ABCMdb

PMID: 16861249

Ren XQ, Furukawa T, Yamamoto M, Aoki S, Kobayashi M, Nakagawa M, Akiyama S
A functional role of intracellular loops of human multidrug resistance protein 1.
J Biochem. 2006 Sep;140(3):313-8. Epub 2006 Jul 21., [PubMed]

Sentences

No. Mutations Sentence Comment

44 ABCC1 p.Gly1161Pro ABCC1 p.Glu507Leu ABCC1 p.Glu1157Leu ABCC1 p.Gly511Pro The strategies employed for site-directed mutagenesis of E507L/G511P and E1157L/G1161P in MRP1 cDNA were previously described (10). Login to comment 45 ABCC1 p.Glu507Leu ABCC1 p.Glu507Leu ABCC1 p.Gly511Pro ABCC1 p.Gly511Pro The primers used to generate E507L/G511P mutations were forward and reverse primers: 50 CTCAATCCGATCAAAGTGCTAAAG30 and 50 AATTAAGTTCATCAGCTTGATCCG30 (The underlining indicates mismatched bases the encoding E507L and G511P mutations, respectively). Login to comment 46 ABCC1 p.Gly1161Pro ABCC1 p.Glu1157Leu We also used a pair of forward and reverse primers to generate E1157L/ G1161P mutations. Login to comment 47 ABCC1 p.Gly1161Pro ABCC1 p.Glu1157Leu The primers were: Forward: 50 TTGC- TGCCGGTCAGCGTCATTCGA30 , and reverse: 50 GGTC- AAGTTGAAATGGGAATA30 (The underlining indicates mismatched bases encoding the E1157L and G1161P mutations, respectively). Login to comment 99 ABCC1 p.Glu507Leu ABCC1 p.Gly511Pro Mutation of E507L/G511P in ICL5 of MRP1 almost completely inhibited the labeling of 8-azido-a-[32 P]ATP in NBD2 but not adjacent NBD1. Login to comment 110 ABCC1 p.Gly1161Pro ABCC1 p.Glu507Leu ABCC1 p.Glu1157Leu ABCC1 p.Gly511Pro ATP-dependent LTC4 transport by reconstituted E507L G511P/WT MRP1 or WT/E1157L G1161P MRP1 was considerably decreased and GSH-dependent photolabeling of azido AG-A of these MRP1 mutants was abrogated. Login to comment 148 ABCC1 p.Gly1433Asp A previous study suggested that ATP binding to both NBDs of MRP1 was not abrogated when the signature sequence of NBD2 was mutated (G1433D) (14). Login to comment