ABCMdb

ABCC7 p.Ile506Val

ClinVar:	c.1518C>G , p.Ile506Met ? , not provided c.1517T>C , p.Ile506Thr ? , not provided c.1516A>C , p.Ile506Leu ? , not provided c.1516A>G , p.Ile506Val N , Benign c.1517T>G , p.Ile506Ser ? , not provided
CF databases:	c.1516A>C , p.Ile506Leu (CFTR1) D , The mutation was found in one Swedish CF patient by multiplex heteroduplex analysis on an MDE gel. The patient carried [delta]F508 on the other allele; the patient had sweat chloride of 103 meq/l, pancreatic sufficient, and mild lung disease. c.1517T>C , p.Ile506Thr (CFTR1) ? , The whole coding and flanking sequence has been screened by DGGE, and no other alteration could be found except known polymorphisms. This second mutation at codon 506 ( the first, 1506S, was described by Deufel) was thoroughly checked by two different sequences from different PCR products. c.1517T>G , p.Ile506Ser (CFTR1) ? , Allele specific amplification and PAA electrophoresis of exon 10 fragments had given discrepant results. By direct sequencing, we found a T to G transversion at nucleotide position 1649, exchanging a isoleucine for a serine (I506S). The second mutation is [delta]F508. The heteroduplex I506S/[delta]F508 can be distinguished from wt/[delta]F508 duplices, allowing for rapid screening of the mutation.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), K: D (95%), L: D (85%), M: D (66%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: N (87%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, K: D, L: N, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Rapid F508del and F508C assay using fluorescent hy... Genet Test. 1999;3(4):365-70. Gundry CN, Bernard PS, Herrmann MG, Reed GH, Wittwer CT
Rapid F508del and F508C assay using fluorescent hybridization probes.
Genet Test. 1999;3(4):365-70., [PMID:10627945]

Abstract [show]
Amplification and fluorescent genotyping of the cystic fibrosis F508del locus was achieved from human genomic DNA in less than 30 min. The hybridization of adjacent fluorescent probes at the mutation site was monitored by resonance energy transfer between fluorescein and Cy5 during heating or cooling. Characteristic curves were obtained for each genotype; the first derivative of these fluorescent curves has a maximum at an apparent hybridization temperature (Tm) that is specific for each probe/allele duplex. The direction and rate of temperature change determines the difference between the apparent Tm and the true equilibrium Tm. One hundred and five sample were genotyped for the F508del cystic fibrosis mutation by heating and cooling curve profiles. These genotypes were validated by allele-specific amplification. Two fluorescein hybridization probes were designed to match the wild-type sequence perfectly from either codons 502 to 513 or from 504 to 511 on the cystic fibrosis transconductance regulator gene of chromosome 7. While genotyping for the F508del, an allele with the F508C base change was detected. For both F508del and F508C variants, the Tm shift from wild type was greater with a 24-mer probe than with a 35-mer probe. Fluorescent monitoring of hybridization probes is a versatile technique that can detect unexpected sequence alterations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 Several sequence variants near codon 508 should be discriminated by this method, including the benign I506V (Kobayashi et al, 1990), and the disease-causing I507del and 1506del (Nelson et al, 1991). Login to comment

[hide] Is isolated idiopathic pancreatitis associated wit... Gut. 2000 Jan;46(1):141. Pallares-Ruiz N, Carles S, des Georges M, Guittard C, Claustres M, Larrey D, Pageaux G
Is isolated idiopathic pancreatitis associated with CFTR mutations?
Gut. 2000 Jan;46(1):141., [PMID:10681187]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Kimberg and coworkers1 2 and Klae- veman and colleagues3 have suggested that prostaglandins increase membrane bound adenylate cyclase activity in the small intestinal mucosa, and thus inhibit Na+ -K+ -ATPase activity of gut mucosa.4 5 Recently, Sundaram and colleagues6 reported that inflamed ileums (excess prostaglandin) express low levels of SGLT1 in rabbits, which indicates that Table 1 Characteristics of 10 patients with idiopathic pancreatitis Patient no Sex Current age Age at diagnosis CFTR genotypes Sequence changes IVS8 TGn-Tn 1540 A/G (M470V) 1 M 77 75 -/- TG11-T7/TG11-T7 G/G 2 F 52 41 3041-71A/G TG11-T7/TG11-T9 A/G 4002A/G 3 M 44 42 4404C/T TG10-T7/TG11-T7 A/G 4 F 70 69 875+40A/G TG11-T5/TG11-T7 A/G 5 M 62 61 125G/C TG11-T7/TG11-T7 G/G 6 F 52 50 1716G/A TG11-T5/TG10-T7 A/A 7 M 41 38 125G/C TG11-T7/TG12-T7 A/G 8 M 64 36 -/- TG10-T7/TG10-T9 A/A 9 M 72 69 I506V TG10-T7/TG11-T7 A/G 875+40A/G 10 F 18 NA -/- TG11-T7/TG12-T7 A/G NA, not available. Login to comment

[hide] A new approach for identifying non-pathogenic muta... Hum Genet. 2000 Feb;106(2):172-8. Bombieri C, Giorgi S, Carles S, de Cid R, Belpinati F, Tandoi C, Pallares-Ruiz N, Lazaro C, Ciminelli BM, Romey MC, Casals T, Pompei F, Gandini G, Claustres M, Estivill X, Pignatti PF, Modiano G
A new approach for identifying non-pathogenic mutations. An analysis of the cystic fibrosis transmembrane regulator gene in normal individuals.
Hum Genet. 2000 Feb;106(2):172-8., [PMID:10746558]

Abstract [show]
Given q as the global frequency of the alleles causing a disease, any allele with a frequency higher than q minus the cumulative frequency of the previously known disease-causing mutations (threshold) cannot be the cause of that disease. This principle was applied to the analysis of cystic fibrosis transmembrane conductance regulator (CFTR) mutations in order to decide whether they are the cause of cystic fibrosis. A total of 191 DNA samples from random individuals from Italy, France, and Spain were investigated by DGGE (denaturing gradient gel electrophoresis) analysis of all the coding and proximal non-coding regions of the gene. The mutations detected by DGGE were identified by sequencing. The sample size was sufficient to select essentially all mutations with a frequency of at least 0.01. A total of 46 mutations was detected, 20 of which were missense mutations. Four new mutations were identified: 1341+28 C/T, 2082 C/T, L1096R, and I11131V. Thirteen mutations (125 G/C, 875+40 A/G, TTGAn, IVS8-6 5T, IVS8-6 9T, 1525-61 A/G, M470V, 2694 T/G, 3061-65 C/A, 4002 A/G, 4521 G/A, IVS8 TG10, IVS8 TG12) were classified as non-CF-causing alleles on the basis of their frequency. The remaining mutations have a cumulative frequency far exceeding q; therefore, most of them cannot be CF-causing mutations. This is the first random survey capable of detecting all the polymorphisms of the coding sequence of a gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Many (13 out of 20) of the missense mutations change highly conserved (5/5 species analyzed) amino acid residues (R75Q, G85E, I148T, I506V, R668C, G622D, L997F, I1027T, F1052V, L1096R, I1131V, R1162L, N1303K); others affect amino acid residues conserved in 4/5 species (K68 E, R170H, M470V, V562L, S1235R), or in 3/5 species (R31C and G576A; Tucker et al. 1992). Login to comment
96 Moreover, 1525-61 A/G (i 9) and 3601-65 C/A (i 18) were detected by SSCA performed in the Spanish sample only (14/82 and 12/80, respectively); these mutations were not identifiable by DGGE as used in the present work The totals are: a378; b362; c380; d356 genes eCertainly a CF-causing mutations fThe most common allele at this site is (TTGA)7 gThe most common allele at this site is T7 hThe frequency shown is that of the M allele Mutation Position North-Central Southern Spain Total East Italy Italy France 82 genes 100 genes 100 genes 100 genes 382 genes % 125 G/C 5`UTR 1 2 7 3 13 3.4 R31C 2 1 1 1 0 3 0.8 K68E 3 1 0 0 0 1 0.3 R75Q 3 1 1 2 0 4 1.0 G85Ee 3 0 1 0 0 1 0.3 406-6 T/C i 3 0 0 1 0 1 0.3 I148T 4 1 0 0 0 1 0.3 621+3 A/G i 4 0 1 0 0 1 0.3 R170H 5 1 0 0 0 1 0.3 875+40 A/G i 6a 11 5 5 2 23 6.0 (TTGA)6 f i 6a 17 11 7 13 48 12.6 1341+28 C/T i 8 1 0 0 0 1 0.3 IVS8-6g T5 i 8 8 2 4 3/78 17a 4.5 IVS8-6g T9 i 8 10 7 10 11/78 38a 10.0 M470Vh 10 42 30 39 27 138 36.1 I506V 10 1 0 0 0 1 0.3 ∆F508e 10 1 0 2 0 3 0.8 1716 G/A 10 2 1 0 5 8 2.1 V562L 12 0 0 1 0 1 0.3 G576A 12 1 0/80 1 0 2b 0.6 G622D 13 0 0/80 1 0 1b 0.3 R668C 13 1 0/80 1 0 2b 0.6 2082 C/T 13 1 0/80 0 0 1b 0.3 2377 C/T 13 0 0/80 0 1 1b 0.3 2694 T/G i 14a 33 23 33 14/80 103c 27.1 2752-15 C/G i 14b 0 3 0 0 3 0.8 3041-71 G/C i 15 0 1 2 0 3 0.8 L997F 17a 0 2 0 0 2 0.5 I1027T 17a 1 0 0 0 1 0.3 F1052V 17b 1 0 0 0 1 0.3 L1096R 17b 0 0 1 0 1 0.3 3417 A/T 17b 1 0 1 0 2 0.5 I1131V 18 0 1 0 0 1 0.3 R1162L 19 0 1 0 0 1 0.3 3690 A/G 19 0 0 0 1/80 1c 0.3 S1235R 19 1 0 0 0 1 0.3 4002 A/G 20 2 3 3 3/80 11c 2.9 4005+28insA i 20 0 1 0 0 0.3 4029 A/G 21 1 0 0 0 1 0.3 N1303Ke 21 1 0 0 0 1 0.3 4404 C/T 24 1 0 1 0 2 0.5 4521 G/A 24 21 16 14/80 15/76 66d 18.5 Total 165 113 137 98 513 encountered in the present survey are possible. Login to comment

