ABCMdb

ABCG2 p.Gln126*

ClinVar:

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Pharmacogenomics of the human ABC transporter ABCG... Naturwissenschaften. 2005 Oct;92(10):451-63. Ishikawa T, Tamura A, Saito H, Wakabayashi K, Nakagawa H
Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design.
Naturwissenschaften. 2005 Oct;92(10):451-63., [PMID:16160819]

Abstract [show]
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 The variant Q126stop (c.376C>T) was consistently observed in certain Japanese cohorts; however, it was absent in Caucasian and African American groups (Imai et al. 2002; Itoda et al. 2003; Kobayashi et al. 2005). Login to comment
118 For this purpose, we have created variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) by site-directed mutagenesis. Login to comment
132 No MTX-transport activity was observed in the Q126stop and E334stop variants, as well as in acquired mutation variants (R482G and R482T). Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
213 Some of the above sequence variations showed an allele frequency of ~ 1% in distinct populations, Q126stop and F489L in the Japanese and N590Y in the Caucasian population [129-131,134,135], whereas most of the mutations were only detected in single individuals (e.g., I206L, F431L, S441N, D620N). Login to comment
238 The variant Q126stop (c.376C > T) was consistently observed in certain Japanese cohorts; however, it was absent in two different Caucasian and African-American groups [129,134,135]. Login to comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment
255 For this purpose, variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G and R482T) were created by site-directed mutagenesis (Figure 3). Login to comment
269 No MTX-transport activity was observed in the Q126stop and E334stop variants, as well as in acquired mutation variants (R482G and R482T). Login to comment

[hide] Functional SNPs of the breast cancer resistance pr... Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21. Yanase K, Tsukahara S, Mitsuhashi J, Sugimoto Y
Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development.
Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21., 2006-03-08 [PMID:16303243]

Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that pumps out various anticancer agents such as 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). C421A BCRP-transfected murine fibroblast PA317 cells showed markedly decreased protein expression and low-level drug resistance when compared with wild-type BCRP-transfected cells. In contrast, G34A BCRP-transfected PA317 cells showed a similar protein expression and drug resistance profile to wild-type. The C376T polymorphism would be expected to have a considerable impact as active BCRP protein will not be expressed from a T376 allele. Hence, people with C376T and/or C421A polymorphisms may express low levels of BCRP, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. Estrogens, estrone and 17beta-estradiol, were previously found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of anticancer agents. BCRP transports sulfated estrogens but not free estrogens and in a series of screening experiments for synthesized and natural estrogenic compounds, several tamoxifen derivatives and phytoestrogens/flavonoids were identified that effectively circumvent BCRP-mediated drug resistance. The kinase inhibitors gefitinib and imatinib mesylate also interact with BCRP. Gefitinib, an inhibitor of epidermal growth factor receptor-tyrosine kinase, inhibits its transporter function and reverses BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transfected human epidermoid carcinoma A431 cells and BCRP-transfected human non-small cell lung cancer PC-9 cells show gefitinib resistance. Imatinib, an inhibitor of BCR-ABL tyrosine kinase, also inhibits BCRP-mediated drug transport. Hence, both functional SNPs and inhibitors of BCRP reduce its transporter function and thus modulate substrate pharmacokinetics and pharmacodynamics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 C376T (Q126stop)-BCRP SNP Another of the BCRP gene SNPs, C376T, substitutes a stop codon for Gln-126 (Q126stop), and was found in 3/124 of our general Japanese samples as a heterozygosity [23]. Login to comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]

Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
115 For this purpose, variant forms (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) have been created by site‐ directed mutagenesis with the QuikChange site‐directed mutagensis kit (Stratagene, La Jolla, CA). Login to comment
125 No MTX transport activity was observed in the variants Q126stop, E334stop, R482G, and R482T. Login to comment
233 Figure 13 shows the result of SNP array detection where nonsynonymous polymorphisms of ABCG2, that is, Q126stop and Q141K, were analyzed. Login to comment
249 Detection of nonsynonymous polymorphisms (Q126stop and Q141K) of ABCG2 with the SNP array. Login to comment

[hide] Functional validation of the genetic polymorphisms... Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11. Tamura A, Watanabe M, Saito H, Nakagawa H, Kamachi T, Okura I, Ishikawa T
Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport.
Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11., [PMID:16608919]

Abstract [show]
The ATP-binding cassette (ABC) transporter ABCG2 has been implicated to play a significant role in the response of patients to medication and/or the risk of diseases. To clarify the possible physiological or pathological relevance of ABCG2 polymorphisms, we have functionally validated single nucleotide polymorphisms (SNP) of ABCG2. In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Because porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the porphyrin transport activity of those variant forms in vitro. We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Furthermore, Flp-In-293 cells expressing those variants were photosensitive. Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
4 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Login to comment
6 Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria. Login to comment
36 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins, suggesting that those genetic polymorphisms in the ABCG2 gene may be related to the risk of certain diseases resulting from disruption of porphyrin homeostasis. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
148 For Q126stop and E334stop, however, that treatment created truncated proteins (Fig. 4A). Login to comment
164 It is important to note that the variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both hematoporphyrin and methotrexate. Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
215 We provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Fig. 5). Login to comment
219 The frequencies of the Q126stop, S441N, and F489L alleles are relatively low (less than 2%) compared with those of the V12M and Q141K alleles. Login to comment
220 The variant Q126stop was consistently observed in certain Japanese cohorts; however, it was absent in two different Caucasian and African-American groups (Imai et al., 2002; Itoda et al., 2003; Mizuarai et al., 2004; Kobayashi et al., 2005; for a recent review, see Ishikawa et al., 2005) for recent review. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
240 Therefore, at least, the validated alleles such as Q126stop, S441N, and F489L with a loss of porphyrin transport activity are at potential risk of diseases. Login to comment

