ABCMdb

ABCC2 p.Lys677Arg

None has been submitted yet.

Publications

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."

No. Sentence Comment

35 An artificial mutation, Lys677Arg (2030A>G), introduced into the Walker A motif of nucleotide-binding domain (NBD) 1, which has not been found in DJS patients, also resulted in deficient maturation and impaired sorting. Login to comment

PMID: 12884082 [PubMed] Wakusawa S et al: "Identification of a novel 2026G-->C mutation of the MRP2 gene in a Japanese patient with Dubin-Johnson syndrome."

No. Sentence Comment

62 Hashimoto et al. (2002) have reported that the artificial mutation K677R of the MRP2 gene and the missense mutation R768 W cause deficient maturation and impaired sorting. Login to comment

PMID: 12395335 [PubMed] Hashimoto K et al: "Trafficking and functional defects by mutations of the ATP-binding domains in MRP2 in patients with Dubin-Johnson syndrome."

No. Sentence Comment

28 The mutants R768W, Q1382R, and K677R were generated from pBS-MRP2.20 To generate these mutant MRPs, site-directed mutagenesis was carried out using a PCR-based method.21 The following primers were used to generate specific mutations: for R768W, the 5Ј-oligonucleotides MRP2-2,302 (5Ј-CAGAAGCAGCGGAT- CAGC; corresponding to the native MRP2 sequence) and R768W-MRP2 (5Ј- CAGAAGCAGTGGAT- CAGCCTG); for Q1382R, the 5Ј-oligonucleotides MRP2-4,555 (5Ј-CATCCCCCAGGACCCCATC; corresponding to the native MRP2 sequence) and Q1382R- MRP2 (5Ј- CATCCCCCGGGACCCCATC); and, for K677R, the 5Ј-oligonucleotides MRP2-2,030 (5Ј- GGCTCTGGGAAATCCTCCTTG; corresponding to the native MRP2 sequence) and K677R-MRP2 (5Ј- GGCTCTGGGAGATCCTCCTTG). Login to comment
39 In brief, 20, 20, 200, and 200 ␮g total protein from LLC-PK1 cells expressing the wild-type, Q1382R, K677R, and R768W MRP2 were treated with 1,000 units of each enzyme for 1 hour at 37°C, respectively. Login to comment
69 The Walker A lysine mutation K677R is also shown. Login to comment
80 Another artificial mutation, 2,030 (A3G) K677R, was also introduced into the Walker A motif of NBD1. Login to comment
81 LLC-PK1 and HEK293 cell lines that stably express the wild-type MRP2 or each mutant MRP2 (R768W, Q1382R, and K677R) were established. Login to comment
86 On the other hand, the R768W and K677R MRP2 were detected as 175-kd weak bands (designated as P) by both antibodies (Fig. 3A and B). Login to comment
87 These results suggested that the R768W and K677R MRP2 did not mature properly and that their expression levels were low. Login to comment
92 The deglycosylated form of MRP2 was also produced from the 175-kd K677R and R768W MRP2 (band P) by the treatment with Endo H, indicating that they did not contain complex oligosaccharides and might be located in the endoplasmic reticulum (ER) or the cis-Golgi complex. Login to comment
95 LLC-PK1 cells stably expressing the wild-type human MRP2 and the mutant MRP (Q1382R, R768W, or K677R) were solubilized and analyzed by Western blot analysis with monoclonal antibodies M2I-4 (A) and M2III-6 (B). Login to comment
98 The cell lysates from LLC-PK1 cells expressing the wild-type and Q1382R MRP2 (20 ␮g) or from cells expressing the R768W and K677R MRP2 (200 ␮g) were treated with Endo H or PNGaseF and analyzed by Western blot analysis with monoclonal antibodies M2I-4. Login to comment
106 In contrast, the 175-kd form (band P) of R768W and K677R MRP2 was scarcely converted to the 190-kd form (band M) and was degraded with a half-life of approximately 60 minutes. Login to comment
114 Consistent with our previous report,20 the wild-type MRP2 predominantly localized to the cell surface, especially to the apical membrane (Fig. 6A), but the R768W and K677R MRP2 localized in the cytoplasm, with ER-like distribution (Fig. 6A), consistent with the immature glycosylation of these mutants. Login to comment
131 In stable HEK293 transfectants, as in stable LLC-PK1 transfectants (Fig. 3A), the Q1382R mutation did not affect the expression and maturation of MRP2, whereas the R768W and K677R MRP2 did not mature properly, and their expression levels were low (Fig. 7A). Login to comment
133 GS-MCLB efflux from HEK293 cells expressing the R768W and K677R MRP2 was as low as that from control cells, consistent with their low expression of these proteins on the plasma membrane. Login to comment
152 (A) LLC-PK1 cells expressing the wild-type, R768W, and K677R MRP2 were stained with the MRP2 antibody M2III-6. Login to comment
163 The symbols shown are as follows: wild type (F), empty vector (Œ), R768W (ϫ), K677R (ϩ), Q1382R (I). Login to comment
176 We introduced 2 DJS-associated MRP2 mutations, R768W and Q1382R, and an artificial mutation, K677R, to the Walker A motif (Fig. 1). Login to comment
178 A confocal microscopic analysis revealed that MRP2 with the missense mutation R768W, in the signature C motif of NBD1, and K677R, in the Walker A motif of NBD1, were localized in the cytoplasm with an ER-like distribution, whereas the wild-type MRP2 was predominantly localized on the apical membrane (Fig. 6A). Login to comment
180 R768W and K677R transfectants produced precursor forms of MRP2 protein that were sensitive to Endo H (Fig. 3C) and rapidly degraded with a half-life of less than 60 minutes (Fig. 4). Login to comment
208 In conclusion, introduction of a DJS mutation R768W as well as the Walker A lysine mutation K677R resulted in abortive maturation and sorting of MRP2, whereas another DJS mutation, Q1382R, did not affect maturation or sorting but impaired the substrate-induced ATP hydrolysis. Login to comment