ABCD1 p.Arg617Gly
| ClinVar: |
c.1849C>T
,
p.Arg617Cys
D
, Pathogenic
c.1850G>A , p.Arg617His D , Pathogenic |
| Predicted by SNAP2: | A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Novel mutation in ATP-binding domain of ABCD1 gene... J Genet. 2010 Dec;89(4):473-7. Kumar N, Taneja KK, Kumar A, Nayar D, Taneja B, Aneja S, Behari M, Kalra V, Bansal SK
Novel mutation in ATP-binding domain of ABCD1 gene in adrenoleukodystrophy.
J Genet. 2010 Dec;89(4):473-7., [PMID:21273699]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
87 In this codon, out of six possible different missense mutations, (three each at position first and second of the codon) four viz. c.1849C>T / Arg617Cys, c.1849C>G / Arg617Gly, c.1850G>A / Arg617His and c.1850G>T / Arg617Leu have already been reported by others (Fanen et al. 1994; Krasemann et al. 1996; Coll et al. 2005).
X
ABCD1 p.Arg617Gly 21273699:87:165
status: NEW97 fourth case (c.1849C>G/Arg617Gly) the status of formation of ALDP is not reported (Krasemann et al. 1996; Pan et al. 2005).
X
ABCD1 p.Arg617Gly 21273699:97:23
status: NEW[hide] Molecular diagnosis of X-linked adrenoleukodystrop... Clin Chim Acta. 2011 May 12;412(11-12):970-4. Epub 2011 Feb 12. Lan F, Wang Z, Xie H, Huang L, Ke L, Yang B, Zhu Z
Molecular diagnosis of X-linked adrenoleukodystrophy: experience from a clinical genetic laboratory in mainland China with report of 13 novel mutations.
Clin Chim Acta. 2011 May 12;412(11-12):970-4. Epub 2011 Feb 12., [PMID:21300044]
Abstract [show]
BACKGROUND: X-linked adrenoleukodystrophy (X-ALD) is a neurodegenerative disorder characterized by progressive demyelination of the nervous system, adrenocortical insufficiency and increase of very long chain fatty acids (VLCFAs) in the plasma and tissues. METHODS: A total of 131 individuals from 30 Chinese pedigrees were involved in this study, including 42 symptomatic patients, 44 female carriers, and 15 high-risk fetuses from 13 families. The mutation was first pinpointed through long distance RT-PCR-based RNA approach and confirmed through peripheral blood DNA approach. RESULTS: A total of 28 mutations were identified, of which 19 were missense, 3 nonsense and 6 frame-shift mutations. Thirteen mutations were novel, i.e. p.R280L, p.P580L, p.G343V, p.S108X, p.R259W, p.P534R, p.fs A246, p.L576P, p.K602X, p.A314P, p.N148D, p.H283R, and p.fs R89. Two mutations occurred de novo, for they were not found in somatic cells of their parents. Three females from the same family developed AMN-like symptoms and they were heterozygous for the p.H283R mutation. Four asymptomatic boys were diagnosed as X-ALD patients and prenatal molecular diagnosis were provided for 13 X-ALD-stricken families. CONCLUSIONS: Our work extended the spectrum of mutations in X-ALD and benefited genetic counseling through reliable identification of heterozygous females and asymptomatic males.
Comments [show]
None has been submitted yet.