[hide] Mutation in the gene responsible for cystic fibros... JAMA. 2000 Oct 11;284(14):1814-9. Wang X, Moylan B, Leopold DA, Kim J, Rubenstein RC, Togias A, Proud D, Zeitlin PL, Cutting GR
Mutation in the gene responsible for cystic fibrosis and predisposition to chronic rhinosinusitis in the general population.
JAMA. 2000 Oct 11;284(14):1814-9., 2000-10-11 [PMID:11025834]

Abstract [show]
CONTEXT: Chronic rhinosinusitis (CRS) is a common condition in the US general population, yet little is known about its underlying molecular cause. Chronic rhinosinusitis is a consistent feature of the autosomal recessive disorder cystic fibrosis (CF). OBJECTIVE: To determine whether mutations in the cystic fibrosis transmembrane regulator (CFTR) gene, which is responsible for CF, predispose to CRS. DESIGN: Case-control study conducted from 1996 to 1999 in which the DNA of CRS patients and controls was typed for 16 mutations that account for 85% of CF alleles in the general population. Chronic rhinosinusitis patients with 1 CF mutation were evaluated for a CF diagnosis by sweat chloride testing, nasal potential difference measurement, and DNA analysis for additional mutations. SETTING: Otolaryngology-head and neck clinic of a US teaching hospital. PARTICIPANTS: One hundred forty-seven consecutive adult white patients who met stringent diagnostic criteria for CRS and 123 CRS-free white control volunteers of similar age range, geographic region, and socioeconomic status. MAIN OUTCOME MEASURES: Presence of CF mutations by DNA analysis among CRS patients vs controls. RESULTS: Eleven CRS patients were found to have a CF mutation (DeltaF508, n = 9; G542X, n = 1; and N1303K, n = 1). Diagnostic testing excluded CF in 10 of these patients and led to CF diagnosis in 1. Excluding this patient from the analyses, the proportion of CRS patients who were found to have a CF mutation (7%) was significantly higher than in the control group (n = 2 [2%]; P =.04, both having DeltaF508 mutations). Furthermore, 9 of the 10 CF carriers had the polymorphism M470V, and M470V homozygotes were overrepresented in the remaining 136 CRS patients (P =.03). CONCLUSION: These data indicate that mutations in the gene responsible for CF may be associated with the development of CRS in the general population. JAMA. 2000;284:1814-1819.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Analysis of CFTR Genes Genomic DNA samples extracted from the blood of participants were screened for 16 mutations (R117H, 621+1G→T, R334W, R347P, A455E, ⌬I507, ⌬F508, 1717-1 G→A, G542X, S549N, G551D, R553X, R560T, 3849+10 Kb C→T, W1282X, and N1303K) that account for 85% of CF alleles in the white population using the multiplex reverse dot hybridization system (Roche Molecular Systems, Alameda, Calif).16,17 This test also identified the 5T, 7T, and 9T variants of the splice acceptor site in intron 8 and F508C, I507V, and I506V (exon 10) polymorphisms of the CFTR gene. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 The 86-mutation assay distinguished ⌬F508 from the F508C, I506V, I506M, and I507V sequence variants. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Clin Exp Allergy. 2002 May;32(5):756-61. Eaton TE, Weiner Miller P, Garrett JE, Cutting GR
Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?
Clin Exp Allergy. 2002 May;32(5):756-61., [PMID:11994102]

Abstract [show]
BACKGROUND: Previous work suggests that cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations may be implicated in the aetiology of allergic bronchopulmonary aspergilosis (ABPA). OBJECTIVE: To compare the frequency of CF gene mutations in asthmatics with ABPA of varying severity with asthmatics who were skin prick test (SPT)-positive to Aspergillus fumigatus (Af) without evidence of ABPA and asthmatics SPT-negative to Af. METHODS: Thirty-one Caucasian patients with ABPA were identified, together with asthmatics SPT positive to Af without evidence of ABPA (n = 23) and SPT negative to Af (n = 28). Genomic DNA was tested for 16 CF mutations accounting for approximately 85% of CF alleles in Caucasian New Zealanders. RESULTS: Four (12.9%) ABPA patients were found to be carriers of a CF mutation (DeltaF508 n = 3, R117H n = 1), one (4.3%) asthmatic SPT positive to Af without ABPA (DeltaF508), and one (3.6%) asthmatic SPT negative to Af (R117H). All patients with a CF mutation had normal sweat chloride (< 40 mM). There was no significant difference between the frequency of CF mutations in the ABPA patients and asthmatics without ABPA. However, the frequency of CF mutations in the ABPA patients was significantly different (P = 0.0125) to the expected carrier rate in the general population. CONCLUSION: These results lend further support to a possible link between CF mutations and ABPA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Patients were also screened for CFTR variants in intron 8 (5T, 7T and 9T) and polymorphisms F508C, I506V and I507V. Login to comment

[hide] Development and evaluation of a PCR-based, line pr... Clin Chem. 2002 Jul;48(7):1121-3. Wang X, Myers A, Saiki RK, Cutting GR
Development and evaluation of a PCR-based, line probe assay for the detection of 58 alleles in the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
Clin Chem. 2002 Jul;48(7):1121-3., [PMID:12089190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Amplicon Size, bp Mutations (polymorphisms) Exon 13 598 2307 insA Intron 8, exon 09 548 A455E, 5T (7/9 T polymorphism) Exon 10 482 G480C, ⌬I507, ⌬F508 (F508C, I507V, I506V polymorphisms) Intron 10, exon 11 433 1717-1G3A, G542X, G551D, R553X, A559T, R560T Exon 19 420 R1162X, 3659delC Exon 21 397 N1303K Exon 20 359 S1255X, W1282X Exon 07 328 1078delT, R334W, R347P Exon 04, intron 4 288 R117H, 621ϩ1G3T Intron 14b 248 2789ϩ5G3A Intron 19 237 3849ϩ10kbC3T Exon 03 210 G85E, 405ϩ3A3C Intron 5 166 711ϩ1G3T Intron 16 139 3120ϩ1G3A Clinical Chemistry 48, No. Login to comment
88 The genotypes of each sample are as follows: lane 1, ϩ/ϩ (ϩ is the wild type); lane 2, 5T, R117H/3659delC; lane 3, G542X/ϩ; lane 4, I506V/ϩ; lane 5, I507V/ϩ; lane 6, F508C/⌬F508; lane 7, G85E/⌬F508; lane 8, 405ϩ3A3C/3120ϩ1G3C; lane 9, R117H/ϩ; lane 10, 621ϩ1G3T/⌬F508; lane 11, 711ϩ1G3T/⌬F508; lane 12, 1078delT/ϩ; lane 13, R334W/⌬F508; lane 14, R347P/⌬F508; lane 15, A455E/ϩ; lane 16, G480C/⌬F508; lane 17, ⌬I507/ϩ; lane 18, ⌬F508/ϩ; lane 19, 1717-1G3A/ϩ; lane 20, G542X/ϩ; lane 21, G551D/⌬F508; lane 22, R553X/ϩ; lane 23, R560T/⌬F508; lane 24, G551D/A559T; lane 25, 2307insA/ϩ; lane 26, 2789ϩ5G3A/⌬F508; lane 27, 3120ϩ1G3A/⌬F508; lane 28, R1162X/R1162X; lane 29, 3659delC/⌬F508; lane 30, 3849ϩ10kbC3T/⌬F508; lane 31, S1255X/⌬F508; lane 32, W1282X/G542X; lane 33, N1303K/ϩ. Login to comment
89 1122 Technical Briefs I506V/⌬F508 genotype showed a similar result. Login to comment
91 However, the other allele did not hybridize with the ⌬F508 probe because it did not contain that mutant sequence, nor did it hybridize with the wild-type probe because the A3G transition (data not shown), which gives rise to the I506V polymorphism, prevents hybridization to that sequence. Login to comment
98 On the other hand, the ⌬F508 mutation is the most common CF allele, and three polymorphisms (I506V, I507V, and F508C) can interfere with hybridization of the wild-type oligonucleotide sequence. Login to comment
99 Thus, the presence of oligonucleotides corresponding to the three polymorphisms in the Research Prototype Cystic Fibrosis Assay-31 test avoids misdiagnosis of ⌬F508/I506V, I507V, or F508C compound heterozygotes. Login to comment

[hide] Survey of CF mutations in the clinical laboratory. BMC Clin Pathol. 2002 Nov 19;2(1):4. Huber K, Mirkovic B, Nersesian R, Myers A, Saiki R, Bauer K
Survey of CF mutations in the clinical laboratory.
BMC Clin Pathol. 2002 Nov 19;2(1):4., 2002-11-19 [PMID:12437773]

