ABCMdb

ABCC1 p.Gly511Pro

Predicted by SNAP2:	A: D (80%), C: D (80%), D: D (91%), E: D (91%), F: D (91%), H: D (85%), I: D (91%), K: D (95%), L: D (91%), M: D (91%), N: D (75%), P: D (95%), Q: D (91%), R: D (95%), S: D (80%), T: D (85%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] A functional role of intracellular loops of human ... J Biochem. 2006 Sep;140(3):313-8. Epub 2006 Jul 21. Ren XQ, Furukawa T, Yamamoto M, Aoki S, Kobayashi M, Nakagawa M, Akiyama S
A functional role of intracellular loops of human multidrug resistance protein 1.
J Biochem. 2006 Sep;140(3):313-8. Epub 2006 Jul 21., [PMID:16861249]

Abstract [show]
Multidrug resistance protein 1 (MRP1) is a human ATP-binding cassette (ABC) transporter in the plasma membrane. It confers multidrug resistance to tumor cells by actively effluxing intracellular drugs. To examine the functional significance of intracellular loops (ICLs) in MRP1, we determined the effect of mutation of the amino acid sequence EXXXG, which is conserved in ICL5 and ICL7 of human MRP1, 2 and 3, sulfonylurea receptor (SUR) 1 and 2, and mouse MRP1 and 2. E and G in the ICLs of human MRP1 were mutated to L and P, respectively, and the N-terminal (including ICL5) and C-terminal (including ICL7) wild type or mutant halves of MRP1 were co-expressed in insect cells. The mutation of either ICL5 or ICL7 considerably decreased ATP-dependent LTC4 uptake into vesicles of insect cells expressing mutated MRP1. GSH-dependent photolabeling of MRP1 with an 125I-labeled photoaffinity analog of azido agosterol A (azido AG-A) was abolished by the mutations in ICL5 and ICL7. Mutations in ICL5 of MRP1 almost completely inhibited the labeling of NBD2, but not NBD1, by 8-azido-alpha-[32P]ATP. In contrast, mutations in ICL7 of MRP1 abolished the labeling of both NBDs. Mutation of either ICL5 or ICL7 of MRP1 almost completely inhibited vanadate trapping with 8-azido-alpha-[32P]ATP by both NBD1 and NBD2 domains. These findings indicate that the intramolecular signaling between NBD and ICLs in MRP1 is vital for MRP1 function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 The strategies employed for site-directed mutagenesis of E507L/G511P and E1157L/G1161P in MRP1 cDNA were previously described (10). Login to comment
45 The primers used to generate E507L/G511P mutations were forward and reverse primers: 50 CTCAATCCGATCAAAGTGCTAAAG30 and 50 AATTAAGTTCATCAGCTTGATCCG30 (The underlining indicates mismatched bases the encoding E507L and G511P mutations, respectively). Login to comment
99 Mutation of E507L/G511P in ICL5 of MRP1 almost completely inhibited the labeling of 8-azido-a-[32 P]ATP in NBD2 but not adjacent NBD1. Login to comment
110 ATP-dependent LTC4 transport by reconstituted E507L G511P/WT MRP1 or WT/E1157L G1161P MRP1 was considerably decreased and GSH-dependent photolabeling of azido AG-A of these MRP1 mutants was abrogated. Login to comment

[hide] Multiple roles of charged amino acids in cytoplasm... Mol Pharmacol. 2009 Feb;75(2):397-406. Epub 2008 Nov 17. Conseil G, Rothnie AJ, Deeley RG, Cole SP
Multiple roles of charged amino acids in cytoplasmic loop 7 for expression and function of the multidrug and organic anion transporter MRP1 (ABCC1).
Mol Pharmacol. 2009 Feb;75(2):397-406. Epub 2008 Nov 17., [PMID:19015228]

