATP2B1 c.43C>T p.P15S N/A Reduced transport activity [149] c.601G>A p.V201M N/A Reduced transport activity [149] c.1175C>T p.T392I N/A Reduced Vmax [148] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

[hide] Functional analysis of nonsynonymous single nucleo... Pharmacogenet Genomics. 2011 Aug;21(8):506-15. Megaraj V, Zhao T, Paumi CM, Gerk PM, Kim RB, Vore M
Functional analysis of nonsynonymous single nucleotide polymorphisms of multidrug resistance-associated protein 2 (ABCC2).
Pharmacogenet Genomics. 2011 Aug;21(8):506-15., [PMID:21691255]

Abstract [show]
BACKGROUND: Multidrug resistance-associated protein 2 (MRP2; ABCC2) mediates the biliary excretion of glutathione, glucuronide, and sulfate conjugates of endobiotics and xenobiotics. Single nucleotide polymorphisms (SNPs) of MRP2 contribute to interindividual variability in drug disposition and ultimately in drug response. OBJECTIVES: To characterize the transport function of human wild-type (WT) MRP2 and four SNP variants, S789F, A1450T, V417I, and T1477M. METHODS: The four SNP variants were expressed in Sf9 cells using recombinant baculovirus infection. The kinetic parameters [Km, (mumol/l); V(max), (pmol/mg/min); the Hill coefficient] of ATP-dependent transport of leukotriene C(4) (LTC(4)), estradiol-3-glucuronide (E(2)3G), estradiol-17beta-glucuronide (E(2)17G), and tauroursodeoxycholic acid (TUDC) were determined in Sf9-derived plasma membrane vesicles. Transport activity was normalized for expression level. RESULTS: The V(max) for transport activity was decreased for all substrates for S789F, and for all substrates except E(2)17G for A1450T. V417I showed decreased apparent affinity for LTC(4), E(2)3G, and E(2)17G, whereas transport was similar between wild-type (WT) and T1477M, except for a modest increase in TUDC transport. Examination of substrate-stimulated MRP2-dependent ATPase activity of S789F and A1450T, SNPs located in MRP2 nucleotide-binding domains (NBDs), demonstrated significantly decreased ATPase activity and only modestly decreased affinity for ATP compared with WT. CONCLUSION: SNPs in the NBDs (S789F in the D-loop of NBD1, or A1450T near the ABC signature motif of NBD2) variably decreased the transport of all substrates. V417I in membrane spanning domain 1 selectively decreased the apparent affinity for the glutathione and glucuronide conjugated substrates, whereas the T1477M SNP in the carboxyl terminus altered only TUDC transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Objectives To characterize the transport function of human wild-type (WT) MRP2 and four SNP variants, S789F, A1450T, V417I, and T1477M. Login to comment
6 Results The Vmax for transport activity was decreased for all substrates for S789F, and for all substrates except E217G for A1450T. Login to comment
8 Examination of substrate-stimulated MRP2-dependent ATPase activity of S789F and A1450T, SNPs located in MRP2 nucleotide-binding domains (NBDs), demonstrated significantly decreased ATPase activity and only modestly decreased affinity for ATP compared with WT. Login to comment
9 Conclusion SNPs in the NBDs (S789F in the D-loop of NBD1, or A1450T near the ABC signature motif of NBD2) variably decreased the transport of all substrates. Login to comment
48 Construction of recombinant baculovirus containing multidrug resistance protein 2 The plasmid (pEF6/V5-His-TOPO; Invitrogen) containing the WT MRP2 (NM_000392) or its SNP variants S789F, A1450T, V417I, and T1477M, was used to create the MRP2 baculovirus expression vector. Login to comment
49 The pENTR 4 vector (Invitrogen) was mutated to generate a Hind III site using Quik Change II site-directed mutagenesis Kit (Stratagene; La Jolla, California, USA) using primers Hind IIIF and Hind IIIR (Hind IIIF: AGGCTCCAC- CATGGGAAGCTTCAGTCGACTGGATC; Hind IIIR: Table 1 Nucleotide sequence of variants in MRP2 leading to amino acid changes in multidrug resistance-associated protein 2 and their allelic frequencya SNP position Amino acid change Exon Location Allelic frequency Functional consequencesb C2366T S789F 18 NBD1 (D loop) 0.01 (Japanese) 52 G4348A A1450T 31 NBD2 (immediately after the ABC signature motif) 0.01 (Japanese) 52 G1249A V417I 10 MSD1 (between transmembrane helices 7 and 8) 0.125/0.312/0.184 (Japanese/Iranian/Moroccan) 27,46,47,52,58,59 C4430T T1477M 31 Carboxy terminal 0.006 (Japanese) MSD, membrane-spanning domain; NBD, nucleotide-binding domain; SNP, single nucleotide polymorphism. Login to comment
56 The pENTR4M containing the WT, S789F, A1450T, V417I, and T1477M SNPs were sequenced (MWG Biotech, Inc., Huntsville, Alabama, USA). Login to comment
97 Protein expression of wild-type multidrug resistance-associated protein 2 and single nucleotide polymorphism variants in Sf9 cells WT MRP2 and the SNP variants S789F, A1450T, V417I, and T1477M were expressed in Sf9 cells using recombinant baculovirus. Login to comment
102 However, there was no significant difference in the expression of V417I in MSD1 or of A1450T in NBD2 compared with WT MRP2 (Fig. 1b). Login to comment
108 LTC4 and E23G were transported with classic Michaelis-Menten kinetics by WT MRP2; however, E217G and TUDC demonstrated positive Fig. 1 8000 6000 4000 Density(%)INT/mm2 2000 0 T1477M * V417IA1450TS789F * WTEV 185 KD EV WT S789F A1450T V417I T1477M (a) (b) Expression of WT multidrug resistance-associated protein 2 (MRP2) and its variants in Sf9 plasma membranes. Login to comment
121 The A1450T variant, which is located immediately after the ABC signature motif of NBD2, showed a 30-55% decrease in the Vmax for transport of LTC4, E23G, and TUDC, but not for E217G, whereas the apparent affinity for all of the substrates tested was not different from that of WT MRP2 (Fig. 2a-d; Table 2). Login to comment
126 Substrate-stimulated ATPase activity of multidrug resistance-associated protein 2 and single nucleotide polymorphism variants To identify the mechanism of reduced transport activity of the SNP variants, S789F and A1450T, located in the ATP-binding domains, we determined their vanadate-sensitive ATPase activity in the presence of E217G (300 mmol/l). Login to comment
