ABCC1 p.Glu1157Leu
| Predicted by SNAP2: | A: D (75%), C: D (80%), D: D (75%), F: D (91%), G: D (91%), H: D (91%), I: D (85%), K: D (91%), L: D (91%), M: D (75%), N: D (85%), P: D (91%), Q: D (85%), R: D (91%), S: D (80%), T: D (85%), V: D (85%), W: D (91%), Y: D (91%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] A functional role of intracellular loops of human ... J Biochem. 2006 Sep;140(3):313-8. Epub 2006 Jul 21. Ren XQ, Furukawa T, Yamamoto M, Aoki S, Kobayashi M, Nakagawa M, Akiyama S
A functional role of intracellular loops of human multidrug resistance protein 1.
J Biochem. 2006 Sep;140(3):313-8. Epub 2006 Jul 21., [PMID:16861249]
Abstract [show]
Multidrug resistance protein 1 (MRP1) is a human ATP-binding cassette (ABC) transporter in the plasma membrane. It confers multidrug resistance to tumor cells by actively effluxing intracellular drugs. To examine the functional significance of intracellular loops (ICLs) in MRP1, we determined the effect of mutation of the amino acid sequence EXXXG, which is conserved in ICL5 and ICL7 of human MRP1, 2 and 3, sulfonylurea receptor (SUR) 1 and 2, and mouse MRP1 and 2. E and G in the ICLs of human MRP1 were mutated to L and P, respectively, and the N-terminal (including ICL5) and C-terminal (including ICL7) wild type or mutant halves of MRP1 were co-expressed in insect cells. The mutation of either ICL5 or ICL7 considerably decreased ATP-dependent LTC4 uptake into vesicles of insect cells expressing mutated MRP1. GSH-dependent photolabeling of MRP1 with an 125I-labeled photoaffinity analog of azido agosterol A (azido AG-A) was abolished by the mutations in ICL5 and ICL7. Mutations in ICL5 of MRP1 almost completely inhibited the labeling of NBD2, but not NBD1, by 8-azido-alpha-[32P]ATP. In contrast, mutations in ICL7 of MRP1 abolished the labeling of both NBDs. Mutation of either ICL5 or ICL7 of MRP1 almost completely inhibited vanadate trapping with 8-azido-alpha-[32P]ATP by both NBD1 and NBD2 domains. These findings indicate that the intramolecular signaling between NBD and ICLs in MRP1 is vital for MRP1 function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 The strategies employed for site-directed mutagenesis of E507L/G511P and E1157L/G1161P in MRP1 cDNA were previously described (10).
X
ABCC1 p.Glu1157Leu 16861249:44:73
status: NEW46 We also used a pair of forward and reverse primers to generate E1157L/ G1161P mutations.
X
ABCC1 p.Glu1157Leu 16861249:46:63
status: NEW47 The primers were: Forward: 50 TTGC- TGCCGGTCAGCGTCATTCGA30 , and reverse: 50 GGTC- AAGTTGAAATGGGAATA30 (The underlining indicates mismatched bases encoding the E1157L and G1161P mutations, respectively).
X
ABCC1 p.Glu1157Leu 16861249:47:160
status: NEW110 ATP-dependent LTC4 transport by reconstituted E507L G511P/WT MRP1 or WT/E1157L G1161P MRP1 was considerably decreased and GSH-dependent photolabeling of azido AG-A of these MRP1 mutants was abrogated.
X
ABCC1 p.Glu1157Leu 16861249:110:72
status: NEW[hide] Mutational analysis of a highly conserved proline ... Drug Metab Dispos. 2007 Aug;35(8):1372-9. Epub 2007 May 9. Letourneau IJ, Slot AJ, Deeley RG, Cole SP
Mutational analysis of a highly conserved proline residue in MRP1, MRP2, and MRP3 reveals a partially conserved function.
