ABCC7 p.Ser434*
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 10923036
[PubMed]
Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."
No.
Sentence
Comment
109
h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b.
X
ABCC7 p.Ser434* 10923036:109:455
status: NEW
PMID: 10425081
[PubMed]
Mittre H et al: "A novel nonsense mutation, S434X, in exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene."
No.
Sentence
Comment
1
Corresponding Author Address and E-mail: H.MITTRE Laboratoire de Biochimie B, C.H.U. Ave G. Clemenceau., 14033 CAEN CEDEX, France E-mail : mittre-h@chu-caen.fr Title : A novel nonsense mutation, S434X, in exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene Keywords: CFTR, Cystic Fibrosis, compound heterozygote, deltaF508 Species: Human Change is: nonsense mutation Gene/Locus Name: Cystic Fibrosis Transmembrane Conductance Regulator gene.
X
ABCC7 p.Ser434* 10425081:1:195
status: NEW3 Mutation / polymorphism name Nucleotide change-Systematic name: c1433C>G Amino acid change-Trivial name: S434X.
X
ABCC7 p.Ser434* 10425081:3:105
status: NEW27 The S434X mutation was detected by direct sequencing of exon 9 after amplification with primers 5'TATACAGTGTAATGGATCATGGGCCA3' and 5'AAGAGACATGGACACCAAATTAAGTTC3' to produce a 372-bp product.
X
ABCC7 p.Ser434* 10425081:27:4
status: NEW29 This substitution is predicted to introduce a termination codon (TGA) in place of the amino acid Serine at residue 434 (S434X) of the CFTR protein.
X
ABCC7 p.Ser434* 10425081:29:120
status: NEW