Abstract [show]
Multidrug resistance protein MRP1 mediates the ATP-dependent efflux of many chemotherapeutic agents and organic anions. MRP1 has two nucleotide binding sites (NBSs) and three membrane spanning domains (MSDs) containing 17 transmembrane helices linked by extracellular and cytoplasmic loops (CL). Homology models suggest that CL7 (amino acids 1141-1195) is in a position where it could participate in signaling between the MSDs and NBSs during the transport process. We have individually replaced eight charged residues in CL7 with Ala, and in some cases, an amino acid with the same charge, and then investigated the effects on MRP1 expression, transport activity, and nucleotide and substrate interactions. A triple mutant in which Glu(1169), Glu(1170), and Glu(1172) were all replaced with Ala was also examined. The properties of R1173A and E1184A were comparable with those of wild-type MRP1, whereas the remaining mutants were either poorly expressed (R1166A, D1183A) or exhibited reduced transport of one or more organic anions (E1144A, D1179A, K1181A, (1169)AAQA). Same charge mutant D1183E was also not expressed, whereas expression and activity of R1166K were similar to wild-type MRP1. The moderate substrate-selective changes in transport activity displayed by mutants E1144A, D1179A, K1181A, and (1169)AAQA were accompanied by changes in orthovanadate-induced trapping of [alpha-(32)P]azidoADP by NBS2 indicating changes in ATP hydrolysis or release of ADP. In the case of E1144A, estradiol glucuronide no longer inhibited trapping of azidoADP. Together, our results demonstrate the extreme sensitivity of CL7 to mutation, consistent with its critical and complex dual role in both the proper folding and transport activity of MRP1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
268 Ren et al. (2006) also created the analogous double mutant (E507L/G511P) in CL5, the cytoplasmic loop that connects TM10 to TM11, and is predicted to be in contact with NBD2 (DeGorter et al., 2008). Login to comment

[hide] Expression and function of human MRP1 (ABCC1) is d... J Biol Chem. 2011 Mar 4;286(9):7202-13. Epub 2010 Dec 20. Iram SH, Cole SP
Expression and function of human MRP1 (ABCC1) is dependent on amino acids in cytoplasmic loop 5 and its interface with nucleotide binding domain 2.
J Biol Chem. 2011 Mar 4;286(9):7202-13. Epub 2010 Dec 20., 2011-03-04 [PMID:21177244]

Abstract [show]
Multidrug resistance protein 1 (MRP1) is an ATP-binding cassette transporter that effluxes drugs and organic anions across the plasma membrane. The 17 transmembrane helices of MRP1 are linked by extracellular and cytoplasmic loops (CLs), but their role in coupling the ATPase activity of MRP1 to the translocation of its substrates is poorly understood. Here we have examined the importance of CL5 by mutating eight conserved charged residues and the helix-disrupting Gly(511) in this region. Ala substitution of Lys(513), Lys(516), Glu(521), and Glu(535) markedly reduced MRP1 levels. Because three of these residues are predicted to lie at the interface of CL5 and the second nucleotide binding domain (NBD2), a critical role is indicated for this region in the plasma membrane expression of MRP1. Further support for this idea was obtained by mutating NBD2 amino acids His(1364) and Arg(1367) at the CL5 interface, which also resulted in reduced MRP1 levels. In contrast, mutation of Arg(501), Lys(503), Glu(507), Arg(532), and Gly(511) had no effect on MRP1 levels. Except for K503A, however, transport by these mutants was reduced by 50 to 75%, an effect largely attributable to reduced substrate binding and affinity. Studies with (32)P-labeled azido-ATP also indicated that whereas ATP binding by the G511I mutant was unchanged, vanadate-induced trapping of azido-ADP was reduced, indicating changes in the catalytic activity of MRP1. Together, these data demonstrate the multiple roles for CL5 in the membrane expression and function of MRP1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
270 Relevant to our findings described here are the properties of a double MRP1 mutant containing a Leu substitution of Glu507 and a Pro substitution of Gly511 (E507L/ G511P) after expression in insect cells (reported by Ren et al. (49)). Login to comment