Abstract [show]
BACKGROUND: Since it is impossible to sequence the complete CFTR gene routinely, clinical laboratories must rely on test systems that screen for a panel of the most frequent mutations causing disease in a high percentage of patients. Thus, in a cohort of 257 persons that were referred to our laboratory for analysis of CF gene mutations, reverse line probe assays for the most common CF mutations were performed. These techniques were evaluated as routine first-line analyses of the CFTR gene status. METHODS: DNA from whole blood specimens was extracted and subjected to PCR amplification of 9 exons and 6 introns of the CFTR gene. The resulting amplicons were hybridised to probes for CF mutations and polymorphisms, immobilised on membranes supplied by Roche Molecular Systems, Inc. and Innogenetics, Inc. Denaturing gradient gel electrophoresis and sequencing of suspicious fragments indicating mutations were done with CF exon and intron specific primers. RESULTS: Of the 257 persons tested over the last three years (referrals based on 1) clinical symptoms typical for/indicative of CF, 2) indication for in vitro fertilisation, and 3) gene status determination because of anticipated parenthood and partners or relatives affected by CF), the reverse line blots detected heterozygote or homozygote mutations in the CFTR gene in 68 persons (26%). Eighty-three percent of those affected were heterozygous (47 persons) or homozygous (10 persons) for the DeltaF508 allele. The only other CF-alleles that we found with these tests were the G542X allele (3 persons), the G551D allele (3 persons), the 3849+10kb C-T allele (2 persons) the R117H allele (2 persons) and the 621+1G-T allele (1 person).Of the fifteen IVS8-5T-polymorphisms detected in intron 8, seven (47%) were found in males referred to us from IVF clinics. These seven 5T-alleles were all coupled with a heterozygous DeltaF508 allele, they make up 35% of the males with fertility problems (20 men) referred to us. CONCLUSIONS: In summary, the frequency of CF chromosomes in the cohort examined with these tests was 26%, with the DeltaF508 allele affecting 83% of the CF chromosomes. It is a substantial improvement for routine CF diagnostics to have available a test system for 30 mutations plus the polypyrimidine length variants in intron 8. Our results show that this test system allows a routine first-line analyses of the CFTR gene status.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 F508C, I507V, I506V polymorphism exon 11 1717-1G → A, G542X, S549N, G551D, R553X, R560T exon 20 W1282X exon 21 N1303K intron 19 3849+10kb C → T Innogenetics assay: exon 3 394delTT, G85E, E60X exon/intron 4 621+1G-T, R117H exon 7 1078delT, R347P, R334W exon 13 2143delT, 2183AA-G, 2184delA exon 19 R1162X, 3659delC intron 5 711+5G-A intron8/exon 9 A455E,, 5T,7T,9T intron 14b 2789+5G-A intron 19 3849+10kb C-T Table 2: Genotypes of patients with mutations, final results Group 1) (patients with symptoms typical for/indicative of CF) No. Login to comment

[hide] Direct visualization of cystic fibrosis transmembr... Clin Chem. 2004 May;50(5):836-45. Epub 2004 Mar 9. Strom CM, Clark DD, Hantash FM, Rea L, Anderson B, Maul D, Huang D, Traul D, Chen Tubman C, Garcia R, Hess PP, Wang H, Crossley B, Woodruff E, Chen R, Killeen M, Sun W, Beer J, Avens H, Polisky B, Jenison RD
Direct visualization of cystic fibrosis transmembrane regulator mutations in the clinical laboratory setting.
Clin Chem. 2004 May;50(5):836-45. Epub 2004 Mar 9., [PMID:15010427]

Abstract [show]
BACKGROUND: The recommendation for population- based cystic fibrosis (CF) carrier screening by the American College of Medical Genetics for the 25 most prevalent mutations and 6 polymorphisms in the CF transmembrane regulatory gene has greatly increased clinical laboratory test volumes. We describe the development and technical validation of a DNA chip in a 96-well format to allow for high-throughput genotype analysis. METHODS: The CF Portrait chip contains an 8 x 8 array of capture probes and controls to detect all requisite alleles. Single-tube multiplex PCR with 15 biotin-labeled primer pairs was used to amplify sequences containing all single-nucleotide polymorphisms to be interrogated. Detection of a thin-film signal created by hybridization of multiplex PCR-amplified DNA to complementary capture probes was performed with an automated image analysis instrument, NucleoSight. Allele classification, data formatting, and uploading to a laboratory information system were fully automated. RESULTS: The described platform correctly classified all mutations and polymorphisms and can screen approximately 1300 patient samples in a 10-h shift. Final validation was performed by two separate 1000-sample comparisons with Roche CF Gold line probe strips and the Applera CF OLA, Ver 3.0. The CF Portrait Biochip made no errors during this validation, whereas the Applera assay made seven miscalls of the IVS-8 5T/7T/9T polymorphism CONCLUSIONS: The CF Portrait platform is an automated, high-throughput, DNA chip-based assay capable of accurately classifying all CF mutations in the recommended screening panel, including the IVS-8 5T/7T/9T polymorphism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
178 The optimal spotting conditions for each probe are indicated by the boxes around spots in C. wild-type controls and heterozygotes for each ACMG mutation and polymorphism, DNA from 12 compound heterozygotes (⌬F508/1898 ϩ 1GϾA, 711 ϩ 1GϾT/⌬F508, G85E/621 ϩ 1GϾT, 3659delC/⌬F508, 3120 ϩ 1GϾA/ 621 ϩ 1GϾT, R347P/G551D, A455E/⌬F508, R560T/ dF508, R553X/⌬F508, 621 ϩ 1GϾT/⌬F508, 621 ϩ 1GϾT/ 711 ϩ 1GϾT, R117H/⌬F508, and I506V/⌬F508) and DNA from 4 homozygous patients (⌬F508 and 2789 ϩ 5GϾA, 3849 ϩ 10kbCϾT, and G542X) was used in validation experiments. Login to comment
181 Expected visual spot patterns, as is shown in Fig. 3C, were observed with the exception of a compound heterozygote (I506V/⌬F508) and a homozygous mutation ⌬F508/⌬F508 in exon 10. Login to comment
184 For example, wild-type probes for I506V and I507V share common sequences with the ⌬F508 probe, and ⌬I507 and F508C have identical wild-type sequence (see Table 2 in the online Data Supplement); this is not surprising because they detect mutations on three contiguous codons. Login to comment
185 As a consequence, when the ⌬F508/⌬F508 homozygous mutant sample was tested the F508C, ⌬I507, I506V, and I507V wild-type probes all lost activity, and in the case of the I506V/⌬F508 compound heterozygote, the I507V wild-type probe lost activity. Login to comment

[hide] Detection of five common CFTR mutations by rapid-c... Clin Chem. 2004 Apr;50(4):773-5. Dempsey E, Barton DE, Ryan F
Detection of five common CFTR mutations by rapid-cycle real-time amplification refractory mutation system PCR.
Clin Chem. 2004 Apr;50(4):773-5., [PMID:15044340]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 The F508del ARMS primers (CF-DFjN and CF-DFwM) are specific for this mutation and are not influenced by the benign I506V and F508C mutations. Login to comment

[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]

Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 DNA Amplification and colorimetric detection on linear array strips with Analyte Specific Reagents for a 16-mutation assay (gift from Roche Molecular Systems, Alameda, CA) and a 27-mutation assay (Linear Array CF-31; Roche Molecular Biochemicals, Indianapolis, IN) were used.20 For both panels, the DNA assay assessed only CFTR mutations; detection of polymorphisms was incorporated as a reflex test for confirmation of putative ⌬F508 homozygotes (assay for F508C, I506V, and I507V) or for genotype elucidation on detection of 2 mutations including R117H (assay for IVS8polyT 5/7/9T). Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] Cystic fibrosis carrier screening: validation of a... Genet Med. 2004 Sep-Oct;6(5):431-8. Edelmann L, Hashmi G, Song Y, Han Y, Kornreich R, Desnick RJ
Cystic fibrosis carrier screening: validation of a novel method using BeadChip technology.
Genet Med. 2004 Sep-Oct;6(5):431-8., [PMID:15371909]

Abstract [show]
PURPOSE: To validate a novel BeadChip assay system for cystic fibrosis (CF) mutation testing using the panel of 25 ACMG recommended mutations and D1152H. METHODS: DNA from 519 individuals originally tested for CF mutation status by allele specific oligonucleotide hybridization (ASOH) were blindly analyzed by the BeadChip assay and the results were compared. The elongation mediated multiplexed analysis of polymorphisms (eMAP) protocol, which combines multiplex amplification of genomic DNA and multiplex detection of mutations on color-coded bead arrays, was used to analyze 26 CF mutations in two separate groups. RESULTS: The system accurately distinguished the 26 CF genotypes and had 100% concordance with the ASOH technique with an assay failure rate of 1.7%. Benign variants of exon 10 codons 506, 507, and 508 did not interfere with mutation identification and reflex testing for the 5/7/9T IVS8 polymorphism was performed on a separate array. CONCLUSIONS: The BeadChip assay system provided accurate and rapid identification of the ACMG recommended CF mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Key Words: cystic fibrosis, carrier screening, BeadChip technology Cystic fibrosis (CF) results from mutations in the CF transmembrane conductance regulator (CFTR) and is a common autosomal recessive disorder, particularly in individuals of Caucasian and Ashkenazi Jewish (AJ) ancestry.1,2 CF also affects individuals from other ethnic groups, including Hispanics, African Americans, and Asians with carrier frequencies ranging from 1in46to1in90.1 Morethan1000mutationshavebeendescribed in the CFTR gene and although many of them are private mutations, there are a number of mutations that are distributed worldwide and still others that are common to specific ethnic groups.3 In2001,theAmericanCollegesofMedicalGenetics(ACMG)and Obstetrics and Gynecologists (ACOG) established guidelines for prenatal carrier testing for CF that included a panel of 25 panethnic mutations with allele frequencies Ն 0.1% among CF patients inNorthAmerica.1,4 Inaddition,theyrecommendedthatcarriers of R117H be subsequently tested for the 5/7/9T polymorphic alleles in intron 8 and that individuals positive for delF508 and delI507 have reflex testing for interference from the benign variants F508C, I506V, and I507V.1 The ACMG/ACOG recommendations precipitated a dramatic increase in the number of CF tests performed in genetic testing laboratories. Login to comment
105 Genomic DNA from an F508C and an I506V carrier were amplified with the Group I multiplex primer mix and analyzed using the BeadChip assay system. Login to comment
108 In addition, the PCR products amplified from the genomic DNA of F508C and I506V carriers and the single-stranded oligonucleotides for the I507V and I506M only elongated from the normal probe indicating that these variants did not interfere with allele discrimination. Login to comment

[hide] A large-scale study of the random variability of a... Eur J Hum Genet. 2005 Feb;13(2):184-92. Modiano G, Bombieri C, Ciminelli BM, Belpinati F, Giorgi S, Georges M, Scotet V, Pompei F, Ciccacci C, Guittard C, Audrezet MP, Begnini A, Toepfer M, Macek M, Ferec C, Claustres M, Pignatti PF
A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.
Eur J Hum Genet. 2005 Feb;13(2):184-92., [PMID:15536480]

