ABCMdb

PMID: 10425081

Mittre H, Bahlous A, Leporrier N, Leymarie P
A novel nonsense mutation, S434X, in exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
Hum Mutat. 1999 Aug 19;14(2):182., [PubMed]

Sentences

No. Mutations Sentence Comment

1 ABCC7 p.Ser434* Corresponding Author Address and E-mail: H.MITTRE Laboratoire de Biochimie B, C.H.U. Ave G. Clemenceau., 14033 CAEN CEDEX, France E-mail : mittre-h@chu-caen.fr Title : A novel nonsense mutation, S434X, in exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene Keywords: CFTR, Cystic Fibrosis, compound heterozygote, deltaF508 Species: Human Change is: nonsense mutation Gene/Locus Name: Cystic Fibrosis Transmembrane Conductance Regulator gene. Login to comment 3 ABCC7 p.Ser434* Mutation / polymorphism name Nucleotide change-Systematic name: c1433C>G Amino acid change-Trivial name: S434X. Login to comment 27 ABCC7 p.Ser434* The S434X mutation was detected by direct sequencing of exon 9 after amplification with primers 5'TATACAGTGTAATGGATCATGGGCCA3' and 5'AAGAGACATGGACACCAAATTAAGTTC3' to produce a 372-bp product. Login to comment 29 ABCC7 p.Ser434* This substitution is predicted to introduce a termination codon (TGA) in place of the amino acid Serine at residue 434 (S434X) of the CFTR protein. Login to comment