131 S789F and A1450T exhibited vanadate-sensitive ATPase activity that was stimulated by E217G, however, the ATPase activity of S789F and A1450T was significantly decreased by 37 and 20%, respectively, compared with WT MRP2 (Fig. 3a). Login to comment
132 To determine whether the maximal rates of ATP hydrolysis or affinity for the nucleotide were altered by the mutation seen in SNP variants S789F and A1450T, we compared their Km for ATP with that of WT MRP2 (Fig. 3b; Table 3). Login to comment
133 Vesicular transport studies over a wide range of concentrations of ATP and a fixed E217G concentration (300 mmol/l) showed that the apparent Km values for ATP were increased modestly but not significantly in both S789F (125 mmol/l) and A1450T (101 mmol/l), compared with WT MRP2 (79 mmol/l) (Fig. 3b; Table 3). Login to comment
134 The Vmax values were significantly decreased to 68% in S789Fand to 85% in A1450T (Table 3), consistent with the decreased E217G Vmax values seen in the saturation kinetics study (Table 2). Login to comment
136 Four SNPs were selected for characterization, one in each of the two NBDs (S789F in NBD1 and A1450T in NBD2), one in MSD1 (V417I), and one in the carboxy terminal (T1477M), to probe how changes in these portions of MRP2 protein might impact its transport properties. Login to comment
138 The MRP2 variant S789F, located in the D-loop of NBD1, consistently decreased the Vmax for transport of all four substrates, whereas A1450T, located immediately after the ABC signature motif in NBD2, decreased the Vmax for all substrates except E217G. Login to comment
145 We, therefore, questioned whether S789F, most likely located in NBS2, and A1450T, likely located in NBS1, might have differential effects on ATP binding and hydrolysis. Login to comment
146 ATPase activity was significantly inhibited in both S789F and A1450T (Fig. 3a); whereas inhibition of ATPase activity was greater for S789F (37%) than A1450T (20%), the data did not permit unequivocal determination of the differential roles of NBS1 and NBS2 in ATP hydrolysis. Login to comment
148 These data imply that irrespective of their locations in NBS1 or NBS2, neither variant S789F nor A1450T is directly involved in ATP binding, but rather both variants impact transport by decreasing ATP hydrolysis. Login to comment
150 These data imply that valine 417 plays a critical and selective role in binding of glutathione Table 2 Kinetic parameters for transport of substrates by wild-type multidrug resistance-associated protein 2 and four single nucleotide polymorphism variants Substrates Kinetic parameters WT S789F A1450T V417I T1477M LTC4 Km 4 (1.8-6.5) 3 (1.8-4.4) 3 (2-3.6) 9 (7.8-12.7)* 6 (3.5-9) Vmax 1464 (1314-1713) 732 (648-816)* 658 (618-699)* 1366 (1200-1531) 1659 (1373-1945) E23G Km 103 (73-133) 235 (173-296)* 106 (64-148) 212 (95-330) 172 (88-230) Vmax 1458 (1339-1578) 615 (558-671)* 855 (746-964)* 1794 (1454-2134) 1157 (975-1338)* E217bG Km 84 (64-104) 72 (67-76) 88 (75-100) 263 (241-285)* 94 (89-100) Vmax 3154 (2691-3617) 1799 (1732-1866)* 2665 (2422-2907) 2647 (2520-2773) 2646 (2555-2737) HC 2.2 (1.4-3) 2.4 (2.1-2.6) 2 (1.6-2.4) 1.1 (1.1-1.2)* 1.8 (1.7-1.9) TUDC Km 71 (65-78) 64 (71-96) 71 (57-86) 74 (70-79) 109 (103-116)* Vmax 595 (563-627) 359 (343-376)* 424 (376-472)* 577 (553-600) 671 (645-699)* HC 2 (1.7-2.3) 2.3 (1.9-2.6) 1.8 (1.3-2.3) 2.6 (2.3-2.8) 2.2 (2-2.4) The kinetic parameters [Km (mmol/l); Vmax (pmol/mg/min); HC] of ATP-dependent transport of LTC4, E23G, E217G, and TUDC were determined in Sf9 plasma membrane vesicles. Login to comment
169 To ensure that the reduced expression was not antibody-dependent, we performed immunoblots using two antibodies, M2 Fig. 3 25(a) (b) 20 15 VanadatesensitiveATPaseactivity3 H-E217Gtransport(pmol/min/mg) 10 5 0 A1450TS789FWTEV 3000 2000 1000 0 7500500025000 ** ** * ATP (μmol/l) WT S789FA1450T (a) ATPase activity of Sf9 membranes expressing wild-type (WT) multidrug resistance-associated protein 2 (MRP2) and the single nucleotide polymorphism (SNP) variants S789F and A1450T. Login to comment
174 Transport in the Sf9 membrane vesicles expressing WT, or variants S789F and A1450T was measured in the presence of various concentrations of ATP ranging from 50 mmol/l to 7 mmol/l at a fixed concentration of [3 H]E217G (300 mmol/l) for 2 min at 371C. Login to comment
177 Table 3 Kinetic parameters for ATP in wild-type multidrug resistance-associated protein 2 and variants S789F and A1450T Kinetic parameters WT S789F A1450T Km 79 (43-114) 125 (96-155) 101 (57-146) Vmax 2630 (2433-2927) 1796 (1721-1870)* 2242 (2071-2413)* Nonlinear regression results [Km, (mmol/l); Vmax (pmol/mg/min)] were obtained from data in Fig. 3b. Login to comment
190 Hirouchi et al. [52] also characterized the expression and transport activity of several MRP2 variants (V417I, S789F, A1450T) using a Tet-off recombinant adenovirus system in LLC-PK1 cells. Login to comment
194 Finally, these researchers also showed a marked reduction in the expression of both S789F and A1450T to 24 and 18% of WT MRP2, respectively, such that transport of E217G by A1450T was too low to be normalized by its expression level [52]. Login to comment
196 These discrepancies, particularly in A1450T expression, indicate that the results of in-vitro transporter expression should be extrapolated to in-vivo situations with caution. Login to comment
200 Even though the SNPs, S789F and A1450T, exist with low allelic frequency, the decreased expression and transport function of S789F and decreased transport activity of A1450T shown here could impact drug disposition in polymorphic individuals. Login to comment
201 Most likely because of the relative rarity of these SNPs, there are no reports of an association between S789F or A1450T and altered pharmacokinetics of MRP2 substrates. Login to comment

