ABCMdb

ABCB1 p.Gly185Cys

ClinVar:	c.554G>T , p.Gly185Val D , Pathogenic
Predicted by SNAP2:	A: N (53%), C: D (75%), D: D (85%), E: D (91%), F: D (85%), H: D (91%), I: D (85%), K: D (91%), L: D (80%), M: D (85%), N: D (85%), P: D (91%), Q: D (91%), R: D (91%), S: D (75%), T: D (80%), V: D (75%), W: D (91%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] The packing of the transmembrane segments of human... J Biol Chem. 2000 Feb 25;275(8):5253-6. Loo TW, Clarke DM
The packing of the transmembrane segments of human multidrug resistance P-glycoprotein is revealed by disulfide cross-linking analysis.
J Biol Chem. 2000 Feb 25;275(8):5253-6., 2000-02-25 [PMID:10681495]

Abstract [show]
Residues from several transmembrane (TM) segments of P-glycoprotein (P-gp) likely form the drug-binding site(s). To determine the organization of the TM segments, pairs of cysteine residues were introduced into the predicted TM segments of a Cys-less P-gp, and the mutant protein was subjected to oxidative cross-linking. In SDS gels, the cross-linked product migrated with a slower mobility than the native protein. The cross-linked products were not detected in the presence of dithiothreitol. Cross-linking was observed in 12 of 125 mutants. The pattern of cross-linking suggested that TM6 is close to TMs 10, 11, and 12, while TM12 is close to TMs 4, 5, and 6. In some mutants the presence of drug substrate colchicine, verapamil, cyclosporin A, or vinblastine either enhanced or inhibited cross-linking. Cross-linking was inhibited in the presence of ATP plus vanadate. These results suggest that the TM segments critical for drug binding must be close to each other and exhibit different conformational changes in response to binding of drug substrate or vanadate trapping of nucleotide. Based on these results, we propose a model for the arrangement of the TM segments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 In these cross-linking experiments, the amount of oxidant was lowered by 10-fold (0.2 mM), and the minimum temperature required to induce cross-TABLE I Cross-linking analysis of P-gp Cross-linking of S993C (TM12) with residues in the following TM: TM1 TM2 TM3 TM4 TM5 M51C -a Y130C - G185C - G226C - I293C - V52C - I131C - I186C - L227C ϩb T294C - V53C - Q132C - G187C - S228C - A295C ϩ G54C - V133C - D188C - A229C - N296C - T55C - S134C - K189C - A230C - I297C - L56C - F135C - I190C - V231C ϩ S298C - A57C - W136C - G191C - W232C ϩ I299C ϩ A58C - C137C - M192C - A233C ϩ G300C - I59C - L138C - F193C - K234C - A301C - I60C - A139C - F194C - I235C ϩ A302C - H61C - A140C - Q195C - L236C ϩ F303C - G141C - S196C - S237C - L304C - Cross-linking of P350C (TM6) with residues in the following TM: TM7 TM8 TM9 TM10 TM11 F711C - F770C - A828C - I867C - A935C - V712C - F771C - I829C - I868C - H936C - V713C - L772C - G830C - A869C - I937C - G714C - Q773C - S831C - I870C - F938C - V715C - G774C - R832C - A871C - G939C ϩ F716C - F775C - L833C - G872C - I940C - C717C - T776C - A834C - V873C - T941C - A718C - F777C - V835C - V874C ϩ F942C - I719C - G778C - I836C - E875C ϩ S943C - I720C - K779C - T837C - M876C ϩ F944C - N721C - A780C - Q838C - K877C - T945C - G722C - G781C - N839C - M878C - Q946C - G723C - E782C - I840C - L879C - A947C - I783C - a -, no cross-linked product detected in SDS-PAGE. b ϩ, cross-linked product detected in SDS-PAGE. Login to comment

[hide] Improved energy coupling of human P-glycoprotein b... Biochemistry. 2004 Apr 6;43(13):3917-28. Omote H, Figler RA, Polar MK, Al-Shawi MK
Improved energy coupling of human P-glycoprotein by the glycine 185 to valine mutation.
Biochemistry. 2004 Apr 6;43(13):3917-28., 2004-04-06 [PMID:15049699]

