ABCMdb

PMID: 20800589

Lan F, Wang Z, Ke L, Xie H, Huang L, Huang H, Tu X, Zheng D, Zeng J, Li H, Xin N, Yang B
A rapid and sensitive protocol for prenatal molecular diagnosis of X-linked adrenoleukodystrophy.
Clin Chim Acta. 2010 Dec 14;411(23-24):1992-7. Epub 2010 Aug 26., [PubMed]

Sentences

No. Mutations Sentence Comment

43 ABCD1 p.Arg259Trp One proband carried a frameshift mutation (c.1415_16delAG) and the remaining one had two mutations (p.Ser108X and p.Arg259Trp) on the same allele. Login to comment 64 ABCD1 p.Arg617Gly The target of ARMS was p.Arg617Gly mutation found in the propositus of family 1. Login to comment 68 ABCD1 p.Arg617Gly ABCD1 p.Arg617Gly For DNA dot hybridization, two oligonucleotides, R617G-W (for detecting the wild-type allele) and R617G-M (for detecting the mutated allele), were synthesized, their sequences being CGGCATGGCCCGCATGTTCTA and CGGCATGGCCGGCATGTTCTA, respectively. Login to comment 70 ABCD1 p.Arg617Gly ABCD1 p.Arg617Gly ABCD1 p.Arg617Gly ABCD1 p.Arg617Gly Purified PCR products from family 1 were dotted on nylon membranes (positively charged with a pore size of 0.45 μm, purchased from Roche) and these membranes were heated at 120 °C for 15-30 min to fix the DNA, prehybridized at 62.5 °C for more than 1 h in a prehybridization buffer in a hybridization oven, and hybridized for 3 h in a hybridization solution containing a DIG- tagged R617G-W or R617G-M probe. Login to comment 74 ABCD1 p.Arg401Gln ABCD1 p.Pro560Leu ABCD1 p.Arg617Cys ABCD1 p.Lys276Glu ABCD1 p.Arg617Gly ABCD1 p.Pro534Arg ABCD1 p.Arg259Trp ABCD1 p.Asn148Asp Family Origin (province) Genotype of proband Age (years) of carrier at amniocentesis Weeks of pregnancy at amniocentesis 1 Guangdong p.Arg617Gly 39 28 2 Shandong p.Pro534Arg 25 21 3 Fujian p.Arg617Cys 33(34)a 16(17)a 4 Hebei 1415_1416delAG (p.Glu471fs) 29 26 5 Fujian [p.Ser108X; p.Arg259Trp] 33 19 6 Shandong p.Pro560Leu 35 18 7 Anhui p.Gln177X 33 20 8 Shandong p.Lys276Glu 33 16 9 Hubei p.Asn148Asp 35 18 10 Jilin c.622_623insG (p.Ser207fs) 35 16 11 Guangxi p.Arg401Gln 32 16 a Figures in parentheses represent those data of second-time prenatal diagnosis for another fetus from family 3. Login to comment 90 ABCD1 p.Arg617Gly ABCD1 p.Arg617Gly In dot hybridization, DNA dots were visible in all DNA samples when the wild-type probe (R617G-W) was applied, while the dotswere visible only in PCR products of fetus 1 and its mother when the mutant probe (R617G-M) was applied (Fig. 2). Login to comment 91 ABCD1 p.Arg617Gly These results indicated that fetus 1 carried the mutation p.Arg617Gly. Login to comment 92 ABCD1 p.Pro534Arg Fetus 2: The PCR products of 506 bp, spanning the site of p. Pro534Arg mutation, from the AFC's DNA of fetus 2 as well as the genomic DNA of its parents, elder brother (proband of the family) and normal controls were digested with the restriction enzyme Hae II, which cuts at the site of mutation and produces two fragments of 396 bp and 110 bp. Login to comment 94 ABCD1 p.Arg617Cys Fetuses 3 and 4: The PCR product of 271 bp, spanning the site of p. Arg617Cys mutation, from the AFC's DNA of fetus 3 showed an elution profile similar to that of a normal control in DHPLC (Fig. 4, F3). Login to comment 95 ABCD1 p.Arg617Cys The same PCR product of fetus 4 was cut with Aci I, which, in normal cases, can find two cuts along the sequence and generates three fragments, i.e., fragments of 162 bp, 75 bp and 34 bp, respectively, and, when there is p.Arg617Cys mutation, can find only one cut, generating two fragments (237 bp and 34 bp). Login to comment 99 ABCD1 p.Pro560Leu Fetus 7: The PCR products of 799 bp, spanning the site of p. Pro560Leu mutation, from the AFC's DNA of fetus 7 as well as the genomic DNA of its parents and elder brother (proband of the family) were digested with the restriction enzyme Bcn I. Login to comment 100 ABCD1 p.Pro560Leu In normal cases, this enzyme has one cutting site on this product and produces two fragments (595 bp and 204 bp) upon its action. When there exists the P560L mutation, the cutting site disappears. Login to comment 103 ABCD1 p.Lys276Glu Fetus 9: The PCR product of 269 bp, spanning the site of p. Lys276Glu mutation, from the AFC's DNA of fetus 9 showed an elution profile similar to that of its father in DHPLC (Fig. 4, F9). Login to comment 104 ABCD1 p.Asn148Asp Fetus 10: The PCR product of fetus 10 was cut with Sal I, which, in normal cases, cannot cut the PCR product and, when there is p. Asn148Asp mutation, can cleave this PCR product into two fragments (577 bp and 145 bp). Login to comment 115 ABCD1 p.Arg617Gly ABCD1 p.Arg617Gly A: wild-type probe (R617G-W); B: mutant probe (R617G-M); 1: normal control; 2: father of fetus 1; 3: mother of fetus 1; 4: fetus 1. Login to comment 117 ABCD1 p.Arg401Gln Fetus 12: The PCR products of 302 bp, spanning the site of p. Arg401Gln mutation, from the AFC's DNA of fetus 12 as well as the genomic DNA of its parents and elder brother (proband of the family) were digested with the restriction enzyme Mbi I. Login to comment 118 ABCD1 p.Arg401Gln In normal cases, this enzyme has one cutting site on this product, producing two fragments (226 bp and 76 bp) upon its action. When there exists the p. Arg401Gln mutation, the cutting site disappears. Login to comment 167 ABCD1 p.Arg617Cys ABCD1 p.Arg617Gly ABCD1 p.Arg259Trp Fetus Family Methods Sex Genotype Diagnosis 1 1 Dot hybridization+ARMS Male p.Arg617Gly ALD hemizygote 2 2 PCR-RFLP+sequencing Male No mutation Normal hemizygote 3 3 DHPLC+sequencing Female No mutation Normal homozygote 4 3 PCR-RFLP+sequencing Male p.Arg617Cys ALD hemizygote 5 4 DHPLC+sequencing Male No mutation Normal hemizygote 6 5 DHPLC+sequencing Female [p.Ser108X; p.Arg259Trp]/ no mutation ALD heterozygote 7 6 PCR-RFLP+sequencing Female No mutation Normal homozygote 8 7 DHPLC+sequencing Female No mutation Normal homozygote 9 8 DHPLC+sequencing Male No mutation Normal hemizygote 10 9 PCR-RFLP+sequencing Male No mutation Normal hemizygote 11 10 DHPLC+sequencing Male No mutation Normal hemizygote 12 11 PCR-RFLP+sequencing Female No mutation Normal homozygote based on molecular techniques. Login to comment