[hide] ABCC2/Abcc2: a multispecific transporter with domi... Drug Metab Rev. 2010 Aug;42(3):402-36. Jemnitz K, Heredi-Szabo K, Janossy J, Ioja E, Vereczkey L, Krajcsi P
ABCC2/Abcc2: a multispecific transporter with dominant excretory functions.
Drug Metab Rev. 2010 Aug;42(3):402-36., [PMID:20082599]

Abstract [show]
ABCC2/Abcc2 (MRP2/Mrp2) is expressed at major physiological barriers, such as the canalicular membrane of liver cells, kidney proximal tubule epithelial cells, enterocytes of the small and large intestine, and syncytiotrophoblast of the placenta. ABCC2/Abcc2 always localizes in the apical membranes. Although ABCC2/Abcc2 transports a variety of amphiphilic anions that belong to different classes of molecules, such as endogenous compounds (e.g., bilirubin-glucuronides), drugs, toxic chemicals, nutraceuticals, and their conjugates, it displays a preference for phase II conjugates. Phenotypically, the most obvious consequence of mutations in ABCC2 that lead to Dubin-Johnson syndrome is conjugate hyperbilirubinemia. ABCC2/Abcc2 harbors multiple binding sites and displays complex transport kinetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Mutant Predicted location Substrate Activity changes Reference Human MRP2 Δ1-188 TMD0 LTC4 ↓ Fernandez et al., 2002 K316A JC, TM6 GMF ↔ Ryu et al., 2000 K324A TM6 GMF ↓ Ryu et al., 2000 K329A TM6 GMF ↔ Ryu et al., 2000 R412G DJ IC MTX ↓ Hulot et al., 2005 W417I IC, TM7-TM8 E2-17βG ↓ Hirouchi et al., 2004 LTC4 ↓ DNP-SG ↓ H439A TM8 GMF ↔ Ryu et al., 2000 K483A IC, JM, TM9 GMF ↓ Ryu et al., 2000 K590A JC, TM11 GMF ↔ Ryu et al., 2000 S789F NBD1 E2-17βG ↓ Hirouchi et al., 2004 LTC4 ↓ DNP-SG ↓↓ R1023A EC, JM, TM13 GMF ↔ Ryu et al., 2000 H1042A TM13 GMF ↔ Ryu et al., 2000 R1100A JC, TM14 GMF ↔ Ryu et al., 2000 P1158A IC, JM, TM15 LTC4 ↓↓ Letourneau et al., 2007 E2-17βG ↔ MTX ↔ Table 1. continued on next page Mutant Predicted location Substrate Activity changes Reference I1173F DJ IC, TM15-16 LTC4 No act Keitel et al., 2003 E2-17βG No act R1210A EC, JC, TM16 GMF ↓↓ Ryu et al., 2000 R1230A TM16 GMF ↔ R1257A JC, TM17 GMF ↓↓ W1254A JC, TM17 E2-17βG ↓↓ Ito et al., 2001a W1254C ↓↓ W1254F ↔ W1254Y ↔ W1254A JC, TM17 LTC4 ↓↓ Ito et al., 2001b W1254C ↓↓↓ W1254F ↓↓ W1254Y ↓↓ W1254A JC, TM17 MTX ↓↓ Ito et al., 2001a W1254C ↓↓ W1254F ↓↓ W1254Y ↓↓↓ A1450T NBD2 E2-17βG ↓↓ Hirouchi et al., 2004 LTC4 ↓↓ DNP-SG ↓↓ Rat Mrp2 K308M IC, JM, TM6 TLC-S ↔ Ito et al., 2001b DNP-G ↑ LTC4 ↓ E3040G ↔ K320M TM6 TLC-S ↑ DNP-G ↑ LTC4 ↓ E3040G ↑ K325M TM6 TLC-S ↓* DNP-G ↓↓↓* LTC4 ↓↓↓* E3040G ↓ D329N TM6 TLC-S ↔ DNP-G ↓ LTC4 ↓↓↓* E3040G ↓ R586L TM11 TLC-S ↓ DNP-G ↓↓* LTC4 ↓↓* E3040G ↔ R1019M IC, JM, TM13 TLC-S ↔ DNP-G ↑* LTC4 ↔ E3040G ↔ R1096L TM14 TLC-S ↑ DNP-G ↑ LTC4 ↔ E3040G ↔ EC, extracellular; IC, intracellular; JC, near the cytosol in the membrane; JM, juxtamembrane; TLC-S, tauro-litocholate-sulfate; GMF, glutathione- methyl-fluorescein; ↑, activity over control>1.2; ↔, 1.2>activity over control>0.8; ↓, 0.8>activity over control>0.5; ↓↓, 0.5>activity over control>0.1; ↓↓↓, 0.1>activity over control. Login to comment