Abstract [show]
A glycine 185 to valine mutation of human P-glycoprotein (ABCB1, MDR1) has been previously isolated from high colchicine resistance cell lines. We have employed purified and reconstituted P-glycoproteins expressed in Saccharomyces cerevisiae [Figler et al. (2000) Arch. Biochem. Biophys. 376, 34-46] and devised a set of thermodynamic analyses to reveal the mechanism of improved resistance. Purified G185V enzyme shows altered basal ATPase activity but a strong stimulation of colchicine- and etoposide-dependent activities, suggesting a tight regulation of ATPase activity by these drugs. The mutant enzyme has a higher apparent K(m) for colchicine and a lower K(m) for etoposide than that of wild type. Kinetic constants for other transported drugs were not significantly modified by this mutation. Systematic thermodynamic analyses indicate that the G185V enzyme has modified thermodynamic properties of colchicine- and etoposide-dependent activities. To improve the rate of colchicine or etoposide transport, the G185V enzyme has lowered the Arrhenius activation energy of the transport rate-limiting step. The high transition state energies of wild-type P-glycoprotein, when transporting etoposide or colchicine, increase the probability of nonproductive degradation of the transition state without transport. G185V P-glycoprotein transports etoposide or colchicine in an energetically more efficient way with decreased enthalpic and entropic components of the activation energy. Our new data fully reconcile the apparently conflicting results of previous studies. EPR analysis of the spin-labeled G185C enzyme in a cysteine-less background and kinetic parameters of the G185C enzyme indicate that position 185 is surrounded by other residues and is volume sensitive. These results and atomic detail structural modeling suggest that residue 185 is a pivotal point in transmitting conformational changes between the catalytic sites and the colchicine drug binding domain. Replacement of this residue with a bulky valine alters this communication and results in more efficient transport of etoposide or colchicine.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 EPR analysis of the spin-labeled G185C enzyme in a cysteine-less background and kinetic parameters of the G185C enzyme indicate that position 185 is surrounded by other residues and is volume sensitive. Login to comment
58 YEpMDR1His∆CysG185C (glycine 185 to cysteine) and YEpMDR1His∆CysR588C (arginine 588 to cysteine) were generated by PCR mutagenesis using a set of primers (AAGATTAATGAATGTATTGGTGACAAA and TTTGT- CACCAATACATTCTTATAATTC, forward and reverse, respectively, for G185C, GTGATAGCTCATTGTTTGTC- TACAGTT and AACTGTAGACAAACAATGAGCTAT- CAC for R588C). Login to comment
185 100% basal ATPase activity values (Vb) were 0.90, 0.25, 0.55, and 0.18 µmol (mg of P-glycoprotein)-1 min-1 for WT, G185V, Cys(-), and G185C/Cys(-) P-glycoproteins, respectively. Login to comment
187 Panel B: 0, WT plus etoposide; 9, G185V plus etoposide; ], Cys(-) plus colchicine; [, G185C/Cys(-) plus colchicine. Login to comment
188 Table 1: Apparent Kinetic Constants of ATPase Activity of WT, Cysteine-less, and G185 Mutant P-glycoproteinsa verapamil valinomycinb colchicine etoposideb enzyme Km D (µM) Vd (U/mg)d Vd/Vb c (fold) Ki (mM) Km D (µM) Vd (U/mg) Vd/Vb (fold) Km D (µM) Vd (U/mg) Vd/Vb (fold) Ki (mM) Km D (µM) Vd (U/mg) Vd/Vb (fold) WT 62 5.7 6.4 0.64 2.0 3.7 4.1 680 2.5 2.8 18 145 1.3 1.4 G185V 64 1.6 6.4 1.0 3.3 1.1 4.2 5800 3.6 15 20 33 1.7 6.8 Cys(-)e 2.1 0.96 1.6 0.87 0.60 1.3 2.3 410 1.4 2.8 30 G185C/Cys(-) 5.3 0.46 2.6 1.5 1.2 0.30 1.7 1900 0.71 3.9 18 a Conditions were as follows: Standard ATPase activities were measured at 37 °C, pH 7.4, and 10 mM Mg‚ATP. Login to comment
