ABCMdb

ABCC8 p.Ala1457Thr

ClinVar:	c.4371C>G , p.Ile1457Met D , Likely pathogenic
Predicted by SNAP2:	C: N (93%), D: D (63%), E: D (59%), F: D (53%), G: N (66%), H: N (57%), I: N (66%), K: D (59%), L: N (53%), M: N (82%), N: N (57%), P: D (63%), Q: N (61%), R: N (53%), S: N (93%), T: N (82%), V: N (87%), W: D (59%), Y: N (53%),
Predicted by PROVEAN:	C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Sulfonylureas correct trafficking defects of ATP-s... J Biol Chem. 2004 Mar 19;279(12):11096-105. Epub 2004 Jan 5. Yan F, Lin CW, Weisiger E, Cartier EA, Taschenberger G, Shyng SL
Sulfonylureas correct trafficking defects of ATP-sensitive potassium channels caused by mutations in the sulfonylurea receptor.
J Biol Chem. 2004 Mar 19;279(12):11096-105. Epub 2004 Jan 5., [PMID:14707124]

Abstract [show]
The pancreatic ATP-sensitive potassium (K(ATP)) channel, a complex of four sulfonylurea receptor 1 (SUR1) and four potassium channel Kir6.2 subunits, regulates insulin secretion by linking metabolic changes to beta-cell membrane potential. Sulfonylureas inhibit K(ATP) channel activities by binding to SUR1 and are widely used to treat type II diabetes. We report here that sulfonylureas also function as chemical chaperones to rescue K(ATP) channel trafficking defects caused by two SUR1 mutations, A116P and V187D, identified in patients with congenital hyperinsulinism. Sulfonylureas markedly increased cell surface expression of the A116P and V187D mutants by stabilizing the mutant SUR1 proteins and promoting their maturation. By contrast, diazoxide, a potassium channel opener that also binds SUR1, had no effect on surface expression of either mutant. Importantly, both mutant channels rescued to the cell surface have normal ATP, MgADP, and diazoxide sensitivities, demonstrating that SUR1 harboring either the A116P or the V187D mutation is capable of associating with Kir6.2 to form functional K(ATP) channels. Thus, sulfonylureas may be used to treat congenital hyperinsulinism caused by certain K(ATP) channel trafficking mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
293 Comparison with Other Trafficking Mutants-A number of missense or point deletion mutations in SUR1 have been reported to reduce or prevent cell surface expression of KATP channels, including ⌬F1388, R1394H, L1544P, A1457T, V1550D, and L1551V (34-36, 50). Login to comment
290 Comparison with Other Trafficking Mutants-A number of missense or point deletion mutations in SUR1 have been reported to reduce or prevent cell surface expression of KATP channels, including èc;F1388, R1394H, L1544P, A1457T, V1550D, and L1551V (34-36, 50). Login to comment

[hide] Acute insulin response tests for the differential ... J Clin Endocrinol Metab. 2002 Oct;87(10):4502-7. Huopio H, Jaaskelainen J, Komulainen J, Miettinen R, Karkkainen P, Laakso M, Tapanainen P, Voutilainen R, Otonkoski T
Acute insulin response tests for the differential diagnosis of congenital hyperinsulinism.
J Clin Endocrinol Metab. 2002 Oct;87(10):4502-7., [PMID:12364426]