[hide] Influence of genetic polymorphisms on intestinal e... Pharmacogenet Genomics. 2008 Apr;18(4):357-65. Haenisch S, May K, Wegner D, Caliebe A, Cascorbi I, Siegmund W
Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol.
Pharmacogenet Genomics. 2008 Apr;18(4):357-65., [PMID:18334920]

Abstract [show]
OBJECTIVES: To evaluate whether ABCC2 gene polymorphisms are associated with expression and/or function of the efflux pump. METHODS: We investigated the allele frequency of ABCC2 -24C>T, -23G>A, c.1249G>A, c.1446C>G, c.1457C>T, c.2302C>T, c.2366C>T, c.3542G>T, c.3561G>A, c.3563T>A, c.3972C>T, c.4348G>A, and 4544G>A in 374 nonrelated German healthy volunteers and determined the impact on duodenal mRNA and protein content of ABCC2. For functional analysis, the disposition of intravenously (30 mg) and orally administered talinolol (100 mg) was measured among 31 individuals. Moreover, the effects of rifampicin-type induction (600 mg, 8 days) of duodenal ABCC2 were quantified in 22 participants with regard to genetic polymorphisms. RESULTS: The allele frequencies were 18.3% (-24T), 21.1% (1249A), 1.4% (1446G), 0.1% (3542T), 4.5% (3563A), 34.2% (3972T), and 4.4% (4544A); carriers of -23G>A, 1457C>T, 2302C>T, 2366C>T, 3561G>A, and 4348G>A were not identified. The -24T allele was in strong linkage with 3972T, and 3563A with 4544A, whereas 1249A was weakly linked with other variant alleles. None of the single nucleotide polymorphisms investigated influenced significantly intestinal ABCC2 mRNA and protein content. The variant ABCC2 1249G>A (V417I), however, was associated with lower oral bioavailability (P=0.001), and increased residual clearance of intravenous talinolol (P=0.021). Intestinal ABCC2 mRNA and protein expression were upregulated by rifampicin treatment, a genetic influence could be detected in only four cases heterozygote for 3563T>A or 4544G>A. CONCLUSION: The 1249G>A (V417I) polymorphism is obviously associated with higher activity of the intestinal transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Genotyping The ABCC2 SNPs -24C > T (rs717620), c.1249G > A (V417I, rs2273697), c.2302C > T (Arg768Trp), c.2366C > T (Ser789Phe), c.3972C > T (I1324I, rs3740066), c.4348G > A (Ala1450Thr) were genotyped using PCR-restriction fragment length polymorphism (RFLP) analysis. Login to comment

[hide] The apical conjugate efflux pump ABCC2 (MRP2). Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18. Nies AT, Keppler D
The apical conjugate efflux pump ABCC2 (MRP2).
Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18., [PMID:16847695]