Drug Metab Dispos. 2007 Aug;35(8):1372-9. Epub 2007 May 9., [PMID:17494643]
Abstract [show]
The ATP-binding cassette multidrug resistance protein 1 MRP1 (ABCC1) mediates the cellular efflux of organic anions including conjugated metabolites, chemotherapeutic agents, and toxicants. We previously described a mutation in cytoplasmic loop 7 (CL7) of MRP1, Pro1150Ala, which reduced leukotriene C(4) (LTC(4)) transport but increased 17beta-estradiol 17beta-d-glucuronide (E(2)17betaG) and methotrexate (MTX) transport. Vanadate-induced trapping of [alpha-(32)P]8N(3)ADP by the Pro1150Ala mutant in the absence of substrate was also greatly reduced compared with wild-type MRP1 suggesting an uncoupling of ATP hydrolysis and transport activity. To determine whether the functional importance of MRP1-Pro(1150) is conserved, the analogous Pro(1158) and Pro(1147) residues in the MRP2 and MRP3 transporters, respectively, were mutated to Ala. Expression levels of the three mutants were unaffected; however, the vesicular transport activity of at least one organic anion substrate was significantly altered. As observed for MRP1-Pro1150Ala, LTC(4) transport by MRP2-Pro1158Ala was decreased. However, E(2)17betaG and MTX transport was comparable with that of wild-type MRP2 rather than increased as was observed for MRP1-Pro1150Ala. In the case of MRP3-Pro1147Ala, LTC(4) transport was increased, whereas E(2)17betaG transport was unaffected. MTX transport by MRP3-Pro1147Ala was also increased but to a lesser extent than for MRP1-Pro1150Ala. In contrast, all three mutants showed a marked reduction in levels of vanadate-induced trapped [alpha-(32)P]8N(3)ADP. We conclude that MRP1-Pro(1150), MRP2-Pro(1158), and MRP3-Pro(1147) in CL7 differ in their influence on substrate specificity but share a common role in the nucleotide interactions of these transporters.
Comments [show]
None has been submitted yet.
No. Sentence Comment
221 Thus, the Glu1157Leu/ Gly1161Pro mutant displayed both decreased vanadate-induced 8N3ADP trapping as well as decreased 8N3ATP photolabeling at both NBDs (Ren et al., 2006).
X
ABCC1 p.Glu1157Leu 17494643:221:10
status: NEW223 Unfortunately, the Glu1157Leu/Gly1161Pro mutant was not tested with other substrates, so it is not known whether the decreased transport activity of this mutant was substrate-selective.
X
ABCC1 p.Glu1157Leu 17494643:223:19
status: NEW[hide] Multiple roles of charged amino acids in cytoplasm... Mol Pharmacol. 2009 Feb;75(2):397-406. Epub 2008 Nov 17. Conseil G, Rothnie AJ, Deeley RG, Cole SP
Multiple roles of charged amino acids in cytoplasmic loop 7 for expression and function of the multidrug and organic anion transporter MRP1 (ABCC1).
Mol Pharmacol. 2009 Feb;75(2):397-406. Epub 2008 Nov 17., [PMID:19015228]
Abstract [show]
Multidrug resistance protein MRP1 mediates the ATP-dependent efflux of many chemotherapeutic agents and organic anions. MRP1 has two nucleotide binding sites (NBSs) and three membrane spanning domains (MSDs) containing 17 transmembrane helices linked by extracellular and cytoplasmic loops (CL). Homology models suggest that CL7 (amino acids 1141-1195) is in a position where it could participate in signaling between the MSDs and NBSs during the transport process. We have individually replaced eight charged residues in CL7 with Ala, and in some cases, an amino acid with the same charge, and then investigated the effects on MRP1 expression, transport activity, and nucleotide and substrate interactions. A triple mutant in which Glu(1169), Glu(1170), and Glu(1172) were all replaced with Ala was also examined. The properties of R1173A and E1184A were comparable with those of wild-type MRP1, whereas the remaining mutants were either poorly expressed (R1166A, D1183A) or exhibited reduced transport of one or more organic anions (E1144A, D1179A, K1181A, (1169)AAQA). Same charge mutant D1183E was also not expressed, whereas expression and activity of R1166K were similar to wild-type MRP1. The moderate substrate-selective changes in transport activity displayed by mutants E1144A, D1179A, K1181A, and (1169)AAQA were accompanied by changes in orthovanadate-induced trapping of [alpha-(32)P]azidoADP by NBS2 indicating changes in ATP hydrolysis or release of ADP. In the case of E1144A, estradiol glucuronide no longer inhibited trapping of azidoADP. Together, our results demonstrate the extreme sensitivity of CL7 to mutation, consistent with its critical and complex dual role in both the proper folding and transport activity of MRP1.
