ABCMdb

ABCC7 p.Gly970Asp

ClinVar:	c.2908G>C , p.Gly970Arg D , Pathogenic c.2908G>A , p.Gly970Ser ? , not provided c.2909G>A , p.Gly970Asp D , Likely pathogenic
CF databases:	c.2908G>C , p.Gly970Arg D , CF-causing ; CFTR1: The G970R mutation (G->C at nucleotide position 3040) in exon 15 was found in 1 out of 34 unrelated Belgian CF chromosomes (7 [delta]F508 and 27 non-[delta]F508 CF chromosomes). c.2908G>A , p.Gly970Ser (CFTR1) ? , This mutation was detected by DHPLC analysis followed by direct sequencing. This mutation was found in one CF patient of Egyptian origin who carried the F508 del on the second CF allele c.2909G>A , p.Gly970Asp (CFTR1) ? , The above mutation was found by SSCP/HA in a compound heterozygote; the other mutation is an 8 nt deletion in exon 4. Further patient information will be reported. <BR> (Corrected August 4, 1997)
Predicted by SNAP2:	A: D (80%), C: D (85%), D: D (91%), E: D (95%), F: D (95%), H: D (95%), I: D (91%), K: D (95%), L: D (95%), M: D (91%), N: D (85%), P: D (95%), Q: D (91%), R: D (95%), S: D (80%), T: D (91%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Two novel mutations in a cystic fibrosis patient o... Hum Genet. 1999 Jun;104(6):511-5. Wagner JA, Vassilakis A, Yee K, Li M, Hurlock G, Krouse ME, Moss RB, Wine JJ
Two novel mutations in a cystic fibrosis patient of Chinese origin.
Hum Genet. 1999 Jun;104(6):511-5., [PMID:10453741]