[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
917 0.005 Exon 4 c. 376 C>T Q126stop 0.01 Lack of function 0.00a 0.00b Exon 5 c. 421 C>A Q141K 0.35 Reduced activity (Mizuarai et al., 2004; Kobayashi et al., 2005; Sparreboom et al., 2005) 0.11a 0.02b IVS 5-16 A>G ? Login to comment

[hide] Human ABC transporter ABCG2 in xenobiotic protecti... Drug Metab Rev. 2006;38(3):371-91. Wakabayashi K, Tamura A, Saito H, Onishi Y, Ishikawa T
Human ABC transporter ABCG2 in xenobiotic protection and redox biology.
Drug Metab Rev. 2006;38(3):371-91., [PMID:16877258]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is regarded as a member of the phase III system of xenobiotic metabolism. This efflux pump is suggested to be responsible for protecting the body from toxic xenobiotics and for removing toxic metabolites. The aim of this review article is to address new aspects of ABCG2 related to redox biology, namely the posttranslational modification (intra- and intermolecular disulfide bond formation) of ABCG2 protein and the transport of porphyrin and chlorophyll metabolites, as well as the high-speed screening and QSAR analysis method to evaluate ABCG2-drug interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment
177 The variants Q126stop, F208S, S248P, E334stop, and S441N were found to be defective in the transport of hematoporphyrin (Tamura et al., 2006) (Table 2). Login to comment

[hide] Involvement of breast cancer resistance protein (B... Drug Metab Dispos. 2007 Feb;35(2):209-14. Epub 2006 Nov 8. Enokizono J, Kusuhara H, Sugiyama Y
Involvement of breast cancer resistance protein (BCRP/ABCG2) in the biliary excretion and intestinal efflux of troglitazone sulfate, the major metabolite of troglitazone with a cholestatic effect.
Drug Metab Dispos. 2007 Feb;35(2):209-14. Epub 2006 Nov 8., [PMID:17093005]

Abstract [show]
Troglitazone sulfate (TGZS) is the major metabolite of troglitazone (TGZ), an antidiabetic agent, and thought to be a cause of the cholestasis induced by TGZ. The aim of the present study is to elucidate the involvement of breast cancer resistance protein (BCRP/ABCG2) in the hepatic disposition of TGZS. The basal-to-apical transport of TGZS was enhanced in organic anion transporting polypeptide 1B1-expressing Madin-Darby canine kidney II cells by infection of recombinant adenovirus harboring human BCRP and mouse Bcrp cDNA. TGZS was given to wild-type and Bcrp (-/-) mice by constant infusion. Biliary excretion is the predominant elimination pathway of TGZS in wild-type mice, and the biliary excretion clearance of TGZS with regard to the hepatic concentration was reduced to 30% of the control in Bcrp (-/-) mice. However, plasma and hepatic concentrations were unchanged, suggesting induction of compensatory mechanisms in Bcrp (-/-) mice for the elimination of TGZS. Involvement of BCRP in the intestinal efflux transport of TGZS was examined using everted sacs. The mucosal efflux clearance of TGZS showed only a slight reduction (15% reduction) in Bcrp (-/-) mice. Our results suggest that BCRP plays a major role in the biliary excretion but a minor role in the intestinal transport of TGZS.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
192 BCRP has some functional single nucleotide polymorphisms (SNP), such as C376T (Q126stop), C421A (Q141K), and G1322A (S441N). Login to comment

[hide] Pharmacogenetics/genomics of membrane transporters... Cancer Metastasis Rev. 2007 Mar;26(1):183-201. Huang Y
Pharmacogenetics/genomics of membrane transporters in cancer chemotherapy.
Cancer Metastasis Rev. 2007 Mar;26(1):183-201., [PMID:17323126]