Abstract [show]
ABCC2 is a member of the multidrug resistance protein subfamily localized exclusively to the apical membrane domain of polarized cells, such as hepatocytes, renal proximal tubule epithelia, and intestinal epithelia. This localization supports the function of ABCC2 in the terminal excretion and detoxification of endogenous and xenobiotic organic anions, particularly in the unidirectional efflux of substances conjugated with glutathione, glucuronate, or sulfate, as exemplified by leukotriene C(4), bilirubin glucuronosides, and some steroid sulfates. The hepatic ABCC2 pump contributes to the driving forces of bile flow. Acquired or hereditary deficiency of ABCC2, the latter known as Dubin-Johnson syndrome in humans, causes an increased concentration of bilirubin glucuronosides in blood because of their efflux from hepatocytes via the basolateral ABCC3, which compensates for the deficiency in ABCC2-mediated apical efflux. In this article we provide an overview on the molecular characteristics of ABCC2 and its expression in various tissues and species. We discuss the transcriptional and posttranscriptional regulation of ABCC2 and review approaches to the functional analysis providing information on its substrate specificity. A comprehensive list of sequence variants in the human ABCC2 gene summarizes predicted and proven functional consequences, including variants leading to Dubin-Johnson syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
151 These Abcc2-deficient mice are apparently healthy and fertile, as are Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references damaging transport function [47] Exon 30 c.4175_4180del6 p.R1392_M1393del2 DJS No ABCC2 protein in liver [170] Impaired sorting and trafficking [79] [79, 170] Exon 31 c.4348 G>A p.A1450T Possibly damaging Reduced protein levels [50] T: 0.010 [62] [62] Exon 31 c.4430 C>T p.T1477M Benign T: 0.006 [51] Exon 32 c.4544 G>A p.C1515Y Benign A: 0.047 rs8187710 A: 0.116 rs17222568 NCBI National Center for Biotechnology Information, SNP single nucleotide polymorphism, DJS Dubin-Johnson syndrome a As recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen) and by ref [26], nucleotide position +1 is the A of the ATG of the translation initiation codon in the ABCC2 cDNA sequence, "c." Login to comment
152 These Abcc2-deficient mice are apparently healthy and fertile, as are Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references damaging transport function [47] Exon 30 c.4175_4180del6 p.R1392_M1393del2 DJS No ABCC2 protein in liver [170] Impaired sorting and trafficking [79] [79, 170] Exon 31 c.4348 G>A p.A1450T Possibly damaging Reduced protein levels [50] T: 0.010 [62] [62] Exon 31 c.4430 C>T p.T1477M Benign T: 0.006 [51] Exon 32 c.4544 G>A p.C1515Y Benign A: 0.047 rs8187710 A: 0.116 rs17222568 NCBI National Center for Biotechnology Information, SNP single nucleotide polymorphism, DJS Dubin-Johnson syndrome a As recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen) and by ref [26], nucleotide position +1 is the A of the ATG of the translation initiation codon in the ABCC2 cDNA sequence, "c." Login to comment

[hide] Single nucleotide polymorphisms in ABCC2 and ABCB1... Cancer Lett. 2006 Mar 8;234(1):40-50. Epub 2005 Dec 27. Wada M
Single nucleotide polymorphisms in ABCC2 and ABCB1 genes and their clinical impact in physiology and drug response.
Cancer Lett. 2006 Mar 8;234(1):40-50. Epub 2005 Dec 27., [PMID:16377077]

Abstract [show]
Among the ABC proteins, some members including ABCB1, ABCC1, ABCC2 and ABCG2 are believed to contribute to multidrug resistance of cancer chemotherapy. In addition, the broad substrate-specificity and apical localization of the ABCB1 and ABCC2 in mucosal epithelium of intestine and hepatocyte give them a protective role against xenobiotics. The inter-individual variations in activity and expression levels of ABCB1 and ABCC2, thus, might affect on drug response and response to toxic substrates. In this review, I focus on (1) physiological and toxicological relevance of ABCB1 and ABCC2, and on (2) genetic variations of ABCB1 and ABCC2 genes and their association with biochemical function, expression level and tumor incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 [38,53] 31 4348GOA A1450T NBD2 (Transport activity) Not reported 0.4? Login to comment

[hide] Treatment of hyperbilirubinemia in Eisai hyperbili... Pharm Res. 2005 Apr;22(4):661-6. Epub 2005 Apr 7. Hirouchi M, Suzuki H, Sugiyama Y
Treatment of hyperbilirubinemia in Eisai hyperbilirubinemic rat by transfecting human MRP2/ABCC2 gene.
Pharm Res. 2005 Apr;22(4):661-6. Epub 2005 Apr 7., [PMID:15846474]

Abstract [show]
PURPOSE: Multidrug resistance-associated protein 2 (MRP2/ABCC2) is predominantly expressed in the liver canalicular membrane and plays an important role in the biliary excretion of organic anions including glucuronide and glutathione conjugates. The purpose of this study is to construct a new evaluation system for human MRP2 by expressing human MRP2 in Eisai hyperbilirubinemic rat (EHBR) liver, the rat Mrp2 function of which is hereditarily defective. METHODS: In order to express human MRP2 in liver, we used the Tet-off adenovirus expression system. After 72 h infection, we evaluated the protein expression and localization in the liver and the transport activity of [(3)H]E(2)17ssG and [(3)H]DNP-SG by preparing canalicular membrane vesicles (CMVs). We also evaluated the biliary excretion and plasma concentration of DBSP after bolus administration and the plasma concentration of endogenous direct and indirect bilirubin. RESULTS: The localization of human MRP2 in EHBR liver was found to be at the bile canalicular membrane. Clear ATP-dependent uptake of [(3)H]E(2)17ssG and [(3)H]DNP-SG into CMVs was observed by using the CMVs prepared from the liver where human MRP2 was transfected. Furthermore, the blood to bile clearance of DBSP increased approximately 3-fold after expression of human MRP2. In addition, the plasma direct bilirubin level in EHBR was reduced by the expression of human MRP2. CONCLUSIONS: These results suggest that this evaluation system for human MRP2 may be useful for evaluating the function of human MRP2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Although the wild-type MRP2 was exclusively localized at the apical membrane, S789F and A1450T MRP2 were located not only at the apical membrane but also in the intracellular compartment, suggesting that the in vivo function of these two kinds of variants may be lower than wild type MRP2 (12). Login to comment

[hide] Characterization of the cellular localization, exp... Pharm Res. 2004 May;21(5):742-8. Hirouchi M, Suzuki H, Itoda M, Ozawa S, Sawada J, Ieiri I, Ohtsubo K, Sugiyama Y
Characterization of the cellular localization, expression level, and function of SNP variants of MRP2/ABCC2.
Pharm Res. 2004 May;21(5):742-8., [PMID:15180328]

