ABCMdb

PMID: 15049699

Omote H, Figler RA, Polar MK, Al-Shawi MK
Improved energy coupling of human P-glycoprotein by the glycine 185 to valine mutation.
Biochemistry. 2004 Apr 6;43(13):3917-28., 2004-04-06 [PubMed]

Sentences

No. Mutations Sentence Comment

0 ABCB1 p.Gly185Val ABCB1 p.Gly185Val Improved Energy Coupling of Human P-glycoprotein by the Glycine 185 to Valine Mutation† Hiroshi Omote, Robert A. Figler, Mark K. Polar, and Marwan K. Al-Shawi* Department of Molecular Physiology and Biological Physics, UniVersity of Virginia Health System, P.O. Box 800736, CharlottesVille, Virginia 22908-0736 ReceiVed August 1, 2003; ReVised Manuscript ReceiVed January 28, 2004 ABSTRACT: A glycine 185 to valine mutation of human P-glycoprotein (ABCB1, MDR1) has been previously isolated from high colchicine resistance cell lines. Login to comment 3 ABCB1 p.Gly185Val Purified G185V enzyme shows altered basal ATPase activity but a strong stimulation of colchicineand etoposide-dependent activities, suggesting a tight regulation of ATPase activity by these drugs. Login to comment 6 ABCB1 p.Gly185Val Systematic thermodynamic analyses indicate that the G185V enzyme has modified thermodynamic properties of colchicineand etoposide-dependent activities. Login to comment 7 ABCB1 p.Gly185Val To improve the rate of colchicine or etoposide transport, the G185V enzyme has lowered the Arrhenius activation energy of the transport rate-limiting step. Login to comment 9 ABCB1 p.Gly185Val G185V P-glycoprotein transports etoposide or colchicine in an energetically more efficient way with decreased enthalpic and entropic components of the activation energy. Login to comment 11 ABCB1 p.Gly185Cys ABCB1 p.Gly185Cys EPR analysis of the spin-labeled G185C enzyme in a cysteine-less background and kinetic parameters of the G185C enzyme indicate that position 185 is surrounded by other residues and is volume sensitive. Login to comment 32 ABCB1 p.Gly185Val ABCB1 p.Gly185Val 1 Abbreviations: Cys(-), cysteine-less P-glycoprotein; DFP, diisopropyl fluorophosphate; DDM, n-dodecyl -D-maltopyranoside; E. coli lipid, ether/acetone-precipitated Escherichia coli lipid; EDTA, ethylenediaminetetraacetic acid; EGTA, ethylene glycol bis( -aminoethyl ether)-N,N,N',N'-tetraacetic acid; G185V, glycine 185 to valine substitution; kcat, turnover number; Km ATP , apparent Michaelis constant for ATP activation; Km D, apparent Michaelis constant for drug activation; Ki, drug inhibition constant; LFER, linear free energy relationship; PC, phosphatidylcholine; Pgp, P-glycoprotein; PMSF, phenylmethanesulfonyl fluoride; PS, phosphatidylserine; SL-verapamil, spin-labeled verapamil; Vb, apparent Vmax for basal ATPase activity; Vd, apparent Vmax for drug-dependent ATPase activity. Login to comment 39 ABCB1 p.Gly185Val ABCB1 p.Gly185Val Interestingly, the selected cell lines had a P-glycoprotein mutated at position 185 (glycine 185 to valine, G185V), and this mutation is now believed to be responsible for high colchicine resistance. Login to comment 40 ABCB1 p.Gly185Val Stein et al. (8) did demonstrate that cells expressing G185V P-glycoprotein had a decreased rate of colchicine uptake when compared to cells with wild-type P-glycoprotein. Login to comment 41 