Abstract [show]
Inter-individual variability in drug response and the emergence of adverse drug reactions are main causes of treatment failure in cancer therapy. Recently, membrane transporters have been recognized as an important determinant of drug disposition, thereby affecting chemosensitivity and -resistance. Genetic factors contribute to inter-individual variability in drug transport and targeting. Therefore, pharmacogenetic studies of membrane transporters can lead to new approaches for optimizing cancer therapy. This review discusses genetic variations in efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (MDR1, P-glycoprotein), ABCC1 (MRP1), ABCC2 (MRP2) and ABCG2 (BCRP), and uptake transporters of the solute carrier (SLC) family such as SLC19A1 (RFC1) and SLCO1B1 (SLC21A6), and their relevance to cancer chemotherapy. Furthermore, a pharmacogenomic approach is outlined, which using correlations between the growth inhibitory potency of anticancer drugs and transporter gene expression in multiple human cancer cell lines, has shown promise for determining the relevant transporters for any given drugs and predicting anticancer drug response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
124 Moreover, Letourneau et al. examined 10 non-synonymous ABCC1 SNPs to determine Table 2 Summary of genetic variants in ABC transporters ABCB1, ABCC1, ABCC2 and ABCG2 involved in cancer chemotherapy Variants (location, effect) Phenotype Drug Sample Reference ABCB1 +103T>C (5'flanking, non-coding) Increased transcription Doxorubicin vincristine osteosarcoma Stein et al., 1994 [19] +8T>C (5'flanking, non-coding) Unknown Leukemia Rund et al., 1999 [21] 1236C>T (exon12, synonymous) Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Higher exposure Irinotecan, SN-38 Cancer patients Mathijssen et al., 2003 [45] 2677G>T/A (exon21, A893S/T) Lower expression placenta Tanabe et al., 2001 [42] Lower expression placenta Hitzl et al., 2004 [37] Higher expression AML blasts Illmer et al., 2002 [47] Allele specific expression Cell lines, lymphoma Mickley et al., 1998 [22] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Survival leukemia Illmer et al., 2002 [47] Survival leukemia van den Heuvel-Eibrink et al., 2001 [48] Worse survival AML blasts Kim et al., 2006 [10] Higher efficacy Paclitaxel Ovarian cancer Green et al., 2006 [50] 2995G>A (exon24, A999T) None Cell lines, lymphoma Mickley et al., 1998 [22] 3435C>T (exon26, synonymous) Lower expression Duodenal protein Hoffmeyer et al., 2000 [26] Lower expression placenta Hitzl et al., 2004 [37] Higher expression Intestine mRNA Nakamura et al., 2002 [32] Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Lower efflux Digoxin CD56+ NK cells Hitzl et al., 2001 [27] Higher plasma level Digoxin Healthy volunteers Hoffmeyer et al., 2000 [26] Higher AUC Cyclosporin transplant patients Bonhomme-Faivre et al., 2004 [36] Lower CNS relapse Cancer patients Stanulla et al., 2005 [46] Better survival leukemia Illmer et al., 2002 [47] Higher efficacy Breast cancer Kafka et al., 2003 [49] Higher activity, worse survival AML Kim et al., 2006 [10] Better survival Platinums Esophageal cancer Wu et al., 2006 [43] No difference Docetaxel patients Puisset et al., 2004 [41] No difference Irinotecan Cancer patients Mathijssen et al., 2004 [39] No difference Vincristine patients Plasschaert et al., 2004 [40] No difference colon Taniguchi et al., 2003 [24] ABCC1 -260G>C (5'flanking, non-coding) Higher activity Transfected cell line Wang et al., 2005 [62] Table 2 (Continued) Variants (location, effect) Phenotype Drug Sample Reference 128G>C (exon2, C43S) Reduced resistance Vincristine, arsenite Transfected cell line Leslie et al., 2003 [60] 1299G>T (exon10, R433S) Reduced transport of LTC4, increased resistance to doxorubicin Leukotriene C4, doxorubicin Transfected cell line Conrad et al., 2002 [59] 2012G>T (exon16, G671V) No change in activityLeukotriene C4 Transfected cell line Conrad et al., 2001 [58] Heart toxicity Doxorubicin nLon-Hodgkin lymphoma Wojnowski et al., 2005 [63] 2965G>A (exon22, A989T) Reduced transport Estradiol 17β-glucuronide Transfected cell line Letourneau et al., 2005 [61] ABCC2 1271A>G (exon10, R421G) Reduced drug elimination, increased nephrotoxicity Methotrexate One lymphoma patient Hulot et al., 2005 [79] 3972C>T (exon28, nonsynonymous) Reduced drug clearance Irinotecan Cancer patients Innocenti et al., 2004 [80] ABCG2 376C>T (exon4, Q126stop) Reduced transport Porphyrin Trensfected cell Tamura et al., 2006 [104] 421C>A (exon5, Q141K) Lower expression Transfected cell lines Imai et al., 2002 [94] Lower expression Transfected cell lines Kondo et al., 2004 [95] Lower expression Placenta Kobayashi et al., 2005 [98] Reduced ATPase activity Trensfected cell lines Mizuarai et al., 2004 [97] Higher plasma levels Diflomotecan patients Sparreboom et al., 2004 [100] Increased bioavailability Topotecan patients Sparreboom et al., 2005 [101] Increased bioavailability 9-Aminocamptothecin patients Zamboni et al., 2006 [81] Increased drug accumulation Imatinib Transfected cell lines Gardner et al., 2006 [96] Increased drug accumulation Topotecan Trensfected cell lines Imai et al., 2002 [94] No difference Imatinib patients Gardner et al., 2006 [96] No difference intestine Zamber et al., 2003 [99] No difference MTX Trensfected cell lines Kondo et al., 2004 [95] the effects on expression and function of this transporter in transfected HEK293T cells [61]. Login to comment
187 Another polymorphism, 376C>T, substitutes a stop codon for Gln (Q126stop) and causes the absence of active ABCG2 protein from the T allele [95, 99]. Login to comment
189 It was recently demonstrated that in vitro the Q126stop protein was defective in porphyrin transport [104]. Login to comment

