ABCC7 p.Ser434*
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]
Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b.
X
ABCC7 p.Ser434* 10923036:109:455
status: NEW[hide] A novel nonsense mutation, S434X, in exon 9 of the... Hum Mutat. 1999 Aug 19;14(2):182. Mittre H, Bahlous A, Leporrier N, Leymarie P
A novel nonsense mutation, S434X, in exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
Hum Mutat. 1999 Aug 19;14(2):182., [PMID:10425081]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 Corresponding Author Address and E-mail: H.MITTRE Laboratoire de Biochimie B, C.H.U. Ave G. Clemenceau., 14033 CAEN CEDEX, France E-mail : mittre-h@chu-caen.fr Title : A novel nonsense mutation, S434X, in exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene Keywords: CFTR, Cystic Fibrosis, compound heterozygote, deltaF508 Species: Human Change is: nonsense mutation Gene/Locus Name: Cystic Fibrosis Transmembrane Conductance Regulator gene.
X
ABCC7 p.Ser434* 10425081:1:195
status: NEW3 Mutation / polymorphism name Nucleotide change-Systematic name: c1433C>G Amino acid change-Trivial name: S434X.
X
ABCC7 p.Ser434* 10425081:3:105
status: NEW27 The S434X mutation was detected by direct sequencing of exon 9 after amplification with primers 5'TATACAGTGTAATGGATCATGGGCCA3' and 5'AAGAGACATGGACACCAAATTAAGTTC3' to produce a 372-bp product.
X
ABCC7 p.Ser434* 10425081:27:4
status: NEW29 This substitution is predicted to introduce a termination codon (TGA) in place of the amino acid Serine at residue 434 (S434X) of the CFTR protein.
X
ABCC7 p.Ser434* 10425081:29:120
status: NEW