Abstract [show]
Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb Â 104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q Â 104 se Â 104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes. Login to comment

[hide] Lack of association of common cystic fibrosis tran... Am J Gastroenterol. 2005 Apr;100(4):874-8. Gallegos-Orozco JF, E Yurk C, Wang N, Rakela J, Charlton MR, Cutting GR, Balan V
Lack of association of common cystic fibrosis transmembrane conductance regulator gene mutations with primary sclerosing cholangitis.
Am J Gastroenterol. 2005 Apr;100(4):874-8., [PMID:15784035]

Abstract [show]
BACKGROUND: Primary sclerosing cholangitis (PSC) is a chronic progressive cholestatic liver disease of uncertain etiology. However, the histologic features of PSC liver disease can resemble those in cystic fibrosis (CF), an inherited disorder caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. We sought to determine if PSC patients have a higher frequency of common CF alleles than disease controls. METHODS: DNA was extracted from peripheral lymphocytes of patients with end-stage liver disease. Samples were obtained before liver transplantation from 59 PSC patients and from three groups of control patients (20 each with primary biliary cirrhosis, autoimmune hepatitis, or hepatitis C). DNA samples were genotyped for 32 common CF mutations, the intron 8 T tract variants, and the M470V variant. RESULTS: One of 59 PSC patients (1.7%) had the common CF mutation (DeltaF508) in one CFTR gene. Two controls (3.3%) carried a single CF mutation (DeltaF508 in one primary biliary cirrhosis patient; W1282X in one hepatitis C patient). These rates do not differ from expected in the general population. The frequency of CFTR variants (5T and M470V) was also similar between PSC patients and controls. CONCLUSIONS: Despite anatomical similarities between CF liver disease and PSC, we could not confirm that PSC patients carried common CF mutations or common CFTR variants in higher than expected frequencies. These data suggest that CFTR dysfunction does not influence the pathogenesis of PSC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 CFTR Mutations and Associated Phenotype Classic Nonclassic Cystic Fibrosis Cystic Fibrosis Variant Normal 621 + 1G→T R117H G85E* 7T 711 + 1G→T R334W 5T† 9T 1078delT R347P M470V‡ F508C I507 A455E I507V F508 2789 + 5G → A I506V 1717 - 1G→A 3849 + 10kbC→T G542X G551D R553X R560T R1162X 3659delC W1282X N1303K * Classic cystic fibrosis and nonclassic cystic fibrosis. Login to comment

[hide] Time-motion analysis of 6 cystic fibrosis mutation... Clin Chem. 2005 Jul;51(7):1116-22. Epub 2005 Apr 28. Krafft AE, Lichy JH
Time-motion analysis of 6 cystic fibrosis mutation detection systems.
Clin Chem. 2005 Jul;51(7):1116-22. Epub 2005 Apr 28., [PMID:15860566]

Abstract [show]
BACKGROUND: A dramatic increase in requests for routine cystic fibrosis (CF) carrier screening prompted us to conduct a time-motion analysis comparing commercially available CF testing platforms. Questions addressed in the study included: (a) How much time is required to perform each step involved in carrying out the assay procedure? (b) Which system requires the minimum number of manual manipulations to complete a typical run? (c) What workflow benefits can be achieved by automation? METHODS: We used a 96-sample run for comparisons and analyzed each of the 6 methods to determine the number of pipetting steps and manual manipulations, the labor and instrument time, and the total time required to perform the assay. The survey participants included a staff of 4 technologists who perform complex molecular assays regularly. Time required for each procedure was determined by direct observation and from work logs completed by the technologists. RESULTS: The total number of pipetting motions varied from 78 to 344. Labor time ranged from 2.6 to 8.4 h, and total assay time from 7.6 to 13.7 h. CONCLUSION: Time-motion analysis allowed identification of a method that minimized pipetting motions and thus reduced the risk of repetitive stress injury.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 CFTR mutation detection system OLA, Ver. 3 INNO-LiPA CF Gold 1.0 Tag-It CF 40 ؉ 4 CF eMAP/ Bead Chip Invader Source Abbott (ABI/ Celera) Innogenetics Roche TM Biosciences BioArray Solutions Third Wave Assay type OLA Reverse slot-blot ASOa Reverse slot-blot ASO ASPE ASPE Invader technology Enzymatic reactions (n) Multiplex PCR (1); OLA (1) Multiplex PCR (2); SA-HRP (1) Multiplex PCR (1); SA-HRP (1) Multiplex PCR (1); Exo-SAP (1); ASPE (1) Multiplex PCR (1); Exo-SAP (2); ASPE (1) Cleavase (6) Special equipment ABI 3100 capillary electrophoresis Auto-LiPA I Gemini Twin shaking water bath Luminex 100 Array imaging system Tecan GENios plate reader Additional Mutations 7 11 6 16 12 Polymorphisms 5/7/9T 5/7/9T 5/7/9T Reflex tests required 5/7/9T Yes Nob Nob Nob Yes Yes I506V/I507V Yes Noc No No No Yes Automated allele calling Yes No No Yes Yes No a ASO, allele-specific oligonucleotides; SA-HRP, streptavidin-conjugated horseradish peroxidase; Exo-SAP, exonuclease plus shrimp alkaline phosphatase digestion. Login to comment

[hide] Negative genetic neonatal screening for cystic fib... Clin Genet. 2007 Oct;72(4):374-7. Girardet A, Guittard C, Altieri JP, Templin C, Stremler N, Beroud C, des Georges M, Claustres M
Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements.
Clin Genet. 2007 Oct;72(4):374-7., [PMID:17850636]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 CFTR mutations identified through the neonatal screening of 84 newborns Mutations Frequency (%) p.Phe508del* 59.52 p.Arg117His* 5.35 p.Gly542X* 2.98 [3849110 kbC.T]* 2.39 p.Arg334Trp* 1.19 p.Arg1162X* 1.19 [2183AA.G]* 1.19 [1717-1G.A]* 1.19 p.Arg1066Cys 1.19 p.Glu1104X 1.19 Total 77.38 Mutations found only once 22.62 Mutations found in a single cystic fibrosis allele: p.Arg75X*, p.Tyr122X*, 71111G.T*, 1078delT*, p.Ile507del*, p.Gly551Asp*, p.Ser1251Asn*, p.Trp1282X*, p.Asn1303Lys*, 62113A.G, p.Leu206Trp, p.Gln220X, p.Gln237Glu, 100115G.A, (TG)12T5, p.Ile506Val, p.Ile506Thr, 1717- 3T.C, p.Leu558Ser, 1802delC, p.Lys710X, p.Leu732X, 2380del8, p.Cys832X, 262211G.A, p.Arg851X, 2634delT, 3007delG, p.Leu997Phe, 3041-15T.G, 3121-1G.A, p.Arg1102X, p.Gly1127Glu, 3750delAG, 3850-1G.A, 400511G.A, and two large rearrangements c.54-5811_c. Login to comment

[hide] Snapback primer genotyping with saturating DNA dye... Clin Chem. 2008 Oct;54(10):1648-56. Epub 2008 Aug 1. Zhou L, Errigo RJ, Lu H, Poritz MA, Seipp MT, Wittwer CT
Snapback primer genotyping with saturating DNA dye and melting analysis.
Clin Chem. 2008 Oct;54(10):1648-56. Epub 2008 Aug 1., [PMID:18676584]

Abstract [show]
BACKGROUND: DNA hairpins have been used in molecular analysis of PCR products as self-probing amplicons. Either physical separation or fluorescent oligonucleotides with covalent modifications were previously necessary. METHODS: We performed asymmetric PCR for 40-45 cycles in the presence of the saturating DNA dye, LCGreen Plus, with 1 primer including a 5' tail complementary to its extension product, but without any special covalent modifications. Samples were amplified either on a carousel LightCycler for speed or on a 96/384 block cycler for throughput. In addition to full-length amplicon duplexes, single-stranded hairpins were formed by the primer tail "snapping back" and hybridizing to its extension product. High-resolution melting was performed on a HR-1 (for capillaries) or a LightScanner (for plates). RESULTS: PCR products amplified with a snapback primer showed both hairpin melting at lower temperature and full-length amplicon melting at higher temperature. The hairpin melting temperature was linearly related to the stem length (6-28 bp) and inversely related to the log of the loop size (17-135 bases). We easily genotyped heterozygous and homozygous variants within the stem, and 100 blinded clinical samples previously typed for F5 1691G>A (Leiden) were completely concordant by snapback genotyping. We distinguished 7 genotypes in 2 regions of CFTR exon 10 with symmetric PCR using 2 snapback primers followed by product dilution to favor intramolecular hybridization. CONCLUSIONS: Snapback primer genotyping with saturating dyes provides the specificity of a probe with only 2 primers that are free of special covalent labels in a closed-tube system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 All heterozygotes resolve into 2 melting peaks except for the I506V heterozygote; however, even the I506V heterozygote is clearly distinguished from other genotypes by the shape of its melting curve after high-resolution melting analysis. Login to comment
193 Snapback 1 covered the F508del, I507del, F508C, and I506V variants with melting transitions between 46 and 60 °C. Login to comment
196 Samples included wild type (circles), compound F508del/Q493X heterozygote (connected small diamonds), I506V heterozygote (small diamonds), F508C heterozygote (small squares), I507del heterozygote (large squares), F508del heterozygote (connected large diamonds), and F508del homozygote (connected squares). Login to comment

[hide] Best practice guidelines for molecular genetic dia... Eur J Hum Genet. 2009 Jan;17(1):51-65. Epub 2008 Aug 6. Dequeker E, Stuhrmann M, Morris MA, Casals T, Castellani C, Claustres M, Cuppens H, des Georges M, Ferec C, Macek M, Pignatti PF, Scheffer H, Schwartz M, Witt M, Schwarz M, Girodon E
Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders--updated European recommendations.
Eur J Hum Genet. 2009 Jan;17(1):51-65. Epub 2008 Aug 6., [PMID:18685558]