Abstract [show]
Mutations in genes encoding the two subunits of the beta-cell ATP-sensitive potassium channel (K(ATP)) channel (SUR1 and Kir6.2) are the major cause of congenital hyperinsulinism (CHI). In this study, the K(ATP) channel genes were screened in a population-based study that included all verified Finnish CHI patients (n = 43) in a 27-yr period. Seven different mutations were identified, which accounted for 60% of all cases. The functional consequences of the major missense mutations were studied in vivo by determining acute (1-3 min) plasma insulin and C-peptide responses to calcium (n = 18), glucose (n = 12), and tolbutamide (n = 11) in those CHI patients who were able to take part in these studies. C-peptide and insulin responses to calcium were significantly higher in the patients with SUR1-E1506K mutation, compared with patients without K(ATP) channel mutations. The patients with SUR1-V187D mutation showed a reduced response to tolbutamide but unexpectedly did not show any response to calcium stimulation. A compound heterozygous patient with Kir6.2-(-54)/K67N mutations responded to calcium but also to tolbutamide. In conclusion, our results show that a positive response in the calcium test is indicative of a K(ATP) channel mutation, but all mutations cannot be identified with this method. The insulin response to tolbutamide in patients with SUR1 mutations is impaired to different extents, depending on the genotype. The combination of calcium and tolbutamide tests is a useful tool for the detection of CHI patients with K(ATP) channel dysfunction. Our results, however, also demonstrate the complexity of these responses and the difficulties in their interpretation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 The patients with paternal SUR1-V187D and maternal SUR1-A1457T (n ϭ 1) or SUR1-V1550D (n ϭ 1) were excluded from AIR tests because of the requirement of insulin more than 0.5 U/kg per day. Login to comment
58 Clinical characteristics of the patients Case Sex Age Cause of hyperinsulinism Previous treatment of hyperinsulinism No KATP channel mutation 1 M 2 Unknown Diazoxide 2 F 3 Unknown Octreotide 3 M 5 Unknown Diazoxide 4 M 20 Unknown Diazoxide, subtotal pancreatectomy 5 F 26 Unknown Diazoxide Kir6.2-(-54)/K67N 6 M 8 Paternal Kir6.2-K67N, maternal Kir6.2-(-54) Octreotide, subtotal pancreatectomy SUR1-E1506K 7 F 6 Dominant maternal SUR1-E1506K Diazoxide 8 F 9 Dominant maternal SUR1-E1506K Diazoxide 9 F 15 Dominant maternal SUR1-E1506K Frequent feeds 10 F 16 Dominant maternal SUR1-E1506K Diazoxide 11 F 19 Dominant maternal SUR1-E1506K Frequent feeds 12 M 27 Dominant maternal SUR1-E1506K Diazoxide, subtotal pancreatectomy SUR1-V187D 13 F 1 Paternal SUR1-V187D, maternal genotype pending Octreotide 14 F 6 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 15 M 8 Paternal SUR1-V187D, maternal genotype pending Subtotal pancreatectomy 16 F 8 Homozygous SUR1-V187D Subtotal pancreatectomy 17 F 9 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 18 F 14 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 19 M 11 Paternal SUR1-V187D, maternal SUR1-A1457T Subtotal pancreatectomy 20 F 13 Paternal SUR1-V187D, maternal SUR1-V1550D Subtotal pancreatectomy SUR1-L1551V 21 M 2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide 22 F 0.2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide Diabetic patients are shown in italics. Login to comment
82 The mutation A1457T in exon 36 was found to be maternally inherited in one compound heterozygote patient with the paternally inherited mutation SUR1-V187D (case 19). Login to comment
94 Primers, PCR conditions, and restriction endonucleases used in the detection of novel KATP channel mutations Substitution Primers (5Ј33Ј) PCR program (C/cycles) Size of the PCR product (bp) Restriction endonucleasea SUR1-A1457T ACCCTGCTCCCTCCTACTG 94-64-72/30 192 HphI GTCCTTGAGTGCCCAACC SUR1-V1550D GGGTGGTATTCCCACCATC 94-65-72/30 230 GTATGGGCAGGGTCCGAAT SUR1-L1551V GGGTGGTATTCCCACCATC 94-65-72/30 230 BseLI GTATGGGCAGGGTCCGAAT Kir6.2-(-54) ACCGAGAGGACTCTGCAGTGA 94-65-72/35 216 NlaIII GTTGCAGTTGCCTTTCTTGGA Kir6.2-K67N GAAAGGCAACTGCAACGTGG 94-58-72/30 278 BseNI TAGTCACTTGGACCTCAATG a The restriction endonuclease recognizing the mutation. Login to comment
110 Correlation between genotype and phenotype The verified compound heterozygote subjects (A1457T/ V187D and V1550D/V187D) show a very severe and drug-resistant disease phenotype. Login to comment

[hide] Characterisation of new KATP-channel mutations ass... Diabetologia. 2003 Feb;46(2):241-9. Epub 2003 Jan 9. Reimann F, Huopio H, Dabrowski M, Proks P, Gribble FM, Laakso M, Otonkoski T, Ashcroft FM
Characterisation of new KATP-channel mutations associated with congenital hyperinsulinism in the Finnish population.
Diabetologia. 2003 Feb;46(2):241-9. Epub 2003 Jan 9., [PMID:12627323]