[hide] ABC multidrug transporters: structure, function an... Pharmacogenomics. 2008 Jan;9(1):105-27. Sharom FJ
ABC multidrug transporters: structure, function and role in chemoresistance.
Pharmacogenomics. 2008 Jan;9(1):105-27., [PMID:18154452]

Abstract [show]
Three ATP-binding cassette (ABC)-superfamily multidrug efflux pumps are known to be responsible for chemoresistance; P-glycoprotein (ABCB1), MRP1 (ABCC1) and ABCG2 (BCRP). These transporters play an important role in normal physiology by protecting tissues from toxic xenobiotics and endogenous metabolites. Hydrophobic amphipathic compounds, including many clinically used drugs, interact with the substrate-binding pocket of these proteins via flexible hydrophobic and H-bonding interactions. These efflux pumps are expressed in many human tumors, where they likely contribute to resistance to chemotherapy treatment. However, the use of efflux-pump modulators in clinical cancer treatment has proved disappointing. Single nucleotide polymorphisms in ABC drug-efflux pumps may play a role in responses to drug therapy and disease susceptibility. The effect of various genotypes and haplotypes on the expression and function of these proteins is not yet clear, and their true impact remains controversial.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
355 Over 80 SNPs, missense, nonsense and frameshift mutations in the ABCG2 gene have been identified in different ethnic groups [23,170], including V12M (N-terminal cytosolic region), Q141K (NBD) and Q126stop (in which no active protein is produced). Login to comment
368 A recent study characterized the activity of 18 ABCG2 variants, and concluded that Q126stop, F208S, S248P, E334stop, S441N and F489L are defective in hematoporphyrin transport [170], which may increase the risk of disease in individuals carrying these polymorphisms. Login to comment

[hide] In vitro evaluation of photosensitivity risk relat... Drug Metab Pharmacokinet. 2007 Dec;22(6):428-40. Tamura A, Onishi Y, An R, Koshiba S, Wakabayashi K, Hoshijima K, Priebe W, Yoshida T, Kometani S, Matsubara T, Mikuriya K, Ishikawa T
In vitro evaluation of photosensitivity risk related to genetic polymorphisms of human ABC transporter ABCG2 and inhibition by drugs.
Drug Metab Pharmacokinet. 2007 Dec;22(6):428-40., [PMID:18159130]

Abstract [show]
Since porphyrins are regarded as endogenous substrates for the ATP-binding cassette (ABC) transporter ABCG2, it is hypothesized that functional impairment owing to genetic polymorphisms or inhibition of ABCG2 by drugs may result in a disruption of cellular porphyrin homeostasis. In the present study, we expressed ABCG2 genetic variants, i.e., V12M, Q141K, S441N, and F489L, as well as the wild type (WT) in Flp-In-293 cells to examine the hypothesis. Cells expressing S441N and F489L variants exhibited high levels of both cellularly accumulated pheophorbide a and photosensitivity, when those cells were incubated with pheophorbide a and irradiated with visible light. To further elucidate the significance of ABCG2 in cellular porphyrin homeostasis, we observed cellular accumulation and compartmentation of porphyrin and pheophorbide a by means of a new fluorescence microscopy technology, and found that accumulation of porphyrin and pheophorbide a in the cytoplasm compartment was maintained at low levels in Flp-In-293 cells expressing ABCG2 WT, V12M, or Q141K. When ABCG2 was inhibited by imatinib or novobiocin, however, those cells became sensitive to light. Based on these results, it is strongly suggested that certain genetic polymorphisms and/or inhibition of ABCG2 by drugs can enhance the potential risk of photosensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 By using plasma membrane vesicles and a high-speed screening system, we precisely evaluated functional changes associated with genetic polymorphisms in vitro.24) Since porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the transport of porphyrins with a total of 18 variant forms of human ABCG2 in the plasma membrane vesicle system.4) As a result, we found that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins. Login to comment
199 Indeed, we reported that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin.4) The F489L variant showed impaired transport activity. Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of non-... Biochem J. 2008 May 1;411(3):623-31. Nakagawa H, Tamura A, Wakabayashi K, Hoshijima K, Komada M, Yoshida T, Kometani S, Matsubara T, Mikuriya K, Ishikawa T
Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2.
Biochem J. 2008 May 1;411(3):623-31., 2008-05-01 [PMID:18237272]