Abstract [show]
Cystic fibrosis is rare in non-Caucasian populations, and in such populations little is known about the spectrum of mutations and polymorphisms in the CFTR gene. We studied a 23-year-old patient of Chinese ethnicity with sweat chloride values of 104 mM/l, pancreatic sufficiency, an FEV1 60% of normal, sputum cultures positive for Staphylococcus aureus and Burkholderia cepacia, and a history of allergic bronchopulmonary aspergillosis. Genetic screening for 31 common CFTR mutations was negative, leading us to search for unknown mutations using single-strand conformation polymorphism and heteroduplex analysis (SSCP/HA). Two novel mutations were detected. In exon 4, a deletion of 8 bp (451458, deltaGCTTCCTA) causes a frameshift and immediately creates a stop codon. In exon 16, mutation 3041G-->A causes the missense change G970D. Functional analysis using an isotopic flux assay indicated that the G970D mutation retains partial function; western blotting indicated that the protein is glycosylated. The patient is heterozygous for the common polymorphisms (2694T/G) in exon 14a and (GATT)6/7 in intron 6a, indicating that these variants arose in ancestors common to Caucasians and Chinese.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 In exon 16, mutation 3041G→A causes the missense change G970D. Login to comment
6 Functional analysis using an isotopic flux assay indicated that the G970D mutation retains partial function; western blotting indicated that the protein is glycosylated. Login to comment
32 Functional analysis G970D was evaluated by introducing the change into human CFTR cDNA using the Stratagene (La Jolla, Calif.) Login to comment
62 Exon 16 was heterozygous for 3041G→A, which converts the codon GGT to GAT and causes the missense 512 Table 1 Primer sequences used to amplify specific CFTR exons Exon Name Base Sequence (5'-3') pair 1 SO-006 204 TTGAGCGGCAGGCACCCAG SO-007 ACACGCCCTAATCTTTCGTG 2 SO-093 178 AGTGAATATCTCTTCCTCCTC SO-094 TTTCTCTTCAACTAAACAATGT 4 SO-016 369 TGTGTTGAAATTCTCAGGGT SO-017 CAGAATATATGTGCCATGGG 5 SO-087 185 ATTATCTAACTTTCCATTTTT SO-88 ACTCCGCCTTTCTTCCAGTTGTA 14a SO-101 200 ATTCTTTTATTCAGGAGTGC SO-102 CCAAACTATCTTAATTTAACTTTA 14b SO-099 203 GGAGGAATAGGTGAAGATGT SO-100 TGGGAGAAATGAAACAAAGT 15 SO-023 485 GTGCATGCTCTTCTAATGCA SO-024 AAGGCACATGCCTCTGTGCA 16 SO-89 191 TGTGATCCAAACTTAGTATTG SO-90 CTTAACGGTACTTATTTTTACA 17a SO-091 199 CATGTTTTCTTTGATCTTACAG SO-092 TGAGTATCGCACATTCACTG 18 SO-097 188 AGGTTCATTTACGTCTTTTG SO-098 ACTTTGTTACTTGTCTGAATTT 23 SO-108 190 ATTACAAGGGCAATGAGATC SO-087 ATTATCTAACTTTCCATTTTT change G970D (Fig.2). Login to comment
63 G970D is a novel mutation, but G970R was reported previously in a single Belgian patient (Cuppens et al. 1993). Login to comment
65 Physiological analysis of G970D To determine whether partial function of G970D might explain this subject`s spared pancreatic function, we made a G970D construct using site-directed mutagenesis, expressed it in HEK cells and assayed for CFTR function using an iodide efflux assay. Login to comment
67 As shown in Fig.3, efflux from cells transfected with the G970D construct was significantly reduced relative to that seen in cells transfected with WT CFTR, but was significantly elevated in comparison with control cells transfected with vector alone. Login to comment
71 We used a western assay to compare G970D with WT CFTR, the M470V polymorphism, and ∆F508. Login to comment
75 B Chromatogram to illustrate heterozygosity for G/A at position 3041(N) in exon 16, giving rise to G970D. Login to comment
79 Asterisks above the points for G970D indicate a significant difference from WT; asterisks below the points indicate a significant difference from vector (P < 0.05); bars are SEM Fig.4 Western blot analysis of G970D CFTR protein. Login to comment
81 The four lanes represent wild type CFTR and the M470V polymorphism (positive controls), ∆F508 (a negative control showing no processing to fully glycosylated CFTR), and G970D Based on this assay, processing of G970D was affected somewhat relative to WT (Fig.), but not more than the common polymorphism M470V. Login to comment
95 The 8-bp deletion is expected to eliminate all functional CFTR expressed from that chromosome, whereas G970D retains partial function. Login to comment
96 Mutation G970D affects the same codon as the previously reported G970R (Cuppens et al. 1993). Login to comment
102 Of interest, they found that the peak efflux for the construct G970E was about half that of WT, which is very similar to our result for the natural mutation G970D. Login to comment
105 Pancreatic sufficiency could presumably arise from the residual Cl-channel function of G970D CFTR, or from a residual ability to regulate chloride/bicarbonate transport (Lee et al. 1999). Login to comment
106 The relatively large efflux observed for G970D (approximately 50% of WT) is probably an overestimate of function. Login to comment

[hide] Comprehensive mutation screening in a cystic fibro... Pediatrics. 2001 Feb;107(2):280-6. Wine JJ, Kuo E, Hurlock G, Moss RB
Comprehensive mutation screening in a cystic fibrosis center.
Pediatrics. 2001 Feb;107(2):280-6., [PMID:11158459]

