ABCC4 p.Lys498Glu
| Predicted by SNAP2: | A: N (57%), C: N (72%), D: N (87%), E: N (78%), F: N (57%), G: D (66%), H: N (97%), I: N (93%), L: N (93%), M: N (93%), N: N (97%), P: N (93%), Q: N (97%), R: N (66%), S: N (97%), T: N (97%), V: N (93%), W: D (53%), Y: N (57%), |
| Predicted by PROVEAN: | A: D, C: D, D: N, E: N, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: N, Q: N, R: N, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]
Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
191 MRP4 protein has been detected in human kidney (van Aubel et al., 2002), lung (Torky et al., 2005), liver (Rius et al., 2003), prostate (Lee et al., 2000), brain (Nies et al., 2004), pancreas (König et al., 2005), lymphocytes (Schuetz et al., 1999), and platelets Figure 4 Predicted membrance topology of MRP4 (ABCC4) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 4 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD Val854Phe Ile18Leu Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304Asn in out Membrane Cys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val MRP4 (ABCC4) COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val (Jedlitschky et al., 2004).
X
ABCC4 p.Lys498Glu 18464048:191:661
status: NEWX
ABCC4 p.Lys498Glu 18464048:191:828
status: NEWX
ABCC4 p.Lys498Glu 18464048:191:982
status: NEW236 Following the discovery and Table 4 MRP4 (ABCC4) Single nucleotide polymorphisms. Location, allele frequency and functional effects. Position in coding sequence Amino acid exchange Location Allele frequency Effect NCBI ID ReferenceAf Ca Jp others 52A>C Ile18Leu Exon 1 - 1.1 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568681 511T>G Cys171Gly Exon 4 - 0 [1] [2] - - rs4148460 559G>T Gly187Trp Exon 5 - 2.2 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568658 912G>T Lys304Asn Exon 8 - 9.9 [1] [2] - No influence on expression and localization in liver [1] rs2274407 1208T>C Pro403Leu Exon 9 - - - - - rs11568705 1492A>G Lys498Glu Exon 11 - - - - - rs11568669 1592G>A Arg531Gln Exon 12 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 1667A>G Tyr556Cys Exon 13 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2230A>G Met744Val Exon 18 - - - - - rs9282570 2269G>A Glu757Lys Exon 18 - 0.6 [1] [2] - No influence on expression and localization in liver [1] rs3765534 2326G>A Val776Ile Exon 19 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2560G>T Val854Phe Exon 21 - 1.7 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568694 2596A>G Ile866Val Exon 21 - 2.8 [1] 0 [2] - No influence on expression and localization in liver [1] 3425C>T Thr1142Met Exon 27 - 1.6 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568644 3814A>G Met1272Val Exon 30 - - - - - rs1134217 Reference without frequency means that SNP was detected but no frequency determined.
X
ABCC4 p.Lys498Glu 18464048:236:676
status: NEW[hide] Pharmacogenetics of drug transporters in the enter... Pharmacogenomics. 2011 May;12(5):611-31. Stieger B, Meier PJ
Pharmacogenetics of drug transporters in the enterohepatic circulation.
Pharmacogenomics. 2011 May;12(5):611-31., [PMID:21619426]
Abstract [show]
This article summarizes the impact of the pharmacogenetics of drug transporters expressed in the enterohepatic circulation on the pharmacokinetics and pharmacodynamics of drugs. The role of pharmacogenetics in the function of drug transporter proteins in vitro is now well established and evidence is rapidly accumulating from in vivo pharmacokinetic studies, which suggests that genetic variants of drug transporter proteins can translate into clinically relevant phenotypes. However, a large amount of conflicting information on the clinical relevance of drug transporter proteins has so far precluded the emergence of a clear picture regarding the role of drug transporter pharmacogenetics in medical practice. This is very well exemplified by the case of P-glycoprotein (MDR1, ABCB1). The challenge is now to develop pharmacogenetic models with sufficient predictive power to allow for translation into drug therapy. This will require a combination of pharmacogenetics of drug transporters, drug metabolism and pharmacodynamics of the respective drugs.
Comments [show]
None has been submitted yet.
No. Sentence Comment
117 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Liver efflux transporters (cont.) SLC47A1 (cont.) MATE1 (cont.) c.1490G>C c.149G>T p.C497S p.C497F N/A Reduced, unchanged or increased transport activities (substrate dependent) [170,229] c.1557G>C p.Q519H N/A Unchanged [170] ABCC4 MRP4 c.232C>G p.P78A N/A Increased intracellular drug accumulation (substrate dependent), lower transport protein expression [161] c.559C>T p.G187W N/A Increased intracellular drug accumulation, reduced transport protein expression Slightly reduced function [161] [162] c.877A>G p.K293E N/A Unchanged [161] c.912G>T p.K304N N/A Unchanged Unchanged [161] [162] c.1208C>T p.P403L N/A Increased intracellular drug accumulation [161] c.1460G>A p.G487E N/A Increased intracellular drug accumulation Reduced transport activity (substrate dependent) [161] [162] c.1492A>G p.K498E N/A Unaltered [161] c.1667A>G p.Y556C N/A Increased transport activity [162] c.2269G>A p.E575K N/A Increased transport activity [162] c.2230A>G p.M744V N/A Unchanged [161] c.2326G>A p.V776I N/A Reduced transport activity [162] c.2459G>T p.R820I N/A Reduced transport activity [162] c.2560G>T p.V854F N/A Unchanged [162] c.2596A>G p.I866V N/A Unchanged [162] c.2867G>C p.C956S N/A Reduced intracellular drug accumulation [161] c.3211G>A p.V1071I N/A Unchanged [161] c.3425C>T p.T1142M N/A Increased transport activity [162] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302].