Abstract [show]
The increasing number of laboratories offering molecular genetic analysis of the CFTR gene and the growing use of commercial kits strengthen the need for an update of previous best practice guidelines (published in 2000). The importance of organizing regional or national laboratory networks, to provide both primary and comprehensive CFTR mutation screening, is stressed. Current guidelines focus on strategies for dealing with increasingly complex situations of CFTR testing. Diagnostic flow charts now include testing in CFTR-related disorders and in fetal bowel anomalies. Emphasis is also placed on the need to consider ethnic or geographic origins of patients and individuals, on basic principles of risk calculation and on the importance of providing accurate laboratory reports. Finally, classification of CFTR mutations is reviewed, with regard to their relevance to pathogenicity and to genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
144 A (T)5 variant can either be associated with (TG)11, (TG)12, (TG)13, and rarely (TG)15 repeats.74 When (T)5 is found in diagnostic testing, for example, for CBAVD or atypical presentation, determination of Table 4 Classification of CFTR mutations with regard to their potential for causing disease Mutation group Examples CF-causing F508del Mainly nonsense, frameshift, splicing (invariant dinucleotide): G542X, R553X, W1282X, 2183AA4G, 3659delC, 1717-1G4A, 3120+1G4A Missense that severely affects CFTR synthesis or function: G551D, N1303K, R347P 2789+5G4A, 3849+10kbC4T, 3272-26A4G, L206Wa , D1152Ha , (TG)13(T)5a CFTR-related disorders associated L206Wa , D1152Ha , (TG)13(T)5a [R117H;(T)7], (TG)12(T)5, L997F, V562I, [R668C;G576A;D443Y], [R74W;D1270N] (TG)11(T)5b , S1235Rb No clinical consequences 875+40A4G, M470V (1540A4G), I506V (1648A4G), F508C (1655T4G), 1716G4A, 2694T4G, 4002A4G, 2752-15G4C (TG)11(T)5b , S1235Rb Unproven or uncertain clinical relevance Mainly missense mutations G622D, R170H, V938G, I125T Putative splice mutations: 406-6T4C, 2752-26A4G, 3601-17T4C Only a fraction of mutations and patients have been characterized in detail and, with the exception of frequent mutations, only small numbers of patients have been available for the study of most mutations. Login to comment

[hide] A novel approach to CFTR mutation testing by pyros... Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16. Bickmann JK, Kamin W, Wiebel M, Hauser F, Wenzel JJ, Neukirch C, Stuhrmann M, Lackner KJ, Rossmann H
A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities.
Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16., [PMID:19372188]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a common autosomal recessive genetic disorder caused by a variety of sequence alterations in the CFTR gene [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)]. Because the relative prevalence of mutations strongly depends on the ethnic background, first-level testing of CF as defined by recent consensus recommendations ought to be adaptable to the ethnicity of patients. METHODS: We therefore developed and implemented a diagnostic approach to first-level testing for CF based on published mutation frequencies and Pyrosequencing (PSQ) technology that we complemented with standard procedures of mutation detection at the second level. RESULTS: The current test system of PSQ assays for 46 target CF mutations [including CFTRdele2,3 (21 kb) and 1342-6 (T)(n) (5T/7T/9T)] permits recombinations of single assays to optimize sensitivities for certain ethnicities. By easy expansion of the original mutation panel, the first-level test sensitivities with other ethnic groups would be increased, provided that the mutation frequencies are known. The test was validated with our local, ethnically mixed, but mainly German population (155 patients). The mutation-detection rate for the 92 patients whose CF was confirmed by the sweat test was 89.0% for the patients of German descent (73 of the 92 patients) and 73.7% for the patients of any other origin (19 of the 92 patients). Ethnicity-adapted testing panels for our foreign CF patients would increase the sensitivities for the respective groups by approximately 5%. CONCLUSIONS: PSQ-based genotyping is a reliable, convenient, highly flexible, and inexpensive alternative to conventional methods for first-level testing of CFTR, facilitating flexible adaptation of the analyzed mutation panel to any local ethnic group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 The clinically irrelevant variants I506V, I507V,andF508C,whicharelocatedincloseproximityto these mutations, change the expected pyrograms dramatically (involving all peaks 3Ј of the base exchange), thereby virtually eliminating any chance of misdiagnosis. Login to comment
129 Furthermore, the PSQ-based first-level test avoids common pitfalls, as do the most recent assays: It correctly discriminates G551D and R553X, as well as I507del and F508del (Fig. 3; see Fig. 1 in the online Data Supplement), thus obviating reflex testing for benign sequence variations such as I506V, I507V, and F508C. Login to comment
148 Fig. 2 in the online Data Supplement illustrates the capability of the assay to discriminate I507del, F508del, 1677delTA, and the interfering benign variants I506V, I507V, and F508C. Login to comment

[hide] Impact of gene patents and licensing practices on ... Genet Med. 2010 Apr;12(4 Suppl):S194-211. Chandrasekharan S, Heaney C, James T, Conover C, Cook-Deegan R
Impact of gene patents and licensing practices on access to genetic testing for cystic fibrosis.
Genet Med. 2010 Apr;12(4 Suppl):S194-211., [PMID:20393308]

Abstract [show]
Cystic fibrosis is one of the most commonly tested autosomal recessive disorders in the United States. Clinical cystic fibrosis is associated with mutations in the CFTR gene, of which the most common mutation among Caucasians, DeltaF508, was identified in 1989. The University of Michigan, Johns Hopkins University, and the Hospital for Sick Children, where much of the initial research occurred, hold key patents on cystic fibrosis genetic sequences, mutations, and methods for detecting them. Several patents, including the one that covers detection of the DeltaF508 mutation, are jointly held by the University of Michigan and the Hospital for Sick Children in Toronto, with Michigan administering patent licensing in the United States. The University of Michigan broadly licenses the DeltaF508 patent for genetic testing with >60 providers of genetic testing to date. Genetic testing is now used in newborn screening, diagnosis, and for carrier screening. Interviews with key researchers and intellectual property managers, a survey of laboratories' prices for cystic fibrosis genetic testing, a review of literature on cystic fibrosis tests' cost-effectiveness, and a review of the developing market for cystic fibrosis testing provide no evidence that patents have significantly hindered access to genetic tests for cystic fibrosis or prevented financially cost-effective screening. Current licensing practices for cystic fibrosis genetic testing seem to facilitate both academic research and commercial testing. More than 1000 different CFTR mutations have been identified, and research continues to determine their clinical significance. Patents have been nonexclusively licensed for diagnostic use and have been variably licensed for gene transfer and other therapeutic applications. The Cystic Fibrosis Foundation has been engaged in licensing decisions, making cystic fibrosis a model of collaborative and cooperative patenting and licensing practice.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
184 I506V, I507V, and F508C are performed only as reflex tests for unexpected homozygosity for ⌬F508 and/or ⌬I507. Login to comment

[hide] An update on cystic fibrosis screening. Clin Lab Med. 2010 Sep;30(3):533-43. Goetzinger KR, Cahill AG
An update on cystic fibrosis screening.
Clin Lab Med. 2010 Sep;30(3):533-43., [PMID:20638569]

Abstract [show]
Cystic fibrosis (CF) is a monogenic, autosomal recessive disorder, which ultimately leads to multisystem organ dysfunction and a subsequent decrease in life expectancy. Because of the sizeable number of disease causing mutations (>1000) and expansive ethnic and racial distribution, CF has presented a challenge for prenatal diagnosis. This article aims to review the genetics of CF, its spectrum of genotypic-phenotypic variations, current prenatal carrier screening and diagnostic recommendations, ultrasonographic markers of CF, and available reproductive options for carrier couples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Given that 5% of the general population will test positive for the 5T polymorphism alone, this test is recommended only as a reflex to a positive R117H result.22,23 Non CF-causing variants, including I506V, I507V, and F508C, can mistakenly cause a false-positive result based on laboratory and testing methodologies. Login to comment
54 For example, in patients who screen positive for DF508 carrier status and for one of the aforementioned mutations, a false-positive test for DF508 homozygosity may be obtained, although the patient is an otherwise healthy individual.22 Although F508C has been associated with CBAVD, neither I506V nor I507V have been associated with any phenotypic manifestations of classical CF or CBAVD.24 Therefore, reflex testing for I506V, I507V, and F508C should be performed in any healthy individual who tests positive for DF508 or DI507 homozygosity, but these mutations should not be otherwise used for a priori testing. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 The mutation analysis discriminated between p.F508del and the benign polymorphisms p.F508C, p.I506V, and p.I507V. Login to comment

[hide] Complete mutational screening of the CFTR gene in ... Hum Genet. 1998 Dec;103(6):718-22. Bombieri C, Benetazzo M, Saccomani A, Belpinati F, Gile LS, Luisetti M, Pignatti PF
Complete mutational screening of the CFTR gene in 120 patients with pulmonary disease.
Hum Genet. 1998 Dec;103(6):718-22., [PMID:9921909]