Abstract [show]
Clinical relevance is implicated between the genetic polymorphisms of the ABC (ATP-binding cassette) transporter ABCG2 (ABC subfamily G, member 2) and the individual differences in drug response. We expressed a total of seven non-synonymous SNP (single nucleotide polymorphism) variants in Flp-In-293 cells by using the Flp (flippase) recombinase system. Of these, ABCG2 F208S and S441N variants were found to be expressed at markedly low levels, whereas their mRNA levels were equal to those of the other SNP variants and ABCG2 WT (wild-type). Interestingly, protein expression levels of the ABCG2 F208S and S441N variants increased 6- to 12-fold when Flp-In-293 cells were treated with MG132, a proteasome inhibitor. Immunoprecipitation followed by immunoblot analysis showed that the ABCG2 F208S and S441N variant proteins were endogenously ubiquitinated in Flp-In-293 cells, and treatment with MG132 significantly enhanced the level of these ubiquitinated variants. Immunofluorescence microscopy demonstrated that MG132 greatly affected the ABCG2 F208S and S441N variants in terms of both protein levels and intracellular distribution. Immunoblot analysis revealed that those variants were N-glycosylated; however, their oligosaccharides were immature compared with those present on ABCG2 WT. The ABCG2 F208S and S441N variant proteins do not appear to be processed in the Golgi apparatus, but undergo ubiquitin-mediated protein degradation in proteasomes, whereas ABCG2 WT is sorted to the plasma membrane and then degraded via the lysosomal pathway. The present study provides the first evidence that certain genetic polymorphisms can affect the protein stability of ABCG2. Control of proteasomal degradation of ABCG2 would provide a novel approach in cancer chemotherapy to circumvent multidrug resistance of human cancers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 The ABCG2 non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N and F489L were defective in the active transport of methotrexate and haematoporphyrin [18]. Login to comment

[hide] Homology modeling of breast cancer resistance prot... J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15. Hazai E, Bikadi Z
Homology modeling of breast cancer resistance protein (ABCG2).
J Struct Biol. 2008 Apr;162(1):63-74. Epub 2007 Dec 15., [PMID:18249138]

Abstract [show]
BCRP (also known as ABCG2, MXR, and ABC-P) is a member of the ABC family that transports a wide variety of substrates. BCRP is known to play a key role as a xenobiotic transporter. Since discovering its role in multidrug resistance, considerable efforts have been made in order to gain deeper understanding of BCRP structure and function. The recent study was aimed at predicting BCRP structure by creating a homology model. Based on sequence similarity with known structures of full-length, NB and TM domain of ABC transporters, TM, NB, and linker regions of BCRP were defined. The NB domain of BCRP was modeled using MalK as a template. Based on secondary structure prediction of BCRP and comparison of the transmembrane connecting regions of known structures of ABC transporters, the TM domain arrangement of BCRP was established and was found to resemble to that of the recently published crystal structure of Sav1866. Thus, an initial alignment of TM domain of BCRP was established using Sav1866 as a template. This alignment was subsequently refined using constrains derived from secondary structure and TM predictions and the final model was built. Finally, the complete homodimer ABCG2 model was generated using Sav1866 as template. Furthermore, known ligands of BCRP were docked to our model in order to define possible binding sites. The results of molecular dockings of known BCRP substrates to the BCRP model were in agreement with recently published experimental data indicating multiple binding sites in BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

[hide] Drug-induced phototoxicity evoked by inhibition of... Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72. Tamura A, An R, Hagiya Y, Hoshijima K, Yoshida T, Mikuriya K, Ishikawa T
Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems.
Expert Opin Drug Metab Toxicol. 2008 Mar;4(3):255-72., [PMID:18363541]

Abstract [show]
BACKGROUND: Photosensitivity depends on both genetic and environmental factors. Pheophorbide a, present in various plant-derived foods and food supplements, can be absorbed by the small intestine. Accumulation of pheophorbide a and porphyrins in the systemic blood circulation can result in phototoxic lesions on light-exposed skin. OBJECTIVE: As the human ATP-binding cassette (ABC) transporter ABCG2 has been suggested to be critically involved in porphyrin-mediated photosensitivity, we aimed to develop in vitro screening systems for drug-induced phototoxicity. CONCLUSION: Functional impairment owing to inhibition of ABCG2 by drugs or its genetic polymorphisms can lead to the disruption of porphyrin homeostasis. This review article provides an overview on drug-induced photosensitivity, as well as our hypothesis on a potential role of ABCG2 in phototoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
246 The variants Q126stop, F208S, S248P, E334stop, and S441N were defective in the transport of hematoporphyrin (Figure 9). Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

[hide] Human ABC transporters ABCG2 (BCRP) and ABCG4. Xenobiotica. 2008 Jul;38(7-8):863-88. Koshiba S, An R, Saito H, Wakabayashi K, Tamura A, Ishikawa T
Human ABC transporters ABCG2 (BCRP) and ABCG4.
Xenobiotica. 2008 Jul;38(7-8):863-88., [PMID:18668433]

Abstract [show]
1. The human ABC transporter ABCG2 is regarded as a member of the phase III system for xenobiotic metabolism, and it has been suggested that this efflux pump is responsible for protecting the body from toxic xenobiotics and for removing metabolites. 2. This review paper will address the new aspects of ABCG2 in terms of post-translational modifications (i.e., disulfide bond formation, ubiquitination, and endoplasmic reticulum-associated degradation) of ABCG2 protein, high-speed screening, and quantitative structure-activity relationship (QSAR) analysis to evaluate ABCG2-drug interactions, and genetic polymorphisms potentially associated with photosensitivity. 3. In addition, new aspects of human ABCG4 and mouse Abcg4 are presented with respect to their molecular properties and potential physiological roles. Considering a high sequence similarity between ABCG1 and ABCG4, both Abcg4 and ABCG4 may be involved in the transport of cholesterol from neurons and astrocytes. Furthermore, high expression of the mouse Abcg4 protein in the testis implicates its involvement in transport of certain sex hormones.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment
232 S. Koshiba et al. variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both haematoporphyrin and methotrexate. Login to comment