No. Sentence Comment
99 Pedigree Number of patient Number of carriere Phenotype of patient Base change Amino acid change Position of mutation Feature of mutation Prenatal diagnosis 1 1 2 AdolCALD 1225GNT R280L Exon 1 Missense 2 1 1 CCALD 1909CNT P508L Exon 6 Missense 3 4 3 CCALD 1987CNG P534R Exon 6 Missense Y 4 1 1 CCALD 1182GNA G266R Exon 1 Missense 5 1a +1b 1 CCALD 2235CNG R617G Exon 8 Missense Y 6 1+1a +1c 1 CCALD 1414GNT G343V Exon 2 Missense 7 1 1 CCALD 1415_02 del AG fs E471 Exon 5 Frameshift 8 1+1b 1 CCALD 2235CNT R617C Exon 8 Missense Yh 9 1 1 CCALD 2065CNT P560L Exon 7 Y 10 1+1a 2+1b CCALD [709 NA; 1161CNT] [S108X; R259W] Exon 1 Nonsense; Missense Y 11 1 1 CCALD 1126ins GCCATCG fs I246 Exon 1 Frameshift 12 1 1 CCALD 2113TNC L576P Exon 7 Missense 13 1a +2c 3 CCALD 807GNA A141T Exon 1 Missense 14 1 1 CCALD 1415_02 del AG fs E471 Exon 5 Frameshift Y 15 1 1+1b CCALD 915CNA Q177X Exon 1 Nonsense Yh 16 1+1a 1 CCALD 1588GNA R401Q Exon 3 Missense 17 1 1 CCALD 1212 ANG K276E Exon 1 Missense Y 18 1 1 CCALD 907 ANG Y174C Exon 1 Missense 19 1 2 CCALD 2190 ANT K602X Exon 8 Nonsense 20 1 1 CCALD 1326GNC A314P Exon 2 Missense 21 1 1 CCALD 828 ANG N148D Exon 1 Missense Y 22 1 1 CCALD 1588GNA R401Q Exon 3 Missense Y 23 1 0f CCALD 2278GNA C631Y Exon 9 Missense 24 1a 1 CCALD 1008insG fs S207 Exon 1 Frameshift Y 25 1 0f CCALD 1920GNA G512S Exon 6 Missense 26 1+1c 3 CCALD 1415_02 del AG fs E471 Exon 5 Frameshift Y 27 1+1b 1 CCALD [1035ANG; 1853GNA] [K217E; V489V] Exon 1 Missense; same sense Y 28 1+3d 4 AMNg 1234ANG H283R Exon 1 Missense 29 1+2a 3 CCALD 1233CNG H283D Exon 1 Missense 30 2 3 AMN; CCALD 656_57 delGA fs R89 Exon 1 Frameshift a patient or proband died at the time of referral; b fetus by prenatal diagnosis; c presymptomatic at the time of referral; d female heterozygote patient; e determined by molecular ananlysis or deduced by the fact that the carrier was the daughter of an X-ALD, or the mother of at least one X-ALD patients; f de novo mutation; g including three heterozygote female patients; h twice for two pregnancies.
X
ABCD1 p.Arg617Gly 21300044:99:355
status: NEW[hide] ABCD1 gene mutations in Chinese patients with X-li... Pediatr Neurol. 2005 Aug;33(2):114-20. Pan H, Xiong H, Wu Y, Zhang YH, Bao XH, Jiang YW, Wu XR
ABCD1 gene mutations in Chinese patients with X-linked adrenoleukodystrophy.
Pediatr Neurol. 2005 Aug;33(2):114-20., [PMID:16087056]
Abstract [show]
X-linked adrenoleukodystrophy is a neurodegenerative disorder caused by mutations in the adrenoleukodystrophy (ALD) protein gene ABCD1. This study used direct sequencing of genomic polymerase chain reaction products to perform mutational analysis of ABCD1 in 34 unrelated Chinese X-linked adrenoleukodystrophy patients and 27 of their maternal relatives. Thirty-two different mutations were identified in 34 patients. Most of the mutations (62.5%, 20/32) were missense mutations, six of which are novel. One novel single nucleotide polymorphism, c.1047 C>A, was also found in three patients and their mothers, which can also be observed in 1 of 120 normal control alleles. Two synonymous mutations (p.L516L and p.V349V) appeared in two unrelated patients, and no other mutations were evident after screening the gene's 10 