Abstract [show]
PURPOSE: The presence of single nucleotide polymorphisms (SNPs) has been reported for multidrug resistance-associated protein 2 (MRP2/ABCC2). The purpose of the current study was to characterize the localization, expression level, and function of MRP2 variants. METHODS: The expression and cellular localization of the wild-type and three kinds of reported SNP variants of MRP2 molecules were analyzed in LLC-PK1 cells after infection with the recombinant Tet-off adenoviruses. Their function was determined by using the isolated membrane vesicles from the infected LLC-PK1 cells. RESULTS: The transport activity for E217betaG, LTC4, and DNP-SG, normalized by the expression level of MRP2, was similar between the wild-type, V417I, and A1450T MRP2s. The transport activity of S789F MRP2 was slightly higher than that of wild-type MRP2. However, the expression level of S789F and A1450T MRP2 proteins was significantly lower compared with the wild-type and V417I MRP2. In addition, although the wild-type and V417I MRP2 were exclusively localized in the apical membrane, S789F and A1450T MRP2 were located in the apical membrane and also in the intracellular compartment. CONCLUSIONS: These results suggest that the most frequently observed V417I substitution may not affect the in vivo function of MRP2, whereas the much less frequently observed S789F and A1450T may be associated with the reduced in vivo function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The transport activity for E217betaG, LTC4, and DNP-SG, normalized by the expression level of MRP2, was similar between the wild-type, V417I, and A1450T MRP2s. Login to comment
9 However, the expression level of S789F and A1450T MRP2 proteins was significantly lower compared with the wild-type and V417I MRP2. Login to comment
10 In addition, although the wild-type and V417I MRP2 were exclusively localized in the apical membrane, S789F and A1450T MRP2 were located in the apical membrane and also in the intracellular compartment. Login to comment
12 These results suggest that the most frequently observed V417I substitution may not affect the in vivo function of MRP2, whereas the much less frequently observed S789F and A1450T may be associated with the reduced in vivo function. Login to comment
26 Only one respective heterozygote subject was observed out of 48 volunteers for C2302T (exon 18, Arg768Trp), C2366T (exon 18, Ser789Phe), and G4348A (exon 31, Ala1450Thr) (19), and their allele frequency was calculated to be 1%. Login to comment
43 We have generated the following four kinds of missense mutations reported previously: Val417Ile, Arg768Trp, Ser789Phe, and Ala1450Thr. Login to comment
86 The expression level of V417I, S789F, and A1450T MRP2 was 82% and 80%, 23% and 25%, and 18% and 8%, respectively, in duplicate experiments (Fig. 1). Login to comment
94 V417I MRP2 showed the same localization as wild-type MRP2 (Fig. 2), whereas two variants (S789F and A1450T MRP2s) were expressed not only at the apical surface, but also intracellularly (Fig. 2). Login to comment
95 The fraction of A1450T MRP2 located intracellularly was higher than that of S789F MRP2 (Fig. 2). Login to comment
101 For A1450T, the expression level was too low to detect the transport function of E217betaG (Fig. 3d), whereas the normalized uptake of DNP-SG and LTC4 was almost identical to that of the wild-type (Figs. 4b and 4c). Login to comment
122 The uptake of E217betaG by A1450T was too low to be normalized by the expression level (Fig. 3d). Login to comment
123 Key: ᭺, tTA; ᭹, wt-MRP2; ᮀ, V417I; ᭿, S789F; ᭝, A1450T. Login to comment
137 In contrast, the transport activity of glutathione-conjugates (LTC4 and DNP-SG) in membrane vesicles expressing A1450T MRTP2 was 1/4 to 1/5 of that in the membrane vesicles expressing wild-type MRP2, whereas A1450T MRP2-mediated transport of E217betaG was much less than wild-type MRP2-mediated transport of this glucuronide- conjugate (Figs. 3 and 4). Login to comment
148 In contrast, S789F and A1450T MRP2s were expressed not only at the apical surface, but also in the intracellular compartment. Login to comment
150 It is possible that the low expression of S789F and A1450T MRP2s may be due to the degradation of the protein synthesized in the infected cells. Login to comment
153 It is possible that the two variants examined in the current study (S789F and A1450T) are also degraded in the same manner. Login to comment
161 S789F and A1450T MRP2s is low compared with that of the wild type. Login to comment
162 Due to this low expression level on the apical surface, it is possible that the function of S789F and A1450T MRP2s under in vivo conditions is much lower compared with that of wild-type MRP2. Login to comment
165 Of the 48 Japanese subjects studied, both S789F and A1450T SNPs were only found in one heterozygous subject and, consequently, their allele frequency was calculated to be only 1%. Login to comment
167 Because S789F and A1450T MRP2s are located within the first and second nucleotide binding domains, respectively, where the DJS mutations are frequently located, it is possible that S789F and A1450T SNPs are associated with the pathogenesis of DJS. Login to comment
170 Although the transport activity per MRP2 molecule was not significantly decreased in much less frequently observed S789F and A1450T MRP2s, their expression level was significantly lower than wild-type MRP2, which may be associated with their intracellular localization. Login to comment

[hide] Single nucleotide polymorphisms in multidrug resis... Adv Drug Deliv Rev. 2002 Nov 18;54(10):1311-31. Suzuki H, Sugiyama Y
Single nucleotide polymorphisms in multidrug resistance associated protein 2 (MRP2/ABCC2): its impact on drug disposition.
Adv Drug Deliv Rev. 2002 Nov 18;54(10):1311-31., [PMID:12406647]

