ABCMdb

PMID: 10207018

Imanaka T, Aihara K, Takano T, Yamashita A, Sato R, Suzuki Y, Yokota S, Osumi T
Characterization of the 70-kDa peroxisomal membrane protein, an ATP binding cassette transporter.
J Biol Chem. 1999 Apr 23;274(17):11968-76., [PubMed]

Sentences

No. Mutations Sentence Comment

51 ABCD3 p.Glu277Asp ABCD3 p.Glu278Asp Construction of Mutant cDNAs-A mutant version of PMP70 containing mutations in EAA-like motif, designated as PMP70 (E277D/ E278D), was constructed by asymmetric PCR using pME18S/PMP70 as a template. Two oligonucleotides (the site of substitution is underlined), with 5Ј-660 AAGCCATTTTTAGACATAGTTTTGTA685 -3Ј and 5Ј-875 GG- CAATTTCTTCACTATTAGTAGTAAGCCG846 -3Ј were used in the first step, and a 220-bp fragment was generated by PCR. Login to comment 53 ABCD3 p.Glu277Asp ABCD3 p.Glu278Asp The fragment containing the mutations of E277D and E278D was ligated into the HpaI-KpnI sites of pME18S/PMP70. Login to comment 54 ABCD3 p.Lys479Ala Another version containing a mutation in Walker A motif, designated as PMP70 (K479A), was constructed with QuikChangeTM site-directed mutagenesis kit (Stratagene) using pME18S/PMP70 as a template. Two oligonucleotides with substitution sites and a new restriction site of 1468 NarI, 5Ј-1445 CATTT- GTGGTCCAAATGGCTGTGGCGCCAGCTCCCTCTTC1484 -3Ј and 5Ј- 1484 GAAGAGGGAGCTGGCGCCACAGCCATTTGGACCACAAATG- 1445 -3Ј were used. Login to comment 164 ABCD3 p.Glu277Asp ABCD3 p.Glu278Asp We chose to mutate the two glutamic acids (Glu277 and Glu278 ) in the EAA-like motif of PMP70 to aspartic acids (E277D/E278D), because aspartic acid resulting from a change of the corresponding glutamic acids (Glu291 ) in ALDP is known to be the site of mutation causing FIG. 5. Login to comment 165 ABCD3 p.Glu277Asp ABCD3 p.Glu278Asp We chose to mutate the two glutamic acids (Glu277 and Glu278 ) in the EAA-like motif of PMP70 to aspartic acids (E277D/E278D), because aspartic acid resulting from a change of the corresponding glutamic acids (Glu291 ) in ALDP is known to be the site of mutation causing FIG. 5. Login to comment 173 ABCD3 p.Glu277Asp ABCD3 p.Glu278Asp ABCD3 p.Lys479Ala In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B). Login to comment 174 ABCD3 p.Glu277Asp ABCD3 p.Glu278Asp ABCD3 p.Lys479Ala In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B). Login to comment