exons. Seventeen of the probands' mothers were found to be heterozygous for the same mutations present in their sons' ABCD1 gene. Eight of the 10 screened sisters and cousins were identified as carriers. There were no hot spot mutations in the ABCD1 gene of Chinese patients with X-linked adrenoleukodystrophy. However, over half of the mutations (19/34) were located in exon 1 and exon 6, suggesting possible hot exons. No obvious relationship between genotype and phenotype was observed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
94 RFLP Associated Phenotype Missense mutations A30 1 421 GϾA A141T CCALD A23 1 545 GϾC R182P CCALD A14 1 796 GϾA G266R‡ CCALD A18 1 847 CϾG H283D†§ - Nsp I CCALD A32 1 871 GϾA E291K‡ CCALD A28 1 887 AϾG Y296C ACALD A21 2 1028 GϾT G343V*‡§ - Ava I ACALD A20 2, 3 1047 CϾA V349V*§ ϩ Rsa I CCALD 1210 TϾC S404P†‡ A6 6 1526 AϾT N509I†‡ CCALD A26 6 1529 GϾA G510D*§ - Bg1 I ACALD A1 6 1552 CϾG R518G†‡§ - Msp I CCALD A24 6 1548 GϾA L516L‡ CCALD 1553 GϾA R518Q‡ A10 6 1553 GϾA R518Q‡ CCALD A7 6 1559 TϾA L520Q CCALD A12 7 1661 GϾA R554H‡ CCALD A19 7 1667 AϾG Q556R‡ AMN A16 8 1814 TϾA L605Q*§ ϩ BstX I CCALD A17 8 1817 CϾT S606L CCALD A2 8 1849 CϾT R617C‡ AO A15 8 1849 CϾG R617G CCALD Nonsense mutations A11 1 396 GϾA W132X‡ CCALD A3 1 726 GϾA W242X CCALD A34 4 1390 CϾT R464X‡ CCALD A8 8 1785 GϾA W595X‡ CCALD Frameshift mutations A29 1 385 ins G fs R128* ACALD A27 2 937 del C fs D312 CCALD A13 5 1415 del AG fs E471 ACALD A22 6 1603 del CC fs P534* CCALD Amino acid insertion A33 1 240-241ins9 R80-L81insPAA* CCALD Splicing defect A5 IVS1 IVS1 ϩ1 gϾt CCALD A31 IVS3 IVS3 ϩ2 cϾt CCALD A25 IVS5 IVS5 -6 delc†‡ ACALD Synonymous mutation A4 2, 6 1047 CϾA V349V‡ CCALD 1548 GϾA L516L‡ A9 2, 6 1047 CϾA V349V‡ CCALD 1548 GϾA L516L‡ * The mutation was novel.
X
ABCD1 p.Arg617Gly 16087056:94:952
status: NEW95 RFLP Associated Phenotype Missense mutations A30 1 421 Gb0e;A A141T CCALD A23 1 545 Gb0e;C R182P CCALD A14 1 796 Gb0e;A G266Rߥ CCALD A18 1 847 Cb0e;G H283Dߤ&#a7; afa; Nsp I CCALD A32 1 871 Gb0e;A E291Kߥ CCALD A28 1 887 Ab0e;G Y296C ACALD A21 2 1028 Gb0e;T G343V*ߥ&#a7; afa; Ava I ACALD A20 2, 3 1047 Cb0e;A V349V*&#a7; af9; Rsa I CCALD 1210 Tb0e;C S404Pߤߥ A6 6 1526 Ab0e;T N509Iߤߥ CCALD A26 6 1529 Gb0e;A G510D*&#a7; afa; Bg1 I ACALD A1 6 1552 Cb0e;G R518Gߤߥ&#a7; afa; Msp I CCALD A24 6 1548 Gb0e;A L516Lߥ CCALD 1553 Gb0e;A R518Qߥ A10 6 1553 Gb0e;A R518Qߥ CCALD A7 6 1559 Tb0e;A L520Q CCALD A12 7 1661 Gb0e;A R554Hߥ CCALD A19 7 1667 Ab0e;G Q556Rߥ AMN A16 8 1814 Tb0e;A L605Q*&#a7; af9; BstX I CCALD A17 8 1817 Cb0e;T S606L CCALD A2 8 1849 Cb0e;T R617Cߥ AO A15 8 1849 Cb0e;G R617G CCALD Nonsense mutations A11 1 396 Gb0e;A W132Xߥ CCALD A3 1 726 Gb0e;A W242X CCALD A34 4 1390 Cb0e;T R464Xߥ CCALD A8 8 1785 Gb0e;A W595Xߥ CCALD Frameshift mutations A29 1 385 ins G fs R128* ACALD A27 2 937 del C fs D312 CCALD A13 5 1415 del AG fs E471 ACALD A22 6 1603 del CC fs P534* CCALD Amino acid insertion A33 1 240-241ins9 R80-L81insPAA* CCALD Splicing defect A5 IVS1 IVS1 af9;1 gb0e;t CCALD A31 IVS3 IVS3 af9;2 cb0e;t CCALD A25 IVS5 IVS5 afa;6 delcߤߥ ACALD Synonymous mutation A4 2, 6 1047 Cb0e;A V349Vߥ CCALD 1548 Gb0e;A L516Lߥ A9 2, 6 1047 Cb0e;A V349Vߥ CCALD 1548 Gb0e;A L516Lߥ * The mutation was novel.