Abstract [show]
Multidrug resistance associated protein 2 (MRP2/ABCC2), expressed on the bile canalicular membrane, plays an important role in the biliary excretion of various kinds of substrates. In addition, MRP2 is also expressed on the apical membrane of epithelial cells such as enterocytes. It is possible that the inter-individual difference in the function of MRP2 affects the drug disposition. In the present article, we will summarize the physiological and pharmacological role of MRP2, particularly focusing on the factors affecting its transport function such as single nucleotide polymorphisms and/or the induction/down regulation of this transporter. Mutations found in patients suffering from the Dubin-Johnson syndrome, along with the amino acid residues which are involved in supporting the transport activity of MRP2, are also summarized.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
138 [116] suggested that this G4348A (exon 31, Ala1450Thr) (Fig. 3) [118]. Login to comment
159 It is possible that the induction by G4348A/Ala1450Thr mutation is located in the food and/or drugs may also be at least partly Walker C motif within the carboxy terminal NBD involved in determining the expression level of region, which may affect MRP2 function. Login to comment

[hide] Regulation of expression of the multidrug resistan... J Pharmacol Exp Ther. 2002 Aug;302(2):407-15. Gerk PM, Vore M
Regulation of expression of the multidrug resistance-associated protein 2 (MRP2) and its role in drug disposition.
J Pharmacol Exp Ther. 2002 Aug;302(2):407-15., [PMID:12130697]

Abstract [show]
The multidrug resistance protein 2 (MRP2; ABCC2) is an ATP-binding cassette transporter accepting a diverse range of substrates, including glutathione, glucuronide, and sulfate conjugates of many endo- and xenobiotics. MRP2 generally performs excretory or protective roles, and it is expressed on the apical domain of hepatocytes, enterocytes of the proximal small intestine, and proximal renal tubular cells, as well as in the brain and the placenta. MRP2 is regulated at several levels, including membrane retrieval and reinsertion, translation, and transcription. In addition to transport of conjugates, MRP2 transports cancer chemotherapeutics, uricosurics, antibiotics, leukotrienes, glutathione, toxins, and heavy metals. Several mutagenesis studies have described critical residues for substrate binding and various naturally occurring mutations that eliminate MRP2 expression or function. MRP2 is important clinically as it modulates the pharmacokinetics of many drugs, and its expression and activity are also altered by certain drugs and disease states.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Site-directed mutagenesis studies substi- TABLE 1 Mutations in human MRP2 Mutation Location Translation Domain Phenotype Reference -24(C-T) Promoter 5Ј-UTR Not reported (Ito et al., 2001e) 1249(G-A)/wt Exon 10 V4171 MSD2 Not reported (Ito et al., 2001e) 1815ϩ2(T-A)/1815ϩ2(T-A) Exon 13 147-bp deletion MSD2 DJS (Wada et al., 1998; Toh et al., 1999) 2002del67/2002del67 Exon 16 Premature termination codon NBD1 DJS (Konig et al., 1999a) 2302(C-T)/2302(C-T) Exon 18 R768W/R768W NBD1 DJS (Wada et al., 1998; Toh et al., 1999; Ito et al., 2001e) 2302(C-T)/2439ϩ2(T-C) Exon 18 R768W/168-bp deletion NBD1 DJS (Toh et al., 1999) 2302(C-T)/wt Exon 18 R768W/wt NBD1 Increased UCP1 (Toh et al., 1999) 2366(C-T)/wt Exon 18 S789F/wt NBD1 Not reported (Ito et al., 2001e) 2439ϩ2(T-C)/2439ϩ2(T-C) Exon 18 168-bp deletion/168-bp deletion NBD1 DJS (Wada et al., 1998; Toh et al., 1999) 2439ϩ2(T-C)/4145(A-G) Exon 18/29 168-bp deletion/Q1328R NBD1/2 DJS (Toh et al., 1999) 2439ϩ2(T-C)/wt Exon 18 168-bp deletion/wt NBD1 Increased UCP1 (Toh et al., 1999) 3196(C-T)/3196(C-T) Exon 23 Premature termination codon MSD3 DJS (Paulusma et al., 1997; Tsujii et al., 1999) 3449(G-A)/3449(G-A) Exon 25 R1150H/R1150H MSD3 DJS (Mor-Cohen et al., 2001) 3517(A-T)/3517(A-T) Exon 25 I1173F/I1173F MSD3 DJS (Mor-Cohen et al., 2001) 3972(C-T)/wt Exon 28 I1324I/wt near NBD2 None (Ito et al., 2001e) 4175del6 Exon 30 Loss of R1392 and M1393 NBD2 DJS (Tsujii et al., 1999) 4348(G-A)/wt Exon 31 A1450T/wt NBD2 Not reported (Ito et al., 2001e) UTR, untranslated region; wt, wild type; bp, base pair; UCP1, urinary coproporphyrin fraction 1. tuting the cationic amino acid Arg586 and Arg1096 in rat Mrp2 with neutral amino acids (R586L, R586I, R1096L, and R1096M) or a cationic amino acid (R1096K) led to acquisition of taurocholate transport and retention of glucuronide and glutathione conjugate transport by Mrp2 (Ito et al., 2001d). Login to comment