Comments [show]
None has been submitted yet.
No. Sentence Comment
264 Ren et al. (2006) have recently confirmed the importance of CL7 in MRP1 function by substituting the highly conserved Glu1157 and Gly1161 with Leu and Pro, respectively.
X
ABCC1 p.Glu1157Leu 19015228:264:118
status: NEW265 They found that the double-mutant E1157L/G1161P no longer transported LTC4 and could not be labeled with the photoaffinity ligand azidoAgosterol A.
X
ABCC1 p.Glu1157Leu 19015228:265:34
status: NEW267 Thus, for reasons that are presently unclear, the interactions of the double E1157L/G1161P mutant with nucleotide differ substantially from those of the CL7 mutants we have described here and elsewhere (Conseil et al., 2006).
X
ABCC1 p.Glu1157Leu 19015228:267:77
status: NEW[hide] Structural and functional properties of human mult... Curr Med Chem. 2011;18(3):439-81. He SM, Li R, Kanwar JR, Zhou SF
Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1).
Curr Med Chem. 2011;18(3):439-81., [PMID:21143116]
Abstract [show]
Multidrug ABC transporters such as P-glycoprotein (P-gp/MDR1/ABCB1) and multidrug resistance protein 1 (MRP1/ABCC1) play an important role in the extrusion of drugs from the cell and their overexpression can be a cause of failure of anticancer and antimicrobial chemotherapy. Recently, the mouse P-gp/Abcb1a structure has been determined and this has significantly enhanced our understanding of the structure-activity relationship (SAR) of mammalian ABC transporters. This paper highlights our current knowledge on the structural and functional properties and the SAR of human MRP1/ABCC1. Although the crystal structure of MRP1/ABCC1 has yet to be resolved, the current topological model of MRP1/ABCC1 contains two transmembrane domains (TMD1 and TMD2) each followed by a nucleotide binding domain (NBD) plus a third NH2-terminal TMD0. MRP1/ABCC1 is expressed in the liver, kidney, intestine, brain and other tissues. MRP1/ABCC1 transports a structurally diverse array of important endogenous substances (e.g. leukotrienes and estrogen conjugates) and xenobiotics and their metabolites, including various conjugates, anticancer drugs, heavy metals, organic anions and lipids. Cells that highly express MRP1/ABCC1 confer resistance to a variety of natural product anticancer drugs such as vinca alkaloids (e.g. vincristine), anthracyclines (e.g. etoposide) and epipodophyllotoxins (e.g. doxorubicin and mitoxantrone). MRP1/ABCC1 is associated with tumor resistance which is often caused by an increased efflux and decreased intracellular accumulation of natural product anticancer drugs and other anticancer agents. However, most compounds that efficiently reverse P-gp/ABCB1-mediated multidrug resistance have only low affinity for MRP1/ABCC1 and there are only a few effective and relatively specific MRP1/ABCC1 inhibitors available. A number of site-directed mutagenesis studies, biophysical and photolabeling studies, SAR and QSAR, molecular docking and homology modeling studies have documented the role of multiple residues in determining the substrate specificity and inhibitor selectivity of MRP1/ABCC1. Most of these residues are located in the TMs of TMD1 and TMD2, in particular TMs 4, 6, 7, 8, 10, 11, 14, 16, and 17, or in close proximity to the membrane/cytosol interface of MRP1/ABCC1. The exact transporting mechanism of MRP1/ABCC1 is unclear. MRP1/ABCC1 and other multidrug transporters are front-line mediators of drug resistance in cancers and represent important therapeutic targets in future chemotherapy. The crystal structure of human MRP1/ABCC1 is expected to be resolved in the near future and this will provide an insight into the SAR of MRP1/ABCC1 and allow for rational design of anticancer drugs and potent and selective MRP1/ABCC1 inhibitors.
Comments [show]
None has been submitted yet.
No. Sentence Comment
807 The double-mutant Glu1157Leu/Gly1161Pro showed no activity for LTC4 and was not labeled by the photoaffinity ligand azidoAgosterol A [365].
X
ABCC1 p.Glu1157Leu 21143116:807:20
status: NEW