199 The intrinsic Gibb`s free energy Table 2: Intrinsic Drug-Transport Rates and Corrected Transition State Thermodynamic Parameters for Steady-State Activity of WT, Cysteine-less, and G185 Mutant P-glycoproteinsa enzyme lipid typeb transport drug transport ratec (s-1) basal rate (Vb) (s-1) stimulationd (Vd/Vb) (fold) ∆Hq (kJ mol-1) T∆Sq (kJ mol-1) ∆Gq (kJ mol-1) WT type 1 none (basal) 1.9 104.8 30.9 73.9 WT type 1 colchicine 2.2 1.2 121.8 48.3 73.5 WT type 1 etoposide 2.1 1.1 159.5 85.8 73.7 G185V type 1 none (basal) 0.77 67.2 -9.0 76.2 G185V type 1 colchicine 6.6 8.6 105.4 (-16.4)e 34.7 (-13.6) 70.7 (-2.8) G185V type 1 etoposide 4.3 5.6 93.1 (-66.4) 21.3 (-64.5) 71.8 (-1.9) Cys(-) type 1 none (basal) 1.6 127.3 53.0 74.3 Cys(-) type 1 colchicine 3.6 2.2 145.6 73.3 72.2 G185C/Cys(-) type 1 none (basal) 2.0 68.0 -5.7 73.3 G185C/Cys(-) type 1 colchicine 5.2 2.6 98.6 (-47.0) 27.3 (-46.0) 71.3 (-0.9) WT type 2 none (basal) 3.7 134.9 62.7 72.2 WT type 2 colchicine 4.3 1.2 136.2 64.4 71.8 G185V type 2 none (basal) 2.9 107.9 35.1 72.8 G185V type 2 colchicine 8.5 2.9 111.9 (-24.3) 41.8 (-22.6) 70.1 (-1.7) WT type 3 none (basal) 2.6 102.4 29.3 73.1 WT type 3 colchicine 5.6 2.1 121.5 50.4 71.1 G185V type 3 none (basal) 5.5 97.6 26.5 71.1 G185V type 3 colchicine 12.2 2.2 104.5 (-17.0) 35.4 (-15.0) 69.1 (-2.0) a Intrinsic values were calculated at 35 °C, pH 7.5, with saturating Mg‚ATP and saturating transport drug if present. Login to comment
210 Large symbols: shaded O, WT basal; O, WT plus colchicine; 0, WT plus etoposide; 4, WT plus valinomycin; 3, WT plus verapamil; shaded thick O, G185V basal activity; thick O, G185V plus colchicine; thick 0, G185V plus etoposide; shaded ], Cys(-) basal; ], Cys(-) plus colchicine; shaded ] (thick line), G185C/Cys(-) basal; ] (thick line), G185C/ Cys(-) plus colchicine. Login to comment
221 Symbols: b, WT with colchicine; 9, WT with etoposide; 2, WT with valinomycin; 1, WT with verapamil; shaded O, G185V with colchicine; shaded 0, G185V with etoposide; [, Cys(-) with colchicine; shaded ], G185C/Cys(-) with colchicine. Login to comment
249 The G185C mutant enzyme was made on the Cys(-) background in which all seven cysteines were changed to alanines (11). Login to comment
250 Colchicine-dependent activities of G185C/Cys(-) and Cys(-) enzymes are shown in Figure 2B and are qualitatively similar to the pattern seen with G185V when compared to wild-type P-glycoprotein (Figure 2A). Login to comment
251 Kinetic constants of G185C/Cys(-) and Cys(-) enzymes are summarized in Table 1. Login to comment
256 Nonetheless, replacing glycine 185 with cysteine in this Cys(-) background (containing a total of eight other point substitutions) still increased Km D for colchicine and also increased the extent of ATPase activation (Table 1). Login to comment
258 Furthermore, G185C/Cys(-) when compared to the parental Cys(-) enzyme behaved in a fashion similar to G185V compared to wild-type Pgp on the LFER plot (Figure 3). Login to comment
260 Thus, G185C/Cys(-) Pgp transports colchicine more efficiently than Cys(-) Pgp, as can be discerned in Figure 4. Login to comment
263 Figure 5 shows a representative EPR spectrum of spin-labeled G185C/Cys(-). Login to comment
265 The center peak width of spin-labeled G185C/Cys(-) enzyme was approximately 4.2 ( 0.14 G ((standard error). Login to comment
266 FIGURE 5: EPR spectra of spin-labeled G185C. Login to comment
267 G185C/Cys(-) P-glycoprotein was spin-labeled with proxylmaleimide as described in Materials and Methods, and the EPR spectrum was measured. Login to comment
271 In the case of the G185C-SL enzyme there was no significant change in spin-label motional freedom on the addition of ATP, drug, or ATP plus drug, further demonstrating the restricted position of the G185C residue. Login to comment