ABCB1 p.Gly185Val Although details of the improved resistance afforded by G185V P-glycoprotein are still not clear, it is highly correlated with the colchicine transport mechanism. Login to comment 46 ABCB1 p.Gly185Val To construct a human P-glycoprotein expression plasmid which carries the glycine 185 to valine mutation, part of pSK1.MDR (9) was transferred to a wild-type expression plasmid YEpMDR1HIS (10). Login to comment 58 ABCB1 p.Gly185Cys ABCB1 p.Gly185Cys ABCB1 p.Arg588Cys ABCB1 p.Arg588Cys YEpMDR1His∆CysG185C (glycine 185 to cysteine) and YEpMDR1His∆CysR588C (arginine 588 to cysteine) were generated by PCR mutagenesis using a set of primers (AAGATTAATGAATGTATTGGTGACAAA and TTTGT- CACCAATACATTCTTATAATTC, forward and reverse, respectively, for G185C, GTGATAGCTCATTGTTTGTC- TACAGTT and AACTGTAGACAAACAATGAGCTAT- CAC for R588C). Login to comment 112 ABCB1 p.Gly185Val RESULTS Drug Dependence of G185V ATPase ActiVity. Login to comment 113 ABCB1 p.Gly185Val Human G185V mutant P-glycoprotein was overexpressed in yeast plasma membranes using our yeast expression system in the presence of 10% glycerol as a chemical chaperone (10). Login to comment 121 ABCB1 p.Gly185Val Ramachandra et al. (21) previously reported altered kinetics of plasma membrane ATPase activity of cells expressing the G185V mutant Pgp, including a higher basal ATPase activity. Login to comment 123 ABCB1 p.Gly185Val There were marked differences between wild-type and G185V enzymes. Login to comment 124 ABCB1 p.Gly185Val Basal activity of G185V Pgp was reduced to 28% of basal wild-type activity (Figure 2 legend) although both enzyme activities were strongly stimulated by colchicine. Login to comment 125 ABCB1 p.Gly185Val G185V Pgp appeared to be more tightly regulated than wild type (Figure 2A). Login to comment 131 ABCB1 p.Gly185Val The apparent Km D for etoposide was decreased 4.4-fold by the G185V mutation. Login to comment 132 ABCB1 p.Gly185Val The apparent specificity constant, kcat/Km D , at saturating colchicine was reduced slightly from 4.0 × 103 to 1.1 × 103 M-1 s-1 by the G185V mutation. Login to comment 134 ABCB1 p.Gly185Val In contrast, the apparent specificity constant for etoposide was increased from 2.2 × 103 to 1.7 × 105 M-1 s-1 by the G185V mutation. Login to comment 135 ABCB1 p.Gly185Val Although the apparent specificity constants change in opposite directions by the G185V mutation for colchicine and etoposide, it will be shown later that the same underlying mechanism of improved drug transport applies to both drugs. Login to comment 142 ABCB1 p.Gly185Val On this basis, it appears that G185V Pgp binds colchicine tightly in the coupling transition state. Login to comment 155 ABCB1 p.Gly185Val When G185V Pgp etoposideor colchicine-dependent ATPase activities were plotted on Figure 3, they were located on the line for drug- FIGURE 1: Variation of apparent Km ATP as a function of temperature. Login to comment 160 ABCB1 p.Gly185Val ABCB1 p.Gly185Val Symbols: shaded O, WT basal (no drug present); 4, WT and 130 µM valinomycin; 3, WT and 130 µM verapamil; O, WT and 2 mM colchicine; shaded thick O, G185V basal; thick O, G185V and 5 mM colchicine. Login to comment 162 ABCB1 p.Gly185Val This means that etoposide- and colchicine-dependent