Abstract [show]
AIMS/HYPOTHESIS: ATP-sensitive potassium (K(ATP)) channels are crucial for the regulation of insulin secretion from pancreatic beta cells and mutations in either the Kir6.2 or SUR1 subunit of this channel can cause congenital hyperinsulinism (CHI). The aim of this study was to analyse the functional consequences of four CHI mutations (A1457T, V1550D and L1551V in SUR1, and K67N in Kir6.2) recently identified in the Finnish population. METHODS: Wild type or mutant Kir6.2 and SUR1 subunits were coexpressed in Xenopus oocytes. The functional properties of the channels were examined by measuring currents in intact oocytes or giant inside-out membrane patches. Surface expression was measured by enzyme-linked immunosorbance assay, using HA-epitope-tagged subunits. RESULTS: Two mutations (A1457T and V1550D) prevented trafficking of the channel to the plasma membrane. The L1551V mutation reduced surface expression 40-fold, and caused loss of MgADP and diazoxide activation. Both these factors will contribute to the lack of K(ATP) current activation observed in response to metabolic inhibition in intact oocytes. The L1551V mutation also increased the channel open probability, thereby producing a reduction in ATP-sensitivity (from 10 micro mol/l to 120 micro mol/l). The fourth mutation (K67N mutation in Kir6.2) did not affect surface expression nor alter the properties of K(ATP) channels in excised patches, but resulted in a reduced K(ATP) current amplitude in intact cells on metabolic inhibition, through an unidentified mechanism. CONCLUSION/INTERPRETATION: The four CHI mutations disrupted K(ATP) channel activity by different mechanisms. Our results are discussed in relation to the CHI phenotype observed in patients with these mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 The aim of this study was to analyse the functional consequences of four CHI mutations (A1457T, V1550D and L1551V in SUR1, and K67N in Kir6.2) recently identified in the Finnish population. Login to comment
8 Two mutations (A1457T and V1550D) prevented trafficking of the channel to the plasma membrane. Login to comment
40 Three of these mutations are found in the C-terminal domain of SUR1 (L1551V, A1457T and V1550D), and one is found in the N-terminus of Kir6.2 (K67N). Login to comment
94 Metabolic poisoning with 3 mmol/l azide induced a large increase in Kir6.2/SUR1 currents, a smaller increase in Kir6.2-K67N/SUR1 and Kir6.2/SUR1-L1551V currents, and no significant change in Kir6.2/SUR1-A1457T or Kir6.2/SUR1-V1550D currents. Login to comment
101 Addition of 340 µmol/l diazoxide, in the continued presence of azide, increased Kir6.2/SUR1 and Kir6.2-K67N/SUR1 currents but did not activate Kir6.2/ SUR1-L1551V, Kir6.2/SUR1-A1457T or Kir6.2/SUR1-V1550D currents. Login to comment
110 In contrast, no measurable currents were observed in patches excised from oocytes coexpressing Kir6.2 and either SUR1-A1457T or SUR1-V1550D. Login to comment
115 Kir6.2-HA was detectable in the plasma membrane when coexpressed with wild-type SUR1, but not when coexpressed with either SUR1-A1457T or SUR1-V1550D (Fig. 3B). Login to comment
117 Thus, these mutations prevent (A1457T, V1550D) or reduce (L1551V) plasma membrane targeting of KATP channels expressed in oocytes. Login to comment
125 Oocytes were co-injected (as indicated) with mRNAs encoding Kir6.2 plus either SUR1, SUR1-A1457T, SUR1-V1550D or SUR1-L1551V, or with Kir6.2-K67N plus SUR1, or with Kir6.2∆36 alone. Login to comment
148 The number of oocytes is given above the bars. Statistical significance (t test) was tested against uninjected oocytes for Kir6.2HA coinjected with SUR1, SUR1-A1457T, SUR1-V1550D or SUR1-L1551V. Login to comment
169 Two of the mutations in SUR1 (A1457T and V1550D) prevented trafficking of the channel to the plasma membrane. Login to comment
185 Two mutations in SUR1 (A1457T and V1550D), that did not result in functional channels in Xenopus oocytes, were each found only once in the Finnish population [23]. Login to comment