X
ABCD1 p.Arg617Gly 16087056:95:954
status: NEW[hide] A rapid and sensitive protocol for prenatal molecu... Clin Chim Acta. 2010 Dec 14;411(23-24):1992-7. Epub 2010 Aug 26. Lan F, Wang Z, Ke L, Xie H, Huang L, Huang H, Tu X, Zheng D, Zeng J, Li H, Xin N, Yang B
A rapid and sensitive protocol for prenatal molecular diagnosis of X-linked adrenoleukodystrophy.
Clin Chim Acta. 2010 Dec 14;411(23-24):1992-7. Epub 2010 Aug 26., [PMID:20800589]
Abstract [show]
BACKGROUND: X-linked adrenoleukodystrophy (X-ALD) is a neurodegenerative genetic disease characterized by progressive demylination of the brain, adrenal insufficiency and elevated VLCFA level. ABCD1gene is the disease gene and more than 500 unique mutations in the ABCD1gene have been recorded in the database, approximately 60% of which are noncurrent ones. Although great progress has been made in the treatment of X-ALD, prenatal diagnosis is still badly needed by X-ALD-stricken families. METHODS: Twelve high-risk fetuses entered this study. Amniotic fluid (AF) was divided into two parts, with one part being used directly to isolate genomic DNA and debris from the other part for amniotic fluid cells (AFC) culturing. STR profiling was performed to evaluate maternal contamination of AFC genomic DNA. Two different molecular approaches, be they any two of direct sequencing, PCR-RFLP, ARMS, dot hybridization and DHPLC, were applied to determine whether the mutation identified in the index patient was found in the fetus. RESULTS: The genotypes of all 12 fetuses were determined, among which 2 were diagnosed as ALD males, 5 unaffected males, 1 heterozygote, and 4 normal unaffected females. A total of 9 families sent samples of umbilical blood at the time of delivery, and results of molecular checking of these samples agreed with those of prenatal diagnosis. Up until now, no ALD-related abnormalities were reported postnatally. CONCLUSION: An in-house protocol for the prenatal molecular diagnosis of X-ALD was established, and this protocol would provide accurate and rapid prenatal genetic service to X-ALD-stricken families.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 The target of ARMS was p.Arg617Gly mutation found in the propositus of family 1.
X
ABCD1 p.Arg617Gly 20800589:64:25
status: NEW68 For DNA dot hybridization, two oligonucleotides, R617G-W (for detecting the wild-type allele) and R617G-M (for detecting the mutated allele), were synthesized, their sequences being CGGCATGGCCCGCATGTTCTA and CGGCATGGCCGGCATGTTCTA, respectively.
X
ABCD1 p.Arg617Gly 20800589:68:49
status: NEWX
ABCD1 p.Arg617Gly 20800589:68:98
status: NEW70 Purified PCR products from family 1 were dotted on nylon membranes (positively charged with a pore size of 0.45 μm, purchased from Roche) and these membranes were heated at 120 °C for 15-30 min to fix the DNA, prehybridized at 62.5 °C for more than 1 h in a prehybridization buffer in a hybridization oven, and hybridized for 3 h in a hybridization solution containing a DIG- tagged R617G-W or R617G-M probe.
X
ABCD1 p.Arg617Gly 20800589:70:396
status: NEWX
ABCD1 p.Arg617Gly 20800589:70:399
status: NEW74 Family Origin (province) Genotype of proband Age (years) of carrier at amniocentesis Weeks of pregnancy at amniocentesis 1 Guangdong p.Arg617Gly 39 28 2 Shandong p.Pro534Arg 25 21 3 Fujian p.Arg617Cys 33(34)a 16(17)a 4 Hebei 1415_1416delAG (p.Glu471fs) 29 26 5 Fujian [p.Ser108X; p.Arg259Trp] 33 19 6 Shandong p.Pro560Leu 35 18 7 Anhui p.Gln177X 33 20 8 Shandong p.Lys276Glu 33 16 9 Hubei p.Asn148Asp 35 18 10 Jilin c.622_623insG (p.Ser207fs) 35 16 11 Guangxi p.Arg401Gln 32 16 a Figures in parentheses represent those data of second-time prenatal diagnosis for another fetus from family 3.
X
ABCD1 p.Arg617Gly 20800589:74:135
status: NEW90 In dot hybridization, DNA dots were visible in all DNA samples when the wild-type probe (R617G-W) was applied, while the dotswere visible only in PCR products of fetus 1 and its mother when the mutant probe (R617G-M) was applied (Fig. 2).