X
ABCC4 p.Lys498Glu 21619426:117:876
status: NEW[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]
Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined.
X
ABCC4 p.Lys498Glu 20103563:7118:1524
status: NEW7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1 Intracellular C218T T73I 1 Normal C257T S92F 2 Normal C350T T117M 2 Normal G689A R230Q Normal G1057A V353M N.D. N.D. G1299T R433S 2 Normal G1898A R633Q 2 Normal G2012T G671V Normal G2168A R723Q 2 Normal G2965A A989T 2 Normal G3140C C1047S 1 Normal G3173A R1058Q Normal C4535T S1512L Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R Normal C4141A R1381S Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2 Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E Normal G912T K304N Normal C1067T T356M N.D. N.D. C1208T P403L 2 Normal G1460A G487E 2 Normal A1492G K498E Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1 Normal G3211A V1071I Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; , no change in function; N.D. not determined.
X
ABCC4 p.Lys498Glu 20103563:7115:1501
status: NEW[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]
Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 Experimentally characterized nsSNPs, G487E and K498E (NBD1), and V1071I (NBD2) are indicated in red.
X
ABCC4 p.Lys498Glu 20799350:48:47
status: NEW72 Predictions of the Functional Effects of 40 nsSNPs in ABC Transporters Comon name HUGO name Mutation NBD Prediction BSEP ABCB11 E592Q NBD1 Neutral BSEP ABCB11 N591S NBD1 Neutral BSEP ABCB11 Q558H NBD1 Neutral BSEP ABCB11 V444A NBD1 Neutral BSEP ABCB11 E1186K NBD2 Disease MDR1 ABCB1 P1051A NBD2 Neutral MDR1 ABCB1 S1141T NBD2 Neutral MDR1 ABCB1 T1256K NBD2 Disease MDR1 ABCB1 V1251I NBD2 Neutral MDR1 ABCB1 W1108R NBD2 Disease MRP2 ABCC2 I670T NBD1 Disease MRP2 ABCC2 L849R NBD1 Disease MRP2 ABCC2 C1515Y NBD2 Disease MRP3 ABCC3 D770N NBD1 Neutral MRP3 ABCC3 K718M NBD1 Neutral MRP3 ABCC3 T809M NBD1 Disease MRP3 ABCC3 V765L NBD1 Disease MRP3 ABCC3 Q1365R NBD2 Disease MRP3 ABCC3 R1297H NBD2 Disease MRP3 ABCC3 R1348C NBD2 Disease MRP3 ABCC3 R1381S NBD2 Disease MRP4 ABCC4 G487E NBD1 Disease MRP4 ABCC4 K498E NBD1 Neutral MRP4 ABCC4 R1220Q NBD2 Neutral MRP4 ABCC4 T1142M NBD2 Neutral MRP4 ABCC4 V1071I NBD2 Neutral MRP6 ABCC6 I1330L NBD1 Neutral MRP6 ABCC6 I742V NBD1 Neutral MRP6 ABCC6 P664S NBD1 Neutral MRP6 ABCC6 R724K NBD1 Neutral MRP6 ABCC6 R769K NBD1 Neutral MRP6 ABCC6 A1291T NBD2 Neutral MRP6 ABCC6 E1369K NBD2 Neutral MRP6 ABCC6 G1327E NBD2 Disease MRP6 ABCC6 L1416R NBD2 Disease MRP6 ABCC6 R1268Q NBD2 Disease MRP6 ABCC6 R1461H NBD2 Disease MXR ABCG2 I206L NBD1 Neutral MXR ABCG2 P269S NBD1 Disease MXR ABCG2 Q141K NBD1 Neutral nsSNPs.
X
ABCC4 p.Lys498Glu 20799350:72:803
status: NEW78 The K498E nsSNP was found with a frequency of 0.025 in the African-American population.
X
ABCC4 p.Lys498Glu 20799350:78:4
status: NEW105 The K498E variant had no effect on MRP4 transport, while the G487E variant showed moderate reduction in function (P < 0.05, Fig. 7).
X
ABCC4 p.Lys498Glu 20799350:105:4
status: NEW112 Structural models of MRP4 nsSNPs G487E, K498E, and V1071I.