Abstract [show]
In order to determine the possible role of the cystic fibrosis transmembrane regulator (CFTR) gene in pulmonary diseases not due to cystic fibrosis, a complete screening of the CFTR gene was performed in 120 Italian patients with disseminated bronchiectasis of unknown cause (DBE), chronic bronchitis (CB), pulmonary emphysema (E), lung cancer (LC), sarcoidosis (S) and other forms of pulmonary disease. The 27 exons of the CFTR gene and their intronic flanking regions were analyzed by denaturing gradient gel electrophoresis and automatic sequencing. Mutations were detected in 11/23 DBE (P = 0.009), 7/25 E, 5/27 CB, 5/26 LC, 5/8 S (P = 0.013), 1/4 tuberculosis, and 1/5 pneumonia patients, and in 5/33 controls. Moreover, the IVS8-5T allele was detected in 6/25 E patients (P = 0.038). Four new mutations were identified: D651N, 2377C/T, E826K, and P1072L. These results confirm the involvement of the CFTR gene in disseminated bronchiectasis of unknown origin, and suggest a possible role for CFTR gene mutations in sarcoidosis, and for the 5T allele in pulmonary emphysema.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 Five mutations (G576A, R668C, R74W, R31C, and I506V) are not thought to be the cause of CF (CFGAC website): three of them (G576A, R668C, and R74W) have been found in CBAVD patients (Anguiano et al. 1992; Chillon et al. 1995; Mercier et al. 1995; Verlingue et al. 1996), R31C was described in a DBE patient (Girodon et al. 1997), and I506V was found in the normal allele in the father of a CF child (Ghanem et al. 1994). Login to comment
88 of cases CFTR gene PolyTb status tested mutationa DBE 23 1 G576A-R668C/L997F 7/9 1 ∆F508/L997F 9/9 1 ∆F508/- 7/9 1 R1066C/- 5/7 1 3667ins4/- 5/7 1 R75Q/- 7/7 1 M1137V/- 7/7 1 -/- 5/5 3 -/- 5/7 10 -/- 7/7 2 -/- 7/9 CB 27 1 P111L/- 7/7 1 R117H/- 7/7 1 E585X/- 7/7 1 P1072L/- 7/7 1 -/- 5/7 15 -/- 7/7 6 -/- 7/9 1 -/- 9/9 E 25 1 R668C/- 7/7 6 -/- 5/7 16 -/- 7/7 6 -/- 7/9 S 8 1 E826K/- 7/7 1 ∆F508/- 7/9 1 4382delA/- 7/7 1 L997F/- 7/9 1 V754M/- 7/9 3 -/- 7/7 LC 26 1 I148T/- 5/7 1 D1270N-R74W 5/7 1 D651N/- 7/7 1 Y301C/- 7/7 1 -/- 5/7 16 -/- 7/7 5 -/- 7/9 TB 4 1 -/- 5/7 1 -/- 7/7 2 -/- 7/9 Pneumonia 5 4 -/- 7/7 1 -/- 5/7 Pnx 2 2 -/- 7/7 Controls 68 1 L997F/- 7/9 1 R31C/- 7/7 1 I506V/- 5/7 1 -/- 5/7 1 -/- 5/9 23 -/- 7/7 4 -/- 7/9 1 -/- 9/9 2 ? Login to comment
120 Three missense mutations were detected in 33 controls: L997F, which is present in two DBE and in one sarcoidosis patients; R31C, which was first described in an apparently unaffected 6-year-old child (Ghanem et al. 1994) and next in a DBE patient (Girodon et al. 1997); I506V, which was described in a healthy parent of a CF patient who bore ∆F508 on the other chromosome (Kobayashi et al. 1990). Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Fourteen novel amino acid changing variants were identified in a total of 183 CFTR sequence changes (excluding the common M470V and I506V polymorphism and 5T/7T/9T variants in intron 8). Login to comment

[hide] Complete gene scanning by temperature gradient cap... J Mol Diagn. 2005 Feb;7(1):111-20. Chou LS, Gedge F, Lyon E
Complete gene scanning by temperature gradient capillary electrophoresis using the cystic fibrosis transmembrane conductance regulator gene as a model.
J Mol Diagn. 2005 Feb;7(1):111-20., [PMID:15681482]

Abstract [show]
Many inherited diseases involve large genes with many different mutations. Identifying a wide spectrum of mutations requires an efficient gene-scanning method. By differentiating thermodynamic stability and mobility of heteroduplexes from heterozygous samples, temperature gradient capillary electrophoresis (TGCE) was used to scan the entire coding region of the cystic fibrosis transmembrane conductance regulator gene. An initial panel (29 different mutations) showed 100% agreement between TGCE scanning and previously genotyped results for heterozygous samples. Different peak patterns were observed for single base substitutions and base insertions/deletions. Subsequently, 12 deidentified clinical samples genotyped as wild type for 32 mutations were scanned for the entire 27 exons. Results were 100% concordance with the bidirectional sequence analysis. Ten samples had nucleotide variations including a reported base insertion in intron 14b (2789 + 2insA) resulting in a possible mRNA splicing defect, and an unreported missense mutation in exon 20 (3991 G/A) with unknown clinical significance. This methodology does not require labeled primers or probes for detection and separation through a temperature gradient eliminates laborious temperature optimization required for other technologies. TGCE automation and high-throughput capability can be implemented in a clinical environment for mutation scanning with high sensitivity, thus reducing sequencing cost and effort.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Mutation Samples with Known Genotypes Scanned by TGCE* Exon Mutation† Amplicon size (bp) Location of mutation from 5Ј end (bp) Base change Detection‡ 3 G85E 234 124 G to A 1/1 3 394delTT 234 132 del TT 1/1 4 R117H 270 83 G to T 2/2 4 I148T 270 176 T to C 3/3 Intron 4 621 ϩ 1 G/T 270 233 G to T 1/1 5 663delT/663delT 186 75 del T 0/1 Intron 5 711 ϩ 1 G/T 186 124 G to T 1/1 7 R334W 345 208 C to T 1/1 7 R347P 345 248 G to C 1/1 9 A455E 263 155 C to A 2/2 10 I506V 292 168 A to G 1/1 10 ⌬I507 292 171 del ATC 2/2 10 ⌬F508 292 174 del TTT 2/2 10 ⌬F508/⌬F508 292 174 del TTT 0/1 10 F508C 292 175 T to G 1/1 10 V520F 292 210 G to T 1/1 Intron 10 1717-1 G/A 175 50 G to A 1/1 11 G542X 175 90 G to T 2/2 11 G542X/G542X 175 90 G to T 0/1 11 G551D 175 118 G to A 3/3 11 R553X 175 123 C to T 3/3 11 R560T 175 145 G to C 2/2 13 2184delA 834 356 del A 1/1 Intron 14b 2789 ϩ 5G/A 192 102 G to A 1/1 Intron 16 3120 ϩ 1G/A 216 111 G to A 1/1 19 R1162X 322 68 C to T 1/1 19 3659delC 322 111 del C 1/1 20 W1282X 206 154 G to A 1/1 21 N1303K 250 175 C to G 2/2 Total exon/intron Overall accuracy 17 93% *Samples were compared with their respective wild-type control (confirmed by sequencing). Login to comment

[hide] Rapid screening for 31 mutations and polymorphisms... Methods Mol Med. 2005;114:147-71. Dunbar SA, Jacobson JW
Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array.
Methods Mol Med. 2005;114:147-71., [PMID:16156102]