ATPase activities of the G185V mutant enzyme have a rate-limiting transition state similar to that of other drug-transport-related coupled activities. Login to comment 176 ABCB1 p.Gly185Val However, the G185V mutation shifted the etoposideand colchicine-dependent activities toward the lower left corner (Figure 4). Login to comment 177 ABCB1 p.Gly185Val This shows that the G185V mutant enzyme requires fewer bond rearrangements than the wild type to reach the coupling transition state when transporting these two drugs. Login to comment 178 ABCB1 p.Gly185Val The G185V mutation turns etoposide and colchicine into excellent transport substrates for this enzyme form. Login to comment 185 ABCB1 p.Gly185Val ABCB1 p.Gly185Cys 100% basal ATPase activity values (Vb) were 0.90, 0.25, 0.55, and 0.18 µmol (mg of P-glycoprotein)-1 min-1 for WT, G185V, Cys(-), and G185C/Cys(-) P-glycoproteins, respectively. Login to comment 186 ABCB1 p.Gly185Val Panel A: O, WT plus colchicine; b, G185V plus colchicine. Login to comment 187 ABCB1 p.Gly185Val ABCB1 p.Gly185Cys Panel B: 0, WT plus etoposide; 9, G185V plus etoposide; ], Cys(-) plus colchicine; [, G185C/Cys(-) plus colchicine. Login to comment 188 ABCB1 p.Gly185Val ABCB1 p.Gly185Cys Table 1: Apparent Kinetic Constants of ATPase Activity of WT, Cysteine-less, and G185 Mutant P-glycoproteinsa verapamil valinomycinb colchicine etoposideb enzyme Km D (µM) Vd (U/mg)d Vd/Vb c (fold) Ki (mM) Km D (µM) Vd (U/mg) Vd/Vb (fold) Km D (µM) Vd (U/mg) Vd/Vb (fold) Ki (mM) Km D (µM) Vd (U/mg) Vd/Vb (fold) WT 62 5.7 6.4 0.64 2.0 3.7 4.1 680 2.5 2.8 18 145 1.3 1.4 G185V 64 1.6 6.4 1.0 3.3 1.1 4.2 5800 3.6 15 20 33 1.7 6.8 Cys(-)e 2.1 0.96 1.6 0.87 0.60 1.3 2.3 410 1.4 2.8 30 G185C/Cys(-) 5.3 0.46 2.6 1.5 1.2 0.30 1.7 1900 0.71 3.9 18 a Conditions were as follows: Standard ATPase activities were measured at 37 °C, pH 7.4, and 10 mM Mg‚ATP. Login to comment 199 ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Cys ABCB1 p.Gly185Cys The intrinsic Gibb`s free energy Table 2: Intrinsic Drug-Transport Rates and Corrected Transition State Thermodynamic Parameters for Steady-State Activity of WT, Cysteine-less, and G185 Mutant P-glycoproteinsa enzyme lipid typeb transport drug transport ratec (s-1) basal rate (Vb) (s-1) stimulationd (Vd/Vb) (fold) ∆Hq (kJ mol-1) T∆Sq (kJ mol-1) ∆Gq (kJ mol-1) WT type 1 none (basal) 1.9 104.8 30.9 73.9 WT type 1 colchicine 2.2 1.2 121.8 48.3 73.5 WT type 1 etoposide 2.1 1.1 159.5 85.8 73.7 G185V type 1 none (basal) 0.77 67.2 -9.0 76.2 G185V type 1 colchicine 6.6 8.6 105.4 (-16.4)e 34.7 (-13.6) 70.7 (-2.8) G185V type 1 etoposide 4.3 5.6 93.1 (-66.4) 21.3 (-64.5) 71.8 (-1.9) Cys(-) type 1 none (basal) 1.6 127.3 53.0 74.3 Cys(-) type 1 colchicine 3.6 2.2 145.6 73.3 72.2 G185C/Cys(-) type 1 none (basal) 2.0 68.0 -5.7 73.3 G185C/Cys(-) type 1 colchicine 5.2 2.6 98.6 (-47.0) 27.3 (-46.0) 71.3 (-0.9) WT type 2 none (basal) 3.7 134.9 62.7 72.2 WT type 2 colchicine 4.3 1.2 136.2 64.4 71.8 G185V type 2 none (basal) 2.9 107.9 35.1 72.8 G185V type 2 colchicine 8.5 2.9 111.9 (-24.3) 41.8 (-22.6) 70.1 (-1.7) WT type 3 none (basal) 2.6 102.4 29.3 73.1 WT type 3 colchicine 5.6 2.1 121.5 50.4 71.1 G185V type 3 none (basal) 5.5 97.6 26.5 71.1 G185V type 3 colchicine 