X
ABCC4 p.Lys498Glu 20799350:112:40
status: NEW146 The distribution of disease-associated mutations is nonsymmetric in NBD1 and NBD2, rationalizing experimental work indicating that the two NBDs in an individual transporter are not functionally equivalent.34 Experimental characterization of ABCC4 nsSNPs and validation of a prediction model using a cell-based assay Predictions of functional impact of three ABCC4 nsSNPs (G487E, K498E, and V1071I) were chosen for experimental validation using HEK293 cells stably transfected with the reference transporter and its variants.
X
ABCC4 p.Lys498Glu 20799350:146:379
status: NEW159 Finally, the lack of an effect of the K498E variant on TFV transport is consistent with our prediction that this surface-exposed site is not affected by a change in charge.
X
ABCC4 p.Lys498Glu 20799350:159:38
status: NEW[hide] The human multidrug resistance protein 4 (MRP4, AB... J Pharmacol Exp Ther. 2008 Jun;325(3):859-68. Epub 2008 Mar 25. Abla N, Chinn LW, Nakamura T, Liu L, Huang CC, Johns SJ, Kawamoto M, Stryke D, Taylor TR, Ferrin TE, Giacomini KM, Kroetz DL
The human multidrug resistance protein 4 (MRP4, ABCC4): functional analysis of a highly polymorphic gene.
J Pharmacol Exp Ther. 2008 Jun;325(3):859-68. Epub 2008 Mar 25., [PMID:18364470]
Abstract [show]
ABCC4 encodes multidrug resistance protein 4 (MRP4), a member of the ATP-binding cassette family of membrane transporters involved in the efflux of endogenous and xenobiotic molecules. The aims of this study were to identify single nucleotide polymorphisms of ABCC4 and to functionally characterize selected nonsynonymous variants. Resequencing was performed in a large ethnically diverse population. Ten nonsynonymous variants were selected for analysis of transport function based on allele frequencies and evolutionary conservation. The reference and variant MRP4 cDNAs were constructed by site-directed mutagenesis and transiently transfected into human embryonic kidney cells (HEK 293T). The function of MRP4 variants was compared by measuring the intracellular accumulation of two antiviral agents, azidothymidine (AZT) and adefovir (PMEA). A total of 98 variants were identified in the coding and flanking intronic regions of ABCC4. Of these, 43 variants are in the coding region, and 22 are nonsynonymous. In a functional screen of ten variants, there was no evidence for a complete loss of function allele. However, two variants (G187W and G487E) showed a significantly reduced function compared to reference with both substrates, as evidenced by higher intracellular accumulation of AZT and PMEA compared to the reference MRP4 (43 and 69% increase in accumulation for G187W compared with the reference MRP4, with AZT and PMEA, respectively). The G187W variant also showed decreased expression following transient transfection of HEK 293T cells. Further studies are required to assess the clinical significance of this altered function and expression and to evaluate substrate specificity of this functional change.
Comments [show]
None has been submitted yet.
No. Sentence Comment
110 Initially, ABCC4 haplotypes were inferred from all variable sites with a frequency higher than TABLE 1 Primers used for constructing the variants and the nonfunctional mutant by site-directed mutagenesis Variant Sequencea (5Ј-3Ј) P78A F: GAATGACGCACAGAAGGCTTCTTTAACAAGAGC R: GCTCTTGTTAAAGAAGCCTTCTGTGCGTCATTC G187W F: GTAACATGGCCATGTGGAAGACAACCACAG R: CTGTGGTTGTCTTCCACATGGCCATGTTAC K293E F: GTACGCCTGGGAAGAGTCATTTTCAAATC R: GATTTGAAAATGACTCTTCCCAGGCGTAC K304N F: CCAATTTGAGAAATAAGGAGATTTCCAAG R: CTTGGAAATCTCCTTATTTCTCAAATTGG P403L F: GCGCAACCGTCAGCTGCTGTCAGATGGTAAAAAG R: CTTTTTACCATCTGACAGCAGCTGACGGTTGCGC G487E F: CCCTGGGTGTTCTCGGAAACTCTGAGGAG R: CTCCTCAGAGTTTCCGAGAACACCCAGGG K498E F: GTAATATTTTATTTGGGAAGGAATACGAAAAGG R: CCTTTTCGTATTCCTTCCCAAATAAAATATTAC M744V F: GGGCAAACAAACAAAGTGTGCTAAATGTCACTG R: CAGTGACATTTAGCACACTTTGTTTGTTTGCCC C956S F: CGTCTGGATGCCATCTCTGCCATGTTTGTCATC R: GATGACAAACATGGCAGAGATGGCATCCAGACG V1071I F: CACAAGAAAAGATTGGCATTGTGGGAAG R: CTTCCCACAATGCCAATCTTTTCTTGTG G538D F: GGAACCACGCTGAGTGGAGACCAGAAAGCACGGGTAAACC R: GGTTTACCCGTGCTTTCTGGTCTCCACTCAGCGTGGTTCC F, forward; R, reverse.
X
ABCC4 p.Lys498Glu 18364470:110:693
status: NEW