Abstract [show]
OBJECTIVES AND BACKGROUND: The identities of a cystic fibrosis (CF) patient's CFTR mutations can influence therapeutic strategies, but because >800 CFTR mutations exist, cost-effective, comprehensive screening requires a multistage approach. Single-strand conformation polymorphism and heteroduplex analysis (SSCP/HA) can be an important part of mutation detection, but must be calibrated within each laboratory. The sensitivity of a combined commercial-SSCP/HA approach to genotyping in a large, ethnically diverse US center CF population has not been established. STUDY DESIGN: We screened all 27 CFTR exons in 10 human participants who had an unequivocal CF diagnosis including a positive sweat chloride test and at least 1 unknown allele after commercial testing for the 70 most common mutations by SSCP/HA. These participants were compared with 7 participants who had negative sweat tests but at least 1 other CF-like symptom meriting complete genotyping. RESULTS: For the 10 CF participants, we detected 11 of 16 unknown alleles (69%) and all 4 of the known alleles (100%), for an overall rate of 75% inpatients not fully genotyped by conventional 70 mutation screen. For 7 participants with negative sweat tests, we confirmed 1 identified mutation in 14 alleles and detected 3 additional mutations. Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, DeltaF508, 451-458Delta8 bp, 5T, 663DeltaT, exon 13 frameshift, 1261+1G-->A and 3272-26A-->G). Three of these mutations were novel (G970D, L1093P, and 451-458Delta8 bp(1)). Thirteen other changes were detected, including the novel changes 1812-3 ins T, 4096-278 ins T, 4096-265 ins TG, and 4096-180 T-->G. CONCLUSION: When combined with the 70 mutation Genzyme test, SSCP/HA analysis allows for detection of >95% of the mutations in an ethnically heterogeneous CF center population. We discuss 5 possible explanations that could account for the few remaining undetected mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, ⌬F508, 451-458⌬8 bp, 5T, 663⌬T, exon 13 frameshift, 1261؉1G3A and 3272-26A3G). Login to comment
17 Three of these mutations were novel (G970D, L1093P, and 451-458⌬8 bp1). Login to comment
115 Mutation Detection in 10 Participants With Positive Sweat Chloride Values I.D. Pancreatic Function Mutation Status Discovered Mutations (Novel) Polymorphisms SP1 PI N1303K/unk* L1093P (17b), M470V (10)* SP2 PI unk*/unk* S13F (exon1) 2184 ins A (exon 13) GATT7/7, 2694 T/G SP3 PS unk*/unk* ⌬451-458 (4); G970D (16) GATT7/6, 2694 T/G SP4 PS unk*/unk* R75X (3), G98R (4) GATT7/7, 492 G/A SP5 PS unk*/unk 3272-26A/G (17b) M470V/M470V (10) SP6 PI/PS (mild) ⌬F508/unk None found - SP7 PI ⌬F508/unk None found GATT6/7,1001ϩ11C/T (6b), M470V (10) SP8 PI unk*/unk S492F (10) GATT7/7 GT11/11 M470V/M470V SP9 PI ⌬F508/unk None found - SP10 PI unk*/unk* 663 ⌬T/663 ⌬T GATT6/6, 2694T3G Column labeled Pancreatic Function indicates the need for dietary supplementation with pancreatic enzymes. Login to comment
135 Novel mutations ⌬451-458 and G970D were reported separately1; novel mutation L1093P has been submitted for publication. Login to comment

[hide] A novel missense mutation A1081P in the cystic fib... J Trop Pediatr. 2004 Aug;50(4):239-40. Ngukam A, Jacquemont ML, Souville I, Viel M, Beldjord C, Hubert D, Hughes JN, Bienvenu T
A novel missense mutation A1081P in the cystic fibrosis transmembrane conductance regulator (CFTR) gene identified in a Laotian patient with congenital bilateral absence of the vas deferens.
J Trop Pediatr. 2004 Aug;50(4):239-40., [PMID:15357566]

Abstract [show]
Cystic fibrosis is the most common autosomal disorder in the Caucasion population. However, the disease is rare in Asia and little is known about the spectrum of CF transmembrane conductance regulator, CFTR, mutations in this population. We studied a 39-year-old Loatian patient with congenital bilateral absence of the vas deferens and identified a novel missense mutation in exon 17b (3373G>C). Identification of novel mutations in this Asian population is of particular interest when designing a genetic testing strategy in Asian countries and also in other countries where immigration from Asia is common.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Only a few CFTR mutations have been identified in that population (L88X, M152R, K166E, F508del, 1742delAC, 1525-18G>A, 1540del10, L568X, 1898ϩ1G>T, 1898ϩ5G>T, G970D, 451-458del8, 3121-2A>G, H1085R).1-6 We report here a novel missense mutation in a Laotian patient with congenital bilateral absence of the vas deferens (CBAVD). Login to comment

[hide] Phenotypic characterisation of patients with inter... Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23. Goubau C, Wilschanski M, Skalicka V, Lebecque P, Southern KW, Sermet I, Munck A, Derichs N, Middleton PG, Hjelte L, Padoan R, Vasar M, De Boeck K
Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis.
Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23., [PMID:19318346]