[hide] Major SNP (Q141K) variant of human ABC transporter... Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29. Furukawa T, Wakabayashi K, Tamura A, Nakagawa H, Morishima Y, Osawa Y, Ishikawa T
Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations.
Pharm Res. 2009 Feb;26(2):469-79. Epub 2008 Oct 29., [PMID:18958403]

Abstract [show]
PURPOSE: Single nucleotide polymorphisms (SNPs) of the ATP-binding cassette (ABC) transporter ABCG2 gene have been suggested to be a significant factor in patients' responses to medication and/or the risk of diseases. We aimed to evaluate the impact of the major non-synonymous SNP Q141K on lysosomal and proteasomal degradations. METHODS: ABCG2 WT and the Q141K variant were expressed in Flp-In-293 cells by using the Flp recombinase system. Their expression levels and cellular localization was measured by immunoblotting and immunofluorescence microscopy, respectively. RESULTS: The protein level of the Q141K variant expressed in Flp-In-293 cells was about half that of ABCG2 WT, while their mRNA levels were equal. The protein expression level of the Q141K variant increased about two-fold when Flp-In-293 cells were treated with MG132. In contrast, the protein level of ABCG2 WT was little affected by the same treatment. After treatment with bafilomycin A1, the protein levels of ABCG2 WT and Q141K increased 5- and 2-fold in Flp-In-293 cells, respectively. CONCLUSIONS: The results strongly suggest that the major non-synonymous SNP Q141K affects the stability of the ABCG2 protein in the endoplasmic reticulum and enhances its susceptibility to ubiquitin-mediated proteasomal degradation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
129 Protein expression levels of the WT and the Q141K variant were determined by immunoblotting after PNGase F treatment in the same way as described above. Login to comment

[hide] Functions of the breast cancer resistance protein ... Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3. Noguchi K, Katayama K, Mitsuhashi J, Sugimoto Y
Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):26-33. Epub 2008 Dec 3., 2009-01-31 [PMID:19111841]

Abstract [show]
The breast cancer resistance protein, BCRP/ABCG2, is a half-molecule ATP-binding cassette transporter that facilitates the efflux of various anticancer agents from the cell, including 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. The expression of BCRP can thus confer a multidrug resistance phenotype in cancer cells, and its transporter activity is involved in the in vivo efficacy of chemotherapeutic agents. Thus, the elucidation of the substrate preferences and structural relationships of BCRP is essential to understanding its in vivo functions during chemotherapeutic treatments. Single nucleotide polymorphisms (SNPs) have also been found to be key factors in determining the efficacy of chemotherapeutics, and those therapeutics that inhibit BCRP activity, such as the SNP that results in a C421A mutant, may result in unexpected side effects of the BCRP- anticancer drugs interaction even at normal dosages. In order to modulate the BCRP activity during chemotherapy, various compounds have been tested as inhibitors of this protein. Estrogenic compounds including estrone, several tamoxifen derivatives in addition to phytoestrogens and flavonoids have been shown to reverse BCRP-mediated drug resistance. Intriguingly, recently developed molecular targeted cancer drugs, such as the tyrosine kinase inhibitors imatinib mesylate, gefitinib and others, can also interact with BCRP. Since both functional SNPs and inhibitory agents of BCRP modulate the in vivo pharmacokinetics and pharmacodynamics of its substrate drugs, BCRP activity is an important consideration in the development of molecular targeted chemotherapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
228 C376T (Q126stop)-BCRP SNP . Login to comment
865 C376T (Q126stop)-BCRP SNP We have identified another SNP within the BCRP gene, C376T, which substitutes a stop codon for Gln-126 (Q126stop) and is present at a low frequency in samples from healthy Japanese individuals as a heterozygote (reported frequencies of 3/124 and 2/120 in two studies, respectively) [54,60]. Login to comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

[hide] Quality control of human ABCG2 protein in the endo... Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11. Wakabayashi-Nakao K, Tamura A, Furukawa T, Nakagawa H, Ishikawa T
Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation.
Adv Drug Deliv Rev. 2009 Jan 31;61(1):66-72. Epub 2008 Dec 11., 2009-01-31 [PMID:19111842]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is a plasma membrane protein carrying intra- and inter-molecular disulfide bonds and an N-linked glycan. Both disulfide bond formation and N-glycosylation are critical check points determining the stability and degradation fate of ABCG2 protein in the endoplasmic reticulum (ER). Misfolded ABCG2 protein without those post-translational modifications is removed from the ER by retrotranslocation to the cytosol compartment, ubiquitination by ubiquitin ligase, and finally degradation by proteasomes. Certain non-synonymous SNP variants of ABCG2 undergo such ER-associated degradation (ERAD).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
950 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin [54]. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
242 0.005 c. 376 C>T Q126stop 0.01 0.00a 0.00b Lack of function c. 421 C>A Q141K 0.35 0.11a 0.02b Reduced activity [120, 124, 137] IVS 5 -16 A>G ? Login to comment

