ABCMdb

ABCB1 p.Arg588Cys

Predicted by SNAP2:	A: D (91%), C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (91%), I: D (91%), K: D (91%), L: D (95%), M: D (91%), N: D (91%), P: D (95%), Q: D (85%), S: D (91%), T: D (91%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Improved energy coupling of human P-glycoprotein b... Biochemistry. 2004 Apr 6;43(13):3917-28. Omote H, Figler RA, Polar MK, Al-Shawi MK
Improved energy coupling of human P-glycoprotein by the glycine 185 to valine mutation.
Biochemistry. 2004 Apr 6;43(13):3917-28., 2004-04-06 [PMID:15049699]

Abstract [show]
A glycine 185 to valine mutation of human P-glycoprotein (ABCB1, MDR1) has been previously isolated from high colchicine resistance cell lines. We have employed purified and reconstituted P-glycoproteins expressed in Saccharomyces cerevisiae [Figler et al. (2000) Arch. Biochem. Biophys. 376, 34-46] and devised a set of thermodynamic analyses to reveal the mechanism of improved resistance. Purified G185V enzyme shows altered basal ATPase activity but a strong stimulation of colchicine- and etoposide-dependent activities, suggesting a tight regulation of ATPase activity by these drugs. The mutant enzyme has a higher apparent K(m) for colchicine and a lower K(m) for etoposide than that of wild type. Kinetic constants for other transported drugs were not significantly modified by this mutation. Systematic thermodynamic analyses indicate that the G185V enzyme has modified thermodynamic properties of colchicine- and etoposide-dependent activities. To improve the rate of colchicine or etoposide transport, the G185V enzyme has lowered the Arrhenius activation energy of the transport rate-limiting step. The high transition state energies of wild-type P-glycoprotein, when transporting etoposide or colchicine, increase the probability of nonproductive degradation of the transition state without transport. G185V P-glycoprotein transports etoposide or colchicine in an energetically more efficient way with decreased enthalpic and entropic components of the activation energy. Our new data fully reconcile the apparently conflicting results of previous studies. EPR analysis of the spin-labeled G185C enzyme in a cysteine-less background and kinetic parameters of the G185C enzyme indicate that position 185 is surrounded by other residues and is volume sensitive. These results and atomic detail structural modeling suggest that residue 185 is a pivotal point in transmitting conformational changes between the catalytic sites and the colchicine drug binding domain. Replacement of this residue with a bulky valine alters this communication and results in more efficient transport of etoposide or colchicine.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 YEpMDR1His∆CysG185C (glycine 185 to cysteine) and YEpMDR1His∆CysR588C (arginine 588 to cysteine) were generated by PCR mutagenesis using a set of primers (AAGATTAATGAATGTATTGGTGACAAA and TTTGT- CACCAATACATTCTTATAATTC, forward and reverse, respectively, for G185C, GTGATAGCTCATTGTTTGTC- TACAGTT and AACTGTAGACAAACAATGAGCTAT- CAC for R588C). Login to comment
270 For comparison, the partially buried spin-labeled R588C/Cys(-), which is located near the surface region of the catalytic domain (see Figure 7), showed a smaller center peak width (3.7 ( 0.04 G). Login to comment
272 In contrast, for R588C-SL, the mobility of the spin probe increased in the presence of ATP (∆∆H0 ) -0.11 G) and stayed nearly constant with drugs (∆∆H0 ) +0.01 G for verapamil) but was the most mobile in the presence of both ligands (∆∆H0 ) -0.28 G). Login to comment