Abstract [show]
BACKGROUND: In patients with symptoms suggestive of cystic fibrosis (CF) and intermediate sweat chloride values (30-60 mmol/l), extensive CFTR gene mutation analysis and nasal potential difference (NPD) measurement are used as additional diagnostic tests and a positive result in either test provides evidence of CFTR dysfunction. To define the phenotype of such patients and confirm the validity of grouping them, patients with intermediate sweat chloride values in whom either additional CF diagnostic test was abnormal were compared with subjects in whom this was not the case and patients with classic CF. METHODS: The phenotypic features of four groups were compared: 59 patients with CFTR dysfunction, 46 with an intermediate sweat chloride concentration but no evidence of CFTR dysfunction (CF unlikely), 103 patients with CF and pancreatic sufficiency (CF-PS) and 62 with CF and pancreatic insufficiency (CF-PI). RESULTS: The CFTR dysfunction group had more lower respiratory tract infections (p = 0.01), more isolation of CF pathogens (p<0.001) and clubbing (p = 0.001) than the CF unlikely group, but less frequent respiratory tract infections with CF pathogens than the CF-PS group (p = 0.05). Patients in the CF-PS group had a milder phenotype than those with PI. Many features showed stepwise changes through the patient groups. CONCLUSION: Patients with intermediate sweat chloride values and two CFTR mutations or an abnormal NPD measurement have a CF-like phenotype compatible with CFTR dysfunction and, as a group, differ phenotypically from patients with intermediate sweat chloride values in whom further CF diagnostic tests are normal as well as from CF-PS and CF-PI patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

[hide] Mutations in the cystic fibrosis transmembrane con... J Cyst Fibros. 2012 Jul;11(4):316-23. doi: 10.1016/j.jcf.2012.01.005. Epub 2012 Apr 6. Li H, Wen Q, Li H, Zhao L, Zhang X, Wang J, Cheng L, Yang J, Chen S, Ma X, Wang B
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) in Chinese patients with congenital bilateral absence of vas deferens.
J Cyst Fibros. 2012 Jul;11(4):316-23. doi: 10.1016/j.jcf.2012.01.005. Epub 2012 Apr 6., [PMID:22483971]