Abstract [show]
A suspension array hybridization assay is described for the detection of 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator (CFTR) gene using Luminex xMAP technology. The Luminex xMAP system allows simultaneous detection of up to 100 different targets in a single multiplexed reaction. Included in the method are the procedures for design of oligonucleotide capture probes and PCR amplification primers, coupling oligonucleotide capture probes to carboxylated microspheres, hybridization of coupled microspheres to oligonucleotide targets, production of targets from DNA samples by multiplexed PCR amplification, and detection of PCR-amplified targets by direct hybridization to probe-coupled microspheres. Mutation screening with the system is rapid, requires relatively few sample manipulations, and provides adequate resolution to reliably genotype the 25 CFTR mutations and 6 CFTR polymorphisms contained in the ACMG/ACOG/NIH-recommended core mutation panel for general population CF carrier screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
104 Nucleotides were added to the 5' and 3' ends of the probe sequences to improve hybridization efficiency of the probe to its perfect-match target, thus 152 Dunbar and Jacobson Table 2 (Continued) Target Microsphere Probe sequence Modificationb Sequence 5' → 3' set 46B 1898+1G→A 5'-AmMC12 TATTTGAAAGATATGTTCTTTG 027 47B 3120+1G 5'-AmMC12 CTTCATCCAGGTATGTAAAAAT 043 48B 3120+1G→A 5'-AmMC12 CTTCATCCAGATATGTAAAAAT 055 Reflex panel R2B I506V 5'-AmMC12 CACCAAAGATGACATTTTC 009 R3B I507V 5'-AmMC12 CACCAAAGACGATATTTTC 021 R4B F508C 5'-AmMC12 AACACCACAGATGATATTT 024 R5B 5T 5'-AmMC12 TGTGTGTTTTTAACAGGG 029 R6B 7T 5'-AmMC12 GTGTGTTTTTTTAACAGG 033 R7C 9T 5'-AmMC12 GTGTGTTTTTTTTTAACAG 037 a The position and sequence of the mutation or variation is indicated in bold type. b 5'-Amino modifier C12. Login to comment
106 Table 3 Reverse Complementary Oligonucleotide Targetsa Target Target sequence Modification Sequence 5' → 3' Standard mutation panel C1b I507 & F508 5'-Biotin AAAATATCATCTTTGGTGTT C2 ΔI507 5'-Biotin AAAGAAAATATCTTTGGTGT C3 ΔF508 5'-Biotin AGAAAATATCATTGGTGTTT C4 W1282 5'-Biotin GGCTTTCCTCCACTGTTGC C5 W1282X 5'-Biotin GGCTTTCCTTCACTGTTGC C6 1717-1G 5'-Biotin TGGAGATGTCCTATTACCAA C7 1717-1G→A 5'-Biotin TGGAGATGTCTTATTACCAA C8 G542 5'-Biotin CCACCTTCTCCAAGAACTAT C9 G542X 5'-Biotin CCACCTTCTCAAAGAACTAT C10 G551 & R553 5'-Biotin CTTGCTCGTTGACCTCCACT C11 G551D 5'-Biotin CTTGCTCGTTGATCTCCACT C12 R553X 5'-Biotin CTTGCTCATTGACCTCCACT C13 R560 5'-Biotin AGTTATTCACCTTGATAAAG C14 R560T 5'-Biotin AGTTATTCACGTTGCTAAAG C15 R117 5'-Biotin CGCGATAGAGCGTTCCTCCT C16 R117H 5'-Biotin CGCGATAGAGTGTTCCTCCT C17 I148 5'-Biotin CTGCATTCCAATGTGATGAA C18 I148T 5'-Biotin CTGCATTCCAGTGTGATGAA C19 621+1G 5'-Biotin GGAAGTATTACCTTCTTATA C20 621+1G→T 5'-Biotin GGAAGTATTAACTTCTTATA C21 N1303 5'-Biotin TTAGAAAAAACTTGGATCCC C22 N1303K 5'-Biotin TTAGAAAAAAGTTGGATCCC C23 1078T 5'-Biotin CTCAGGGTTCTTTGTGGTGT C24 1078delT 5'-Biotin TCTCAGGGTTCTTGTGGTGT C25 R334 5'-Biotin AATCATCCTCCGGAAAATAT C26 R334W 5'-Biotin AATCATCCTCTGGAAAATAT C27 R347 5'-Biotin ATTGTTCTGCGCATGGCGGT C28 R347P 5'-Biotin ATTGTTCTGCCCATGGCGGT C29 711+1G 5'-Biotin TAGGTACATACTTCATCAAA C30 711+1G→T 5'-Biotin TAGGTACATAATTCATCAAA C31 G85 5'-Biotin TAAAAAGATTCCATAGAACA C32 G85E 5'-Biotin TAAAAAGATTTCATAGAACA C33 3849+10kbC 5'-Biotin ATTAAAATGGCGAGTAAGAC C34 3849+10kbC→T 5'-Biotin ATTAAAATGGTGAGTAAGAC C35 A455 5'-Biotin CAGTTGTTGGCGGTTGCTGG C36 A455E 5'-Biotin CAGTTGTTGGAGGTTGCTGG C37 R1162 5'-Biotin ATCTGTGAGCCGAGTCTTTA C38 R1162X 5'-Biotin ATCTGTGAGCTGAGTCTTTA (Continued) Rapid CF Screening by xMAPTM 153 Table 3 (Continued) Target Target sequence Modification Sequence 5' → 3' C39 3659C 5'-Biotin GGTAAACCTACCAAGTCAAC C40 3659delC 5'-Biotin AGGTAAACCTACAAGTCAAC C41 2789+5G 5'-Biotin ACATGGAATACTCACTTTCC C42 2789+5G→A 5'-Biotin ACATGGAATATTCACTTTCC C43 2184A 5'-Biotin AAGATTGTTTTTTTGTTTCT C44 2184delA 5'-Biotin AAGATTGTTTTTTGTTTCTG C45 1898+1G 5'-Biotin AAAGAACATACCTTTCAAAT C46 1898+1G→A 5'-Biotin AAAGAACATATCTTTCAAAT C47 3120+1G 5'-Biotin TTTTTACATACCTGGATGAA C48 3120+1G→A 5'-Biotin TTTTTACATATCTGGATGAA Reflex panel CR2 I506V 5'-Biotin GAAAATGTCATCTTTGGTGT CR3 I507V 5'-Biotin GAAAATATCGTCTTTGGTGT CR4 F508C 5'-Biotin AAAATATCATCTGTGGTGTT CR5 5T 5'-Biotin TCCCTGTTAAAAACACACAC CR6 7T 5'-Biotin CCCTGTTAAAAAAACACACA CR7 9T 5'-Biotin CCTGTTAAAAAAAAACACAC a The position and sequence of the mutation or variation is indicated in bold type. b Target C1 (I507 & F508) is also used in the reflex panel. Login to comment
114 Using a small target DNA (approx 100-300 bp) minimizes the potential for steric hindrance to affect the xMAPTM Table 4 PCR Amplification Primers Size CFTR target Mutation(s) Primer 5' Modification Sequence 5' → 3' (bp) Exon 10 ΔI507, ΔF508, BE10U 5'-Biotin TTCTGTTCTCAGTTTTCCTGG 107 I506V, I507V, E10D None TTGGCATGCTTTGATGACG F508C Exon 20 W1282X E20U None TTGAGACTACTGAACACTGAAGG 126 BE20D 5'-Biotin TTCTGGCTAAGTCCTTTTGC Intron 10 1717-1G→A E11U None TCAGATTGAGCATACTAAAAGTGAC 89 BE11D2 5'-Biotin GAACTATATTGTCTTTCTCTGCAAAC Exon 11 G542X, G551D, E11U2 None AAGTTTGCAGAGAAAGACAATATAG 135 R553X, R560T BE11D 5'-Biotin GAATGACATTTACAGCAAATGC Exon 4 R117H E4U None TTTGTAGGAAGTCACCAAAGC 145 BE4D2 5'-Biotin GAGCAGTGTCCTCACAATAAAGAG Exon 4/intron 4 I148T, E4U2 None CTTCTCTTTATTGTGAGGACACTGC 169 621+1G→T BE4D 5'-Biotin ATGACATTAAAACATGTACGATACAG Exon 21 N1303K BE21U 5'-Biotin TGCTATAGAAAGTATTTATTTTTTCTGG 106 E21D None AGCCTTACCTCATCTGCAAC Exon 7 1078delT, BE7U 5'-Biotin GAACAGAACTGAAACTGACTCG 199 R334W, R347P E7D3 None CAGGGAAATTGCCGAGTG Intron 5 711+1G→T I5U None CAACTTGTTAGTCTCCTTTCC 99 BI5D2 5'-Biotin AGTTGTATAATTTATAACAATAGTGC Exon 3 G85E E3U None CTGGCTTCAAAGAAAAATCC 117 BE3D2 5'-Biotin TGAATGTACAAATGAGATCCTTACC Chromosome 7 3849+10kbC→T BC7U 5'-Biotin GACTTGTCATCTTGATTTCTGG 148 C7D None TTTGGTGCTAGCTGTAATTGC Exon 9 A455E BE9U 5'-Biotin TCACTTCTTGGTACTCCTGTCC 105 E9D None CAAAAGAACTACCTTGCCTGC Exon 19-I R1162X BE19U 5'-Biotin ATTGTGAAATTGTCTGCCATTC 167 E19Da None CAATAATCATAACTTTCGAGAGTTG Exon 19-II 3659delC BE19U2 5'-Biotin TTTAAGTTCATTGACATGCCAAC 91 E19Da None CAATAATCATAACTTTCGAGAGTTG Intron 14B 2789+5G→A I14BU None GTGTCTTGTTCCATTCCAGG 147 BI14BD 5'-Biotin TGGATTACAATACATACAAACATAGTGG Exon 13 2184delA E13U None AGATGCTCCTGTCTCCTGG 126 BE13D 5'-Biotin TGCACAATGGAAAATTTTCGTATAG Intron 12 1898+1G→A I12U None TTAGACTCTCCTTTTGGATACC 110 BI12D 5'-Biotin GTCTTTCTTTTATTTTAGCATGAGC Intron 16 3120+1G→A I16U None ATGACCTTCTGCCTCTTACC 118 BI16D 5'-Biotin ATGAAAACAAAATCACATTTGC Intron 8 5T/7T/9T I8U None TAATGGATCATGGGCCATGTGC 212 BI8D 5'-Biotin ACTGAAGAAGAGGCTGTCATCACC CFTR, cystic fibrosis transmembrane conductance regulator gene. Login to comment
119 Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene. Login to comment
124 The M1 reaction was also used for detection of the I506V, I507V, and F508C polymorphisms in the reflex panel. Login to comment
259 Table7(continued) 167 Table 8 Allelic Ratio Data for the Reflex Panela Genotype I507 & F508 I506V I507Vb F508C Exon 10 variants ΔF508/ΔF508c - - - - ΔF508/Normal 0.93 0.03 0.02 0.02 Normal/Normal 0.94 0.03 0.01 0.01 ΔI507/Normal 0.97 0.04 -0.03 0.01 I506V/Normal 0.45 0.01 -0.01 0.54 F508C/Normal 0.40 0.58 0.00 0.01 Intron 8 variants Genotype 5T 7T 9T 7T/7T -0.06 1.06 0.01 7T/7T -0.01 1.00 0.01 7T/7T -0.01 1.01 0.00 9T/9T 0.05 0.05 0.90 9T/9T 0.07 0.05 0.87 7T/9T 0.04 0.45 0.51 7T/9T 0.03 0.40 0.56 5T/7T 0.42 0.60 -0.01 5T/7T 0.45 0.59 -0.04 5T/9T 0.36 0.00 0.64 a Positive alleles are indicated in bold type. b Samples positive for the I507V allele were not available. Login to comment

[hide] Microsphere bead arrays and sequence validation of... J Mol Diagn. 2004 Nov;6(4):348-55. Hadd AG, Laosinchai-Wolf W, Novak CR, Badgett MR, Isgur LA, Goldrick M, Walkerpeach CR
Microsphere bead arrays and sequence validation of 5/7/9T genotypes for multiplex screening of cystic fibrosis polymorphisms.
J Mol Diagn. 2004 Nov;6(4):348-55., [PMID:15507674]