[hide] Structure and function of the human breast cancer ... Curr Drug Metab. 2010 Sep;11(7):603-17. Ni Z, Bikadi Z, Rosenberg MF, Mao Q
Structure and function of the human breast cancer resistance protein (BCRP/ABCG2).
Curr Drug Metab. 2010 Sep;11(7):603-17., [PMID:20812902]

Abstract [show]
The human breast cancer resistance protein (BCRP/ABCG2) is the second member of the G subfamily of the large ATP-binding cassette (ABC) transporter superfamily. BCRP was initially discovered in multidrug resistant breast cancer cell lines where it confers resistance to chemotherapeutic agents such as mitoxantrone, topotecan and methotrexate by extruding these compounds out of the cell. BCRP is capable of transporting non-chemotherapy drugs and xenobiotiocs as well, including nitrofurantoin, prazosin, glyburide, and 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine. BCRP is frequently detected at high levels in stem cells, likely providing xenobiotic protection. BCRP is also highly expressed in normal human tissues including the small intestine, liver, brain endothelium, and placenta. Therefore, BCRP has been increasingly recognized for its important role in the absorption, elimination, and tissue distribution of drugs and xenobiotics. At present, little is known about the transport mechanism of BCRP, particularly how it recognizes and transports a large number of structurally and chemically unrelated drugs and xenobiotics. Here, we review current knowledge of structure and function of this medically important ABC efflux drug transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
249 A systematic study of 18 natural variants of BCRP expressed in insect cells showed that the variants Q126stop, F208S, S248P, E334stop, and S441N were defective in porphyrin transport, whereas F489L displayed approximately 10% of the transport activity of wild-type BCRP [120]. Login to comment

[hide] Ubiquitin-mediated proteasomal degradation of ABC ... J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12. Nakagawa H, Toyoda Y, Wakabayashi-Nakao K, Tamaki H, Osumi M, Ishikawa T
Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts.
J Pharm Sci. 2011 Sep;100(9):3602-19. doi: 10.1002/jps.22615. Epub 2011 May 12., [PMID:21567408]

Abstract [show]
The interindividual variation in the rate of drug metabolism and disposition has been known for many years. Pharmacogenomics dealing with heredity and response to drugs is a part of science that attempts to explain variability of drug responses and to search for the genetic basis of such variations or differences. Genetic polymorphisms of drug metabolizing enzymes and drug transporters have been found to play a significant role in the patients' responses to medication. Accumulating evidence demonstrates that certain nonsynonymous polymorphisms have great impacts on the protein stability and degradation, as well as the function of drug metabolizing enzymes and transporters. The aim of this review article is to address a new aspect of protein quality control in the endoplasmic reticulum and to present examples regarding the impact of nonsynonymous single-nucleotide polymorphisms on the protein stability of thiopurine S-methyltransferase as well as ATP-binding cassette (ABC) transporters including ABCC4, cystic fibrosis transmembrane conductance regulator (CFTR, ABCC7), ABCC11, and ABCG2. Furthermore, we will discuss the molecular mechanisms underlying posttranslational modifications (intramolecular and intermolecular disulfide bond formation and N-linked glycosylation) and ubiquitin-mediated proteasomal degradation of ABCG2, one of the major drug transporter proteins in humans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected. Login to comment

[hide] A T3587G germ-line mutation of the MDR1 gene encod... Mol Cancer Ther. 2006 Apr;5(4):877-84. Mutoh K, Mitsuhashi J, Kimura Y, Tsukahara S, Ishikawa E, Sai K, Ozawa S, Sawada J, Ueda K, Katayama K, Sugimoto Y
A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein.
Mol Cancer Ther. 2006 Apr;5(4):877-84., [PMID:16648557]

Abstract [show]
The human multidrug resistance gene 1 (MDR1) encodes a plasma membrane P-glycoprotein (P-gp) that functions as an efflux pump for various structurally unrelated anticancer agents. We have identified two nonsynonymous germ-line mutations of the MDR1 gene, C3583T MDR1 and T3587G MDR1, in peripheral blood cell samples from Japanese cancer patients. Two patients carried the C3583T MDR1 allele that encodes H1195Y P-gp, whereas a further two carried T3587G MDR1 that encodes I1196S P-gp. Murine NIH3T3 cells were transfected with pCAL-MDR-IRES-ZEO constructs carrying either wild-type (WT), C3583T, or T3587G MDR1 cDNA and selected with zeocin. The resulting zeocin-resistant mixed populations of transfected cells were designated as 3T3/WT, 3T3/H1195Y, and 3T3/I1196S, respectively. The cell surface expression of I1196S P-gp in 3T3/I1196S cells could not be detected by fluorescence-activated cell sorting, although low expression of I1196S P-gp was found by Western blotting. H1195Y P-gp expression levels in 3T3/H1195Y cells were slightly lower than the corresponding WT P-gp levels in 3T3/WT cells. By immunoblotting analysis, both WT P-gp and H1195Y P-gp were detectable as a 145-kDa protein, whereas I1196S P-gp was visualized as a 140-kDa protein. 3T3/I1196S cells did not show any drug resistance unlike 3T3/H1195Y cells. Moreover, a vanadate-trap assay showed that the I1196S P-gp species lacks ATP-binding activity. Taken together, we conclude from these data that T3587G MDR1 expresses a nonfunctional P-gp and this is therefore the first description of such a germ-line mutation. We contend that the T3587G MDR1 mutation may affect the pharmacokinetics of MDR1-related anticancer agents in patients carrying this allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
216 In a separate previous study from our laboratory, we identified the C376T BCRP SNP that encodes a Q126stop truncated BCRP (34, 35). Login to comment