X
ABCD1 p.Arg617Gly 20800589:90:89
status: NEWX
ABCD1 p.Arg617Gly 20800589:90:208
status: NEW91 These results indicated that fetus 1 carried the mutation p.Arg617Gly.
X
ABCD1 p.Arg617Gly 20800589:91:60
status: NEW115 A: wild-type probe (R617G-W); B: mutant probe (R617G-M); 1: normal control; 2: father of fetus 1; 3: mother of fetus 1; 4: fetus 1.
X
ABCD1 p.Arg617Gly 20800589:115:20
status: NEWX
ABCD1 p.Arg617Gly 20800589:115:47
status: NEW167 Fetus Family Methods Sex Genotype Diagnosis 1 1 Dot hybridization+ARMS Male p.Arg617Gly ALD hemizygote 2 2 PCR-RFLP+sequencing Male No mutation Normal hemizygote 3 3 DHPLC+sequencing Female No mutation Normal homozygote 4 3 PCR-RFLP+sequencing Male p.Arg617Cys ALD hemizygote 5 4 DHPLC+sequencing Male No mutation Normal hemizygote 6 5 DHPLC+sequencing Female [p.Ser108X; p.Arg259Trp]/ no mutation ALD heterozygote 7 6 PCR-RFLP+sequencing Female No mutation Normal homozygote 8 7 DHPLC+sequencing Female No mutation Normal homozygote 9 8 DHPLC+sequencing Male No mutation Normal hemizygote 10 9 PCR-RFLP+sequencing Male No mutation Normal hemizygote 11 10 DHPLC+sequencing Male No mutation Normal hemizygote 12 11 PCR-RFLP+sequencing Female No mutation Normal homozygote based on molecular techniques.
X
ABCD1 p.Arg617Gly 20800589:167:78
status: NEW[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]
Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.
Comments [show]
None has been submitted yet.
No. Sentence Comment
50 Disease-associated nsSNPs at Three Structural Hotspots in Human ABC Transporter NBDs Gene Disease Position ARA motif ABCB11 BRIC2 A570T ABCD1 X-ALD A616V CFTR CF A559T ABCC6 PXE R765Q ABCC8 HHF1 R841G ABCC8 HHF1 R1493Q ABCC8 HHF1 R1493W ABCD1 X-ALD R617C ABCD1 X-ALD R617G ABCD1 X-ALD R617H CFTR CF R560K CFTR CF R560S CFTR CF R560T ABCA1 HDLD1 A1046D ABCB4 ICP A546D C-loop 1 motif ABCC8 HHF1 D1471H ABCC8 HHF1 D1471N CFTR CBAVD G544V ABCC8 HHF1 G1478R C-loop2 motif ABCA4 STGD1 H2128R ABCC8 HHF1 K889T ABCD1 X-ALD R660P ABCD1 X-ALD R660W ABCA1 HDLD2 M1091T ABCA4 STGD1 E2131K ABCA12 LI2 E1539K ABCA4 STGD1 and CORD3 E1122K CFTR CF L610S ABCC8 HHF1 L1543P ABCA1 Colorectal cancer sample; somatic mutation A2109T ABCC9 CMD1O A1513T ABCD1 X-ALD H667D CFTR CF A613T ABCA1 HDLD2 D1099Y ABCD1 X-ALD T668I CFTR CF D614G ABCA4 STGD1 R2139W ABCA4 STGD1 R1129C ABCA4 ARMD2, STGD1, and FFM R1129L Disease abbreviations are as follows: BRIC2, benign recurrent intrahepatic cholestasis type 2; X-ALD, X-linked adrenoleukodystrophy; CF, cystic fibrosis; PXE, Pseudoxanthoma elasticum; HHF1, familial hyperinsulinemic hypoglycemia-1; HDLD1, high density lipoprotein deficiency type 1; ICP, intrahepatic cholestasis of pregnancy; CBAVD, congenital bilateral absence of the vas deferens; STGD1, Stargardt disease type 1; HDLD2, high density lipoprotein deficiency type 2; LI2, ichthyosis lamellar type 2; CORD3, cone-rod dystrophy type 3; CMD1O, cardiomyopathy dilated type 1O; ARMD2, age-related macular degeneration type 2; FFM, fundus flavimaculatus.
X
ABCD1 p.Arg617Gly 20799350:50:267
status: NEW