12.2 2.2 104.5 (-17.0) 35.4 (-15.0) 69.1 (-2.0) a Intrinsic values were calculated at 35 °C, pH 7.5, with saturating Mg‚ATP and saturating transport drug if present. Login to comment 210 ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Cys ABCB1 p.Gly185Cys Large symbols: shaded O, WT basal; O, WT plus colchicine; 0, WT plus etoposide; 4, WT plus valinomycin; 3, WT plus verapamil; shaded thick O, G185V basal activity; thick O, G185V plus colchicine; thick 0, G185V plus etoposide; shaded ], Cys(-) basal; ], Cys(-) plus colchicine; shaded ] (thick line), G185C/Cys(-) basal; ] (thick line), G185C/ Cys(-) plus colchicine. Login to comment 221 ABCB1 p.Gly185Val ABCB1 p.Gly185Val ABCB1 p.Gly185Cys Symbols: b, WT with colchicine; 9, WT with etoposide; 2, WT with valinomycin; 1, WT with verapamil; shaded O, G185V with colchicine; shaded 0, G185V with etoposide; [, Cys(-) with colchicine; shaded ], G185C/Cys(-) with colchicine. Login to comment 224 ABCB1 p.Gly185Val These results confirm that the major effect of the G185V mutation is in the improved catalytic efficiency for etoposide or colchicine transport. Login to comment 227 ABCB1 p.Gly185Val To ensure that our results and interpretations were valid, we reconstituted wild-type and G185V P-glycoproteins in three types of lipid preparations (see Materials and Methods for details). Login to comment 228 ABCB1 p.Gly185Val The basal activities for wild-type P-glycoprotein, when assayed using the conditions of Table 1, were 0.9, 1.4, and 1.0 µmol (mg of P-glycoprotein)-1 min-1 for type 1, 2, and 3 lipids, respectively (1.5-fold range), whereas the basal activities for G185V P-glycoprotein were 0.25, 1.2, and 2.2 µmol (mg of P-glycoprotein)-1 min-1 for type 1, 2, and 3 lipids, respectively (9-fold range). Login to comment 229 ABCB1 p.Gly185Val Thus, it appears that the G185V mutation is more sensitive than WT Pgp to the type of lipid in the membrane and in lipid control of the flux through the uncoupled basal cycle. Login to comment 230 ABCB1 p.Gly185Val Nevertheless, when the intrinsic thermodynamic parameters were calculated for colchicine-dependent activity of G185V and compared to WT Pgp, there was always improved colchicine transport by the mutation in any lipid type (Table 2). Login to comment 242 ABCB1 p.Gly185Val ABCB1 p.Gly185Val In Table 2 it can be seen that the transport rates of etoposide and colchicine were increased by 2and 3-fold, respectively, in type 1 lipids for G185V Pgp compared to WT Pgp. Login to comment 243 ABCB1 p.Gly185Val Similarly, a 2-fold increase in the rate of colchicine transport by G185V Pgp in type 2 and type 3 lipids was observed (Table 2). Login to comment 249 ABCB1 p.Gly185Cys The G185C mutant enzyme was made on the Cys(-) background in which all seven cysteines were changed to alanines (11). Login to comment 250 ABCB1 p.Gly185Val ABCB1 p.Gly185Cys Colchicine-dependent activities of G185C/Cys(-) and Cys(-) enzymes are shown in Figure 2B and are qualitatively similar to the pattern seen with G185V when compared to wild-type P-glycoprotein (Figure 2A). Login to comment 251 ABCB1 p.Gly185Cys Kinetic constants of G185C/Cys(-) and Cys(-) enzymes are summarized in Table 1. Login to comment 256 ABCB1 p.Gly185Cys