Abstract [show]
BACKGROUND: Genetic testing of the cystic fibrosis transmembrane conductance (CFTR) gene is currently performed in patients with congenital bilateral absence of vas deferens (CBAVD). This study was conducted to investigate the role of mutations in the CFTR gene in CBAVD-dependent male infertility. METHODS: 73 Chinese patients diagnosed with CBAVD were studied. The entire coding regions and splice sites of 27 exons of the CFTR gene were sequenced in 146 chromosomes from the 73 CBAVD patients. Screening was carried out using PCR, gel electrophoresis and DNA sequencing to identify novel variants of the entire coding regions and boundaries of the 27 exons. RESULTS: Five novel nonsynonymous mutations, three novel splice site mutations and one deletion were identified by sequencing. Apart from the novel variants, we also found 19 previously reported mutations and polymorphism sites. Thirty-four patients (46.57%) had the 5T variant (6 homozygous and 28 heterozygous) and in two of them it was not associated with any detectable mutation of the CFTR gene. All potential pathogenic mutations are not contained in the 1000 Genome Project database. In total, the present study identified 30 potential pathogenic variations in the CFTR gene, 9 of which had not previously been described. CONCLUSIONS: Most patients with CBAVD have mutations in the CFTR gene. A mild genotype with one or two mild or variable mutations was observed in all the patients. These findings improve our understanding of the distribution of CFTR alleles in CBAVD patients and will facilitate the development of more sensitive CFTR mutation screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1). Login to comment
119 △F508 R117H Mutation genotypes IVS8-Tn n (%) Two mutations detected Neg Neg I556V/I556V 7T/7T 1(1.3) Neg Neg I556V/1209+2 G-C 5T/7T 1(1.3) Neg Neg I556V/726delATT 5T/5T 1(1.3) Neg Neg I556V/- 5T/5T 1(1.3) Neg Neg I556V/- 5T/7T 1(1.3) Neg Neg G970D/- 5T/7T 1(1.3) Neg Neg C592F/- 5T/5T 1(1.3) Neg Neg 1209+1 G-C/- 5T/7T 1(1.3) Neg Neg R553X/- 5T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg S485C/- 5T/7T 1(1.3) Neg Neg A357T/- 5T/7T 1(1.3) Neg Neg E217G/- 5T/7T 1(1.3) Neg Neg R347H/- 5T/7T 1(1.3) Neg Neg G451K/- 5T/7T 1(1.3) Neg Neg L558S/- 5T/7T 1(1.3) Neg Neg 3635delT/Q1352H 7T/7T 1(1.3) Neg Neg A1136T/G970D 7T/7T 1(1.3) Neg Neg 870-1 G-C/- 5T/7T 1(1.3) Neg Neg 520-2 A-G/- 5T/7T 1(1.3) Neg Neg R419I/- 5T/7T 1(1.3) Neg Neg C491F/Q1643Q 7T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg R851X/- 5T/7T 1(1.3) Neg Neg P750L/G970D 7T/7T 1(1.3) One mutation detected Neg Neg -/- 5T/7T 2(2.7) Neg Neg -/- 5T/7T 3(4.1) Neg Neg -/- 5T/7T 5(6.8) Neg Neg -/- 5T/5T 2(2.7) Neg Neg -/- 5T/5T 1(1.3) Neg Neg G970D/- 7T/7T 2(2.7) Neg Neg D993Y/- 7T/7T 1(1.3) Neg Neg I556V/- 7T/7T 1(1.3) Neg Neg T388R/- 7T/7T 1(1.3) No mutation detected Neg Neg -/- 7T/7T 8(10.9) Neg Neg -/- 7T/7T 15(20.5) Neg Neg -/- 7T/9T 2(2.7) Neg Neg -/- 7T/7T 4(5.5) Neg: Negative. Login to comment
76 Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1). Login to comment
118 b3;F508 R117H Mutation genotypes IVS8-Tn n (%) Two mutations detected Neg Neg I556V/I556V 7T/7T 1(1.3) Neg Neg I556V/1209+2 G-C 5T/7T 1(1.3) Neg Neg I556V/726delATT 5T/5T 1(1.3) Neg Neg I556V/- 5T/5T 1(1.3) Neg Neg I556V/- 5T/7T 1(1.3) Neg Neg G970D/- 5T/7T 1(1.3) Neg Neg C592F/- 5T/5T 1(1.3) Neg Neg 1209+1 G-C/- 5T/7T 1(1.3) Neg Neg R553X/- 5T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg S485C/- 5T/7T 1(1.3) Neg Neg A357T/- 5T/7T 1(1.3) Neg Neg E217G/- 5T/7T 1(1.3) Neg Neg R347H/- 5T/7T 1(1.3) Neg Neg G451K/- 5T/7T 1(1.3) Neg Neg L558S/- 5T/7T 1(1.3) Neg Neg 3635delT/Q1352H 7T/7T 1(1.3) Neg Neg A1136T/G970D 7T/7T 1(1.3) Neg Neg 870-1 G-C/- 5T/7T 1(1.3) Neg Neg 520-2 A-G/- 5T/7T 1(1.3) Neg Neg R419I/- 5T/7T 1(1.3) Neg Neg C491F/Q1643Q 7T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg R851X/- 5T/7T 1(1.3) Neg Neg P750L/G970D 7T/7T 1(1.3) One mutation detected Neg Neg -/- 5T/7T 2(2.7) Neg Neg -/- 5T/7T 3(4.1) Neg Neg -/- 5T/7T 5(6.8) Neg Neg -/- 5T/5T 2(2.7) Neg Neg -/- 5T/5T 1(1.3) Neg Neg G970D/- 7T/7T 2(2.7) Neg Neg D993Y/- 7T/7T 1(1.3) Neg Neg I556V/- 7T/7T 1(1.3) Neg Neg T388R/- 7T/7T 1(1.3) No mutation detected Neg Neg -/- 7T/7T 8(10.9) Neg Neg -/- 7T/7T 15(20.5) Neg Neg -/- 7T/9T 2(2.7) Neg Neg -/- 7T/7T 4(5.5) Neg: Negative. Login to comment