ABCMdb

ABCD3 p.Lys479Ala

Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Characterization of the 70-kDa peroxisomal membran... J Biol Chem. 1999 Apr 23;274(17):11968-76. Imanaka T, Aihara K, Takano T, Yamashita A, Sato R, Suzuki Y, Yokota S, Osumi T
Characterization of the 70-kDa peroxisomal membrane protein, an ATP binding cassette transporter.
J Biol Chem. 1999 Apr 23;274(17):11968-76., [PMID:10207018]

Abstract [show]
The 70-kDa peroxisomal membrane protein (PMP70) is one of the major components of rat liver peroxisomal membranes and belongs to a superfamily of proteins known as ATP binding cassette transporters. PMP70 is markedly induced by administration of hypolipidemic agents in parallel with peroxisome proliferation and induction of peroxisomal fatty acid beta-oxidation enzymes. To characterize the role of PMP70 in biogenesis and function of peroxisomes, we transfected the cDNA of rat PMP70 into Chinese hamster ovary cells and established cell lines stably expressing PMP70. The content of PMP70 in the transfectants increased about 5-fold when compared with the control cells. A subcellular fractionation study showed that overexpressed PMP70 was enriched in peroxisomes. This peroxisomal localization was confirmed by immunofluorescence and immunoelectron microscopy. The number of immuno-gold particles corresponding to PMP70 on peroxisomes increased markedly in the transfectants, but the size and the number of peroxisomes were essentially the same in both the transfectants and the control cells. beta-Oxidation of palmitic acid increased about 2-3-fold in the transfectants, whereas the oxidation of lignoceric acid decreased about 30-40%. When intact peroxisomes prepared from both the cell lines were incubated with palmitoyl-CoA, oxidation was stimulated with ATP, but the degree of the stimulation was higher in the transfectants than in the control cells. Furthermore, we established three Chinese hamster ovary cell lines stably expressing mutant PMP70. In these cells, beta-oxidation of palmitic acid decreased markedly. These results suggest that PMP70 is involved in metabolic transport of long chain acyl-CoA across peroxisomal membranes and that increase of PMP70 is not associated with proliferation of peroxisomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Another version containing a mutation in Walker A motif, designated as PMP70 (K479A), was constructed with QuikChangeTM site-directed mutagenesis kit (Stratagene) using pME18S/PMP70 as a template. Two oligonucleotides with substitution sites and a new restriction site of 1468 NarI, 5Ј-1445 CATTT- GTGGTCCAAATGGCTGTGGCGCCAGCTCCCTCTTC1484 -3Ј and 5Ј- 1484 GAAGAGGGAGCTGGCGCCACAGCCATTTGGACCACAAATG- 1445 -3Ј were used. Login to comment
173 In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B). Login to comment
174 In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B). Login to comment