Nonetheless, replacing glycine 185 with cysteine in this Cys(-) background (containing a total of eight other point substitutions) still increased Km D for colchicine and also increased the extent of ATPase activation (Table 1). Login to comment 257 ABCB1 p.Gly185Val Overall, the situation was quite similar to the G185V mutation compared against wild-type Pgp (Table 1). Login to comment 258 ABCB1 p.Gly185Val ABCB1 p.Gly185Cys Furthermore, G185C/Cys(-) when compared to the parental Cys(-) enzyme behaved in a fashion similar to G185V compared to wild-type Pgp on the LFER plot (Figure 3). Login to comment 260 ABCB1 p.Gly185Cys Thus, G185C/Cys(-) Pgp transports colchicine more efficiently than Cys(-) Pgp, as can be discerned in Figure 4. Login to comment 263 ABCB1 p.Gly185Cys Figure 5 shows a representative EPR spectrum of spin-labeled G185C/Cys(-). Login to comment 265 ABCB1 p.Gly185Cys The center peak width of spin-labeled G185C/Cys(-) enzyme was approximately 4.2 ( 0.14 G ((standard error). Login to comment 266 ABCB1 p.Gly185Cys FIGURE 5: EPR spectra of spin-labeled G185C. Login to comment 267 ABCB1 p.Gly185Cys G185C/Cys(-) P-glycoprotein was spin-labeled with proxylmaleimide as described in Materials and Methods, and the EPR spectrum was measured. Login to comment 270 ABCB1 p.Arg588Cys For comparison, the partially buried spin-labeled R588C/Cys(-), which is located near the surface region of the catalytic domain (see Figure 7), showed a smaller center peak width (3.7 ( 0.04 G). Login to comment 271 ABCB1 p.Gly185Cys ABCB1 p.Gly185Cys In the case of the G185C-SL enzyme there was no significant change in spin-label motional freedom on the addition of ATP, drug, or ATP plus drug, further demonstrating the restricted position of the G185C residue. Login to comment 272 ABCB1 p.Arg588Cys In contrast, for R588C-SL, the mobility of the spin probe increased in the presence of ATP (∆∆H0 ) -0.11 G) and stayed nearly constant with drugs (∆∆H0 ) +0.01 G for verapamil) but was the most mobile in the presence of both ligands (∆∆H0 ) -0.28 G). Login to comment 278 ABCB1 p.Gly185Val The P-glycoprotein G185V mutant was first isolated from highly colchicine-resistant cell lines (6). Login to comment 279 ABCB1 p.Gly185Val Cell lines having G185V Pgp exhibit higher resistance to colchicine and etopside but a decreased resistance to vinblastine, Taxol, and actinomycin D, suggesting altered drug specificity (7, 32, 33). Login to comment 280 ABCB1 p.Gly185Val The high resistance to colchicine was thought to have originated from altered kinetics of the mutant enzyme since there was increased colchicine extrusion from cells without a concomitant change in plasma membrane G185V Pgp expression levels (7, 21, 33). Login to comment 281 ABCB1 p.Gly185Val Thus, G185V Pgp is of great interest for understanding the mechanism of drug specificity and transport. Login to comment 284 ABCB1 p.Gly185Val On the other hand, Roninson and co-workers reported reduced affinity of G185V to colchicine based on a P-glycoprotein conformation-specific antibody (33). Login to comment 292 ABCB1 p.Gly185Val First, G185V Pgp has a lowered apparent affinity to colchicine and decreased basal ATPase activity in type 1 lipids (Figure 2A, Table 1). Login to comment