Abstract [show]
The development of simple and rapid methods for the detection of the common genetic mutations associated with cystic fibrosis (CF) requires access to positive-control samples including the 5/7/9T variants of intron 8. We used PCR and a simple multiplex bead-array assay to identify 5/7/9T control samples from 29 commercially available DNA samples. Unpurified PCR products were directly hybridized to color-coded beads containing allele-specific capture probes for 5/7/9T detection. The performance of the assay was investigated using reverse-complement oligonucleotides, individual PCR products, and multiplex PCR products for 5/7/9T detection within a complex CFTR screening assay. Samples were genotyped by grouping the relative signal intensities from each capture probe. Of 29 commercially available DNA samples analyzed, 2 5T/7T, 2 5T/9T, 9 7T/9T, 11 7T/7T, and 5 9T/9T genotypes were identified. The genotype within each sample group was confirmed by DNA sequencing. The assay was compatible with the analysis of 10 to 1000 ng of genomic DNA isolated from whole blood and allowed for the separate identification of primary CFTR mutations from reflex variants. The correct identification of positive controls demonstrated the utility of a simple bead-array assay and provided accessible samples for assay optimization and for routine quality control in the clinical laboratory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
197 Intron 8 Genotype by Coriell Number, Characterized CF Mutation and Allele Fraction for 5/7/9T Intron 8 genotype Coriell sample Characterized mutation Allele fraction by probe 5T 7T 9T 7T/7T NA09947 Normal 0.04 0.93 0.03 NA11277 ⌬I507/normal 0.06 0.90 0.04 NA11761 G551D/R553X 0.06 0.92 0.02 NA11859 2789ϩ5GϾA/2789ϩ5GϾA 0.02 0.96 0.02 NA11860 3849ϩ10kbCϾT/3849ϩ10kbCϾT 0.03 0.94 0.03 NA12444 1717-1GϾT/normal 0.06 0.87 0.07 NA12585 R1162X/normal 0.07 0.86 0.08 NA12785 R347P/G551D 0.04 0.92 0.05 NA12960 R334W/normal 0.06 0.92 0.02 NA12961 V520F/normal 0.06 0.89 0.05 NA13033 F508C/normal 0.03 0.93 0.04 9T/9T NA01531 ⌬F508/⌬F508 0.14 0.04 0.82 NA11281 621ϩ1GϾT/⌬F508 0.14 0.04 0.82 NA11283 A455E/⌬F508 0.13 0.05 0.82 NA11290 A455E/621ϩ1GϾT 0.12 0.01 0.87 NA11496 G542X/G542X 0.14 0.05 0.81 5T/7T NA11723 W1282X/normal 0.53 0.44 0.03 NA13032 I506V/normal 0.58 0.39 0.03 5T/9T NA11279 129GϾC/⌬F508 0.51 0.00 0.49 NA13591 R117H/⌬F508 0.52 0.00 0.48 7T/9T NA07441 3120ϩ1GϾA/621ϩ1GϾA 0.08 0.41 0.51 NA07552 R553X/⌬F508 0.09 0.36 0.55 NA07830 556dA/⌬F508 0.11 0.37 0.52 NA11275 3659dC/⌬F508 0.10 0.37 0.53 NA11278 Q493X/⌬F508 0.09 0.38 0.53 NA11280 711ϩ1GϾT/621ϩ1GϾA 0.09 0.37 0.54 NA11282 G85E/621ϩ1GϾA 0.07 0.39 0.53 NA11284 R560T/⌬F508 0.08 0.39 0.52 NA11472 N1303K/G1349D 0.08 0.39 0.54 Figure 3. Login to comment

[hide] Modeling of nucleotide binding domains of ABC tran... J Bioenerg Biomembr. 1997 Oct;29(5):503-24. Bianchet MA, Ko YH, Amzel LM, Pedersen PL
Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR).
J Bioenerg Biomembr. 1997 Oct;29(5):503-24., [PMID:9511935]

Abstract [show]
Members of the ABC transporter superfamily contain two nucleotide binding domains. To date, the three dimensional structure of no member of this super-family has been elucidated. To gain structural insight, the known structures of several other nucleotides binding proteins can be used as a framework for modeling these domains. We have modeled both nucleotide binding domains of the protein CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) using the two similar domains of mitochondrial F1-ATPase. The models obtained, provide useful insights into the putative functions of these domains and their possible interaction as well as a rationale for the basis of Cystic Fibrosis causing mutations. First, the two nucleotide binding domains (folds) of CFTR are each predicted to span a 240-250 amino acid sequence rather than the 150-160 amino acid sequence originally proposed. Second, the first nucleotide binding fold, is predicted to catalyze significant rates of ATP hydrolysis as a catalytic base (E504) resides near the y phosphate of ATP. This prediction has been verified experimentally [Ko, Y.H., and Pedersen, P.L. (1995) J. Biol. Chem. 268, 24330-24338], providing support for the model. In contrast, the second nucleotide binding fold is predicted at best to be a weak ATPase as the glutamic acid residue is replaced with a glutamine. Third, F508, which when deleted causes approximately 70% of all cases of cystic fibrosis, is predicted to lie in a cleft near the nucleotide binding pocket. All other disease causing mutations within the two nucleotide binding domains of CFTR either reside near the Walker A and Walker B consensus motifs in the heart of the nucleotide binding pocket, or in the C motif which lies outside but near the nucleotide binding pocket. Finally, the two nucleotide binding domains of CFTR are predicted to interact, and in one of the two predicted orientations, F508 resides near the interface. This is the first report where both nucleotide binding domains of an ABC transporter and their putative domain-domain interactions have been modeled in three dimensions. The methods and the template used in this work can be used to analyze the structures and function of the nucleotide binding domains of all other members of the ABC transporter super-family.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Importantly, missense mutations such as F508C, I506V and I507V are benign and do not cause the disease [Kobayashi et al. (1990)]. Login to comment

[hide] Psoralen-modified oligonucleotide primers improve ... Hum Mol Genet. 1993 Apr;2(4):393-7. Costes B, Girodon E, Ghanem N, Chassignol M, Thuong NT, Dupret D, Goossens M
Psoralen-modified oligonucleotide primers improve detection of mutations by denaturing gradient gel electrophoresis and provide an alternative to GC-clamping.
Hum Mol Genet. 1993 Apr;2(4):393-7., [PMID:7684943]

Abstract [show]
Denaturing gradient gel electrophoresis (DGGE), a mutation-scanning procedure separating DNA fragments differing by as little as a single base change, is widely used in studies of genomic nucleotide sequence variability. The efficiency of the technique is greatly enhanced by attaching, through polymerase chain reaction (PCR) incorporation, a long GC-tail to the test DNA sequence which, as a result, becomes analysable throughout. As synthesis of GC-rich specific PCR primers is costly and time-consuming, we attempted to clamp the DNA fragment using a psoralen derivative (ChemiClamp) that promotes photo-induced cross-linking at one end. We found that this procedure provides an attractive alternative to GC-clamp in DGGE (and temperature gradient gel electrophoresis) and should prove useful in both research and diagnostic laboratories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Analysis of the exon 10 nucleotide substitution 1648 A-G(I506V). Login to comment
33 Lane 1: an I506V heterozygous sample amplified with regular primers; Lane 2: a normal control; Lane 3: the I506V sample amplified with ChemiClamped primers and run without prior UV irradiation; Lanes 4 and 5:1506V sample and a normal control, respectively, amplified with ChemiClamped primers and run after 15 min of UV irradiation. Login to comment
44 Two nucleotide substitutions lying in a single melting domain within CFTR exon 10 (1648 A-G named I506V) or exon 4 (482 G-A or R117H) were analysed with or without the chemical clamp at one end of the gene fragment. Login to comment
55 DGGE analysis of the I506V polymorphism in exoo 10 of the CFTR gene, using ChemiClamped (left) and GC-clamped (right) primers. Login to comment
65 the DGGE pattern of ChemiClamped exon 10 fragments from an I506V heterozygote, shows that homoduplexes and heteroduplexes can be distinguished unambiguously. Login to comment

[hide] Three point mutations in the CFTR gene in French c... Hum Genet. 1990 Sep;85(4):446-9. Vidaud M, Fanen P, Martin J, Ghanem N, Nicolas S, Goossens M
Three point mutations in the CFTR gene in French cystic fibrosis patients: identification by denaturing gradient gel electrophoresis.
Hum Genet. 1990 Sep;85(4):446-9., [PMID:2210768]

Abstract [show]
The cystic fibrosis (CF) gene was recently identified as a gene spanning 250 kilobases (kbp) and coding for a 1480 amino acid protein, cystic fibrosis transmembrane conductance regulator (CFTR). Approximately 70% of CF mutations involve a three-base-pair deletion in CFTR exon 10, resulting in the loss of a phenylalanine at position 508 in the gene product (delta F508). In order to screen for other molecular defects, we have used a strategy based on denaturing gradient gel electrophoresis (DGGE) of polymerase chain reaction (PCR)-amplified gene segments. This method, which permits rapid detection of any sequence change in a given DNA stretch, was used successfully to analyse 61 non-delta F508 CF chromosomes from French CF patients. A study of CFTR exons 10, 11, 14a, 15 and 20 detected three mutations located in exons 14a, 15 and 20, along with several nucleotide sequence polymorphisms. These nucleotide changes were identified by direct sequencing of PCR fragments displaying altered electrophoretic behaviour, together with some of the polymorphisms and mutations previously characterized by others. The strategy presented here constitutes a valuable tool for the development of carrier testing for individuals or couples with a family history of cystic fibrosis, and will contribute to deciphering the functionally important regions of the CFTR gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 One is probably a polymorphism, since the A-to-G substitution at position 1648 (exon 10), which replaces an isoleucine by a valine (I506V), was found in one instance on a normal chromosome. Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 If indicated, testing includes reflex analysis for the following variants: 5/7/9T exon 9 splice acceptor tracts, F508C, I507V and I506V. Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment

[hide] Genetics of cystic fibrosis: CFTR mutation classif... Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12. Fanen P, Wohlhuter-Haddad A, Hinzpeter A
Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies.
Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12., [PMID:24631642]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes an epithelial anion channel. Since the identification of the disease in 1938 and up until 2012, CF patients have been treated exclusively with medications aimed at bettering their respiratory, digestive, inflammatory and infectious symptoms. The identification of the CFTR gene in 1989 gave hopes of rapidly finding a cure for the disease, for which over 1950 mutations have been identified. Since 2012, recent approaches have enabled the identification of small molecules targeting either the CFTR protein directly or its key processing steps, giving rise to novel promising therapeutic tools. This review presents the current CFTR mutation classifications according to their clinical consequences and to their effect on the structure and function of the CFTR channel. How these classifications are essential in the establishment of mutation-targeted therapeutic strategies is then discussed. The future of CFTR-targeted treatment lies in combinatory therapies that will enable CF patients to receive a customized treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Group A Group B Group C Group D Classic-CF CF-causing mutations Non-classic CF CFTR-related disorder associated mutations No clinical consequence Unknown clinical relevance All mutations in Table 2 and 711 + 3A > G*, R117H-T5*, D1152H*, L206W*, TG13-T5* TG13-T5a , R117H-T5a , D1152Ha , L206Wa , L997F, M952I, D565Ga , TG11-T5b , R117H-T7b , D443Y-G576A-R668C, R74W-D1270N, R75Qb TG11-T5b , R117H-T7b , R75Qb , 875 + 40A/G, M470V, T854T, P1290P, I807M, I521F, R74W, F508C, I506V, I148T All mutations (mostly missense) not yet analyzed or undergoing functional analysis a Mutations that may belong either to Group A or to Group B. b Mutations that may belong either to Group B or to Group C. Login to comment