ABCD3 p.Lys479Ala
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 10207018
[PubMed]
Imanaka T et al: "Characterization of the 70-kDa peroxisomal membrane protein, an ATP binding cassette transporter."
No.
Sentence
Comment
54
Another version containing a mutation in Walker A motif, designated as PMP70 (K479A), was constructed with QuikChangeTM site-directed mutagenesis kit (Stratagene) using pME18S/PMP70 as a template. Two oligonucleotides with substitution sites and a new restriction site of 1468 NarI, 5Ј-1445 CATTT- GTGGTCCAAATGGCTGTGGCGCCAGCTCCCTCTTC1484 -3Ј and 5Ј- 1484 GAAGAGGGAGCTGGCGCCACAGCCATTTGGACCACAAATG- 1445 -3Ј were used.
X
ABCD3 p.Lys479Ala 10207018:54:78
status: NEW173 In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B).
X
ABCD3 p.Lys479Ala 10207018:173:51
status: NEW174 In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B).
X
ABCD3 p.Lys479Ala 10207018:174:51
status: NEW