[hide] ABC transporters in human lymphocytes: expression,... Expert Opin Drug Metab Toxicol. 2010 May;6(5):571-89. Giraud C, Manceau S, Treluyer JM
ABC transporters in human lymphocytes: expression, activity and role, modulating factors and consequences for antiretroviral therapies.
Expert Opin Drug Metab Toxicol. 2010 May;6(5):571-89., [PMID:20367109]

Abstract [show]
IMPORTANCE OF THE FIELD: ATP-binding cassette (ABC) transporters are a superfamily of efflux pumps that transport numerous compounds across cell membranes. These transporters are located in various human tissues including peripheral blood cells, in particular lymphocytes, and present a high variability of expression and activity. This variability may affect the intracellular concentrations and efficacy of drugs acting within lymphocytes, such as antiretroviral drugs. AREAS COVERED IN THIS REVIEW: This review focuses on the current knowledge about the expression, activity, roles and variability of ABC drug transporters in human lymphocytes. The identified modulating factors and their impact on the intracellular pharmacokinetics and efficacy of antiretroviral drugs are also detailed. WHAT THE READER WILL GAIN: Controversial data regarding the expression, activity and sources of variability of ABC transporters in lymphocytes are discussed. The modulating factors and their pharmacological consequences regarding antiretroviral therapies are also provided. TAKE HOME MESSAGE: Numerous studies have reported conflicting results regarding the expression and activity of ABC drug transporters in lymphocytes. Despite these discrepancies, which may partly result from heterogeneous analytical methods, ABCC1 appears to have the highest expression in lymphocytes and may thus play a predominant role in the resistance to antiretroviral drugs, particularly to protease inhibitors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
207 A nonsense mutation resulting in a premature stop codon has also been identified, the 376C > T mutation (Q126stop), which was associated with a lack of protein activity. Login to comment

[hide] Metabolic Interactions of Purine Derivatives with ... Pharmaceuticals (Basel). 2013 Nov 4;6(11):1347-60. doi: 10.3390/ph6111347. Ishikawa T, Aw W, Kaneko K
Metabolic Interactions of Purine Derivatives with Human ABC Transporter ABCG2: Genetic Testing to Assess Gout Risk.
Pharmaceuticals (Basel). 2013 Nov 4;6(11):1347-60. doi: 10.3390/ph6111347., [PMID:24287461]

Abstract [show]
In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid) in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs), i.e., 421C>A (major) and 376C>T (minor), in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 The variant Q126stop (376C>T) was consistently observed in certain Japanese cohorts; however, it was absent in Caucasian and African-American groups [39,41,44]. Login to comment
119 Matsuo et al. [4] reported that the genotype combinations of Q126stop and Q141K are clinically important biomarkers to predict the possible risk of gout in the Japanese population. Login to comment

[hide] Role of the breast cancer resistance protein (BCRP... AAPS J. 2015 Jan;17(1):65-82. doi: 10.1208/s12248-014-9668-6. Epub 2014 Sep 19. Mao Q, Unadkat JD
Role of the breast cancer resistance protein (BCRP/ABCG2) in drug transport--an update.
AAPS J. 2015 Jan;17(1):65-82. doi: 10.1208/s12248-014-9668-6. Epub 2014 Sep 19., [PMID:25236865]

Abstract [show]
The human breast cancer resistance protein (BCRP, gene symbol ABCG2) is an ATP-binding cassette (ABC) efflux transporter. It was so named because it was initially cloned from a multidrug-resistant breast cancer cell line where it was found to confer resistance to chemotherapeutic agents such as mitoxantrone and topotecan. Since its discovery in 1998, the substrates of BCRP have been rapidly expanding to include not only therapeutic agents but also physiological substances such as estrone-3-sulfate, 17beta-estradiol 17-(beta-D-glucuronide) and uric acid. Likewise, at least hundreds of BCRP inhibitors have been identified. Among normal human tissues, BCRP is highly expressed on the apical membranes of the placental syncytiotrophoblasts, the intestinal epithelium, the liver hepatocytes, the endothelial cells of brain microvessels, and the renal proximal tubular cells, contributing to the absorption, distribution, and elimination of drugs and endogenous compounds as well as tissue protection against xenobiotic