[hide] Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found... Drug Metab Dispos. 2002 Apr;30(4):363-4. Itoda M, Saito Y, Soyama A, Saeki M, Murayama N, Ishida S, Sai K, Nagano M, Suzuki H, Sugiyama Y, Ozawa S, Sawada Ji J
Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28.
Drug Metab Dispos. 2002 Apr;30(4):363-4., [PMID:11901087]

Abstract [show]
We found nucleotide variability in the 5'-upstream region and exonic sequences of a gene-encoding canalicular multispecific organic anion transporter/multidrug resistance-associated protein 2 (cMOAT/MRP2) by polymerase chain reaction-based sequencing using genomic DNA from 72 established cell lines derived from 72 Japanese individuals. Four single nucleotide polymorphisms (SNPs) were found in the 5'-untranslational region and 21 in the exonic regions. Of them, 14 were nonsynonymous SNPs. One deletion of seven consecutive adenines resulting in a frameshift variant was also found. Four SNPs, c-24t, g1249a (V417I), c2366t (S789F), and c3972t (I1324I), were the same as those recently reported. A strong association was found between c-24t (5'-untranslated region) and c3972t (exon 28), with the promoter activity of the former worth being compared.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

[hide] Structure, function, expression, genomic organizat... Int J Toxicol. 2006 Jul-Aug;25(4):231-59. Choudhuri S, Klaassen CD
Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters.
Int J Toxicol. 2006 Jul-Aug;25(4):231-59., [PMID:16815813]

Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a large family of membrane proteins, which transport a variety of compounds through the membrane against a concentration gradient at the cost of ATP hydrolysis. Substrates of the ABC transporters include lipids, bile acids, xenobiotics, and peptides for antigen presentation. As they transport exogenous and endogenous compounds, they reduce the body load of potentially harmful substances. One by-product of such protective function is that they also eliminate various useful drugs from the body, causing drug resistance. This review is a brief summary of the structure, function, and expression of the important drug resistance-conferring members belonging to three subfamilies of the human ABC family; these are ABCB1 (MDR1/P-glycoprotein of subfamily ABCB), subfamily ABCC (MRPs), and ABCG2 (BCRP of subfamily ABCG), which are expressed in various organs. In the text, the transporter symbol that carries the subfamily name (such as ABCB1, ABCC1, etc.) is used interchangeably with the corresponding original names, such as MDR1P-glycoprotein, MRP1, etc., respectively. Both nomenclatures are maintained in the text because both are still used in the transporter literature. This helps readers relate various names that they encounter in the literature. It now appears that P-glycoprotein, MRP1, MRP2, and BCRP can explain the phenomenon of multidrug resistance in all cell lines analyzed thus far. Also discussed are the gene structure, regulation of expression, and various polymorphisms in these genes. Because genetic polymorphism is thought to underlie interindividual differences, including their response to drugs and other xenobiotics, the importance of polymorphism in these genes is also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
315 Other SNPs identified with low frequency (~1%) were C2302T (Arg768Trp), C2366T (Ser789Phe), and G4348A (Ala1450Thr), all being missense mutations. Login to comment
316 Of these, the G4348A (Ala1450Thr) is located in the ABC signature motif, and hence may impact MRP2 function. Login to comment
321 They found that the most frequently observed amino acid substitution (Val417Ile) as well as the two less frequently observed amino acid substitutions (Ser789Phe and Ala1450Thr) may not affect drug disposition function of MRP2. Login to comment
322 However, mutant MRP2 protein with two less frequently observed amino acid substitutions (Ser789Phe and Ala1450Thr) showed significantly lower expression levels compared to the wild-type MRP2. Login to comment

[hide] ABC transporters in human lymphocytes: expression,... Expert Opin Drug Metab Toxicol. 2010 May;6(5):571-89. Giraud C, Manceau S, Treluyer JM
ABC transporters in human lymphocytes: expression, activity and role, modulating factors and consequences for antiretroviral therapies.
Expert Opin Drug Metab Toxicol. 2010 May;6(5):571-89., [PMID:20367109]

Abstract [show]
IMPORTANCE OF THE FIELD: ATP-binding cassette (ABC) transporters are a superfamily of efflux pumps that transport numerous compounds across cell membranes. These transporters are located in various human tissues including peripheral blood cells, in particular lymphocytes, and present a high variability of expression and activity. This variability may affect the intracellular concentrations and efficacy of drugs acting within lymphocytes, such as antiretroviral drugs. AREAS COVERED IN THIS REVIEW: This review focuses on the current knowledge about the expression, activity, roles and variability of ABC drug transporters in human lymphocytes. The identified modulating factors and their impact on the intracellular pharmacokinetics and efficacy of antiretroviral drugs are also detailed. WHAT THE READER WILL GAIN: Controversial data regarding the expression, activity and sources of variability of ABC transporters in lymphocytes are discussed. The modulating factors and their pharmacological consequences regarding antiretroviral therapies are also provided. TAKE HOME MESSAGE: Numerous studies have reported conflicting results regarding the expression and activity of ABC drug transporters in lymphocytes. Despite these discrepancies, which may partly result from heterogeneous analytical methods, ABCC1 appears to have the highest expression in lymphocytes and may thus play a predominant role in the resistance to antiretroviral drugs, particularly to protease inhibitors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
197 Other rare non-synonymous variants (frequencies about 1%) have also been identified, such as the 2302C > T (A768W), 2366C > T (S789F) and 4348 G > A (A1450T) polymorphisms, but are rare and their functional impact is unknown. Login to comment