ABCC7 p.His939Arg
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 21931512
[PubMed]
Polizzi A et al: "Genotype-phenotype correlation in cystic fibrosis patients bearing [H939R;H949L] allele."
No.
Sentence
Comment
3
We ascertained five patients with a novel complex CFTR allele, with two mutations, H939R and H949L, inherited in cis in the same exon of CFTR gene, and one different mutation per patient inherited in trans in a wide population of 289 Caucasian CF subjects from South Italy.
X
ABCC7 p.His939Arg 21931512:3:83
status: NEW25 The Cystic Fibrosis Mutation Database lists the H939R missense mutation, a nucleotide substitution of A to G at base pair 2948 in the same exon of the mutation H949L, corresponding to a histidine to arginine amino acid change at codon 939.
X
ABCC7 p.His939Arg 21931512:25:48
status: NEW26 The Authors also described the clinical phenothype of the patient, a 17 years old male, with the F508del/H939R genotype, mild expression of a chronic lung disease, pancreatic sufficiency, and unequivocally positive sweat chloride test result.
X
ABCC7 p.His939Arg 21931512:26:105
status: NEW27 In this study we evaluated the contribution to the phenotype of the two CF-associated allele mutations [H939R;H949L], combined in cis in the same exon 15 of CFTR gene, which we observed for the first time in 5 unrelated CF patients.
X
ABCC7 p.His939Arg 21931512:27:104
status: NEW43 During the genetic characterization of the 289 enrolled CF patients a new complex allele [H939R;H949L] (Human Genome Variation Society nomenclature c:[2816A>G;2846A>T] http://www.hgvs.org/ mutnomen) was found in five unrelated patients, in whom the two CF-associated mutations, H939R and H949L, were both carried in the exon 15 on the same allele, as showed in Figure 1.
X
ABCC7 p.His939Arg 21931512:43:90
status: NEWX
ABCC7 p.His939Arg 21931512:43:278
status: NEW45 The segregation analysis showed that the mother was the carrier of the complex allele [H939R;H949L] in four cases (patients 2, 3, 4 and 5; Table 1), while only in one case (patient 1) the father carried this complex allele (Table 1).
X
ABCC7 p.His939Arg 21931512:45:87
status: NEW46 We did not find patients bearing the H939R or the H949L mutations alone.
X
ABCC7 p.His939Arg 21931512:46:37
status: NEW47 Polizzi et al. 417 Figure 1 - Sequence electropherograms showing the complex allele [H939R;H949L] in CFTR exon 15, (A) forward and (B) reverse (Forward primer: TCAGTAAGTAACTTTGGCTGC; Reverse primer: CCTATTGATGGTGGATCAGC).
X
ABCC7 p.His939Arg 21931512:47:85
status: NEW48 Continuous arrows show the H939R mutation while the dashed arrows show the H949L mutation.
X
ABCC7 p.His939Arg 21931512:48:27
status: NEW58 To our knowledge the complex allele [H939R;H949L] and its correlation to the CF phenotype were not previously described.
X
ABCC7 p.His939Arg 21931512:58:37
status: NEW60 The other four patients were compound heterozygotes respectively for G542X, 1259insA, G1349D, F508del and the two associated mutation in exon 15 [H939R;H949L].
X
ABCC7 p.His939Arg 21931512:60:146
status: NEW65 On the other hand, the F508del mutation, a deletion of three bases encoding a phenylalanine residue at position 508 within the first nucleotide binding domain (NBD), affects CFTR maturation (class II mutations) (Rowntree and Harris, 2003), while the G1349D plays a role in ATP-dependent opening of the chloride channel, resulting in a defective CFTR activation 418 Novel complex allele in CF Table 1 - Clinical features of five unrelated patients with the complex allele [H939R;H949L].
X
ABCC7 p.His939Arg 21931512:65:472
status: NEW66 Patients characteris* Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Mutation in trans with [H939R;H949L] R248T G542X 1259insA G1349D F508del Sex male male male male male Present age (years) 15 15 17 20 25 Age at diagnosis (years) 14 3 0 10 10 Airways colonization No SA SA SA PA, BC Age of first colonization (years) / 9 6 12 14 BMI (kg/m2 ) 21.9 17.0 15.1 17.6 17.5 FEV1 as % predicted 84.4 114.8 80.9 93.2 53.7 Sweat chloride concentration (mEq/L) 78 100 108 92 95 S-K score 100 70 60 75 40 Brasfield scorez N/A 5 11 7 21 Pancreas status PS PI PI PI PI Diagnosis CFTR-RD CF CF CF CF SA = Staphilococcus aureus, PA = Pseudomonas aeruginosa, BC = Burkholderia cepacia; N/A = not applicable; S-K = Shwachman-Kulczycki: the system is based on four parameters (general activity, physical examination, growth and nutrition and chest radiograph x-ray), and is rated as a) excellent: 86-100 b) good: 71-85, c) mild: 56-70, d) moderate: 41-55, and e) severe: < 40 (Shwachman and Kulczyzki, 1958); z scoring system from 3 "mild" to 25 "most severe" (Brett et al., 1992) after x-ray; PS/PI = Pancreatic sufficiency/insufficiency.
X
ABCC7 p.His939Arg 21931512:66:96
status: NEW70 We speculate that both mutations H939R and H949L might affect the second NBD of CFTR and have a role in altering the conductance of the chloride channel, but to our knowledge there are no reports on their functions.
X
ABCC7 p.His939Arg 21931512:70:33
status: NEW71 In our study, the four patients carrying the complex allele [H939R;H949L] associated in trans with the severe mutations G542X, 1259insA, G1349D and F508del presented the classic CF phenotype.
X
ABCC7 p.His939Arg 21931512:71:61
status: NEW74 It seems that the complex allele [H939R;H949L] greatly reduces the residual function of CFTR and, when also on the other allele is present a severe mutation which produces a very low residual function, the combined effect is an overall great reduction of CFTR functionality; on the contrary, when the other allele carries a mild mutation, the overall effect is a cumulative greater CFTR functionality.
X
ABCC7 p.His939Arg 21931512:74:34
status: NEW77 The complex alleles and their role in disease pathogenesis still remain a challenge for both researchers and clinicians, thus more information on our newly discovered complex allele [H939R;H949L] or on the H939R and the H949L mutations alone would help to study the effect on the phenotype of these rare mutations.
X
ABCC7 p.His939Arg 21931512:77:183
status: NEWX
ABCC7 p.His939Arg 21931512:77:206
status: NEW
PMID: 10923036
[PubMed]
Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."
No.
Sentence
Comment
109
h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b.
X
ABCC7 p.His939Arg 10923036:109:877
status: NEW152 Twenty-four non F508del mutations were found associated with the 9T allele: 394delTT, L90S, D110H, R117G, 621+1G>T, V232D, A455E, G542X, R851L, T908N, 2789+5G>A, 2896insAG, H939R, 3007delG, I980K, I1027T, R1066H, A1067T, D1154G, 3737delA, R74W+D1270N, N1303I, N1303K, D1377H.
X
ABCC7 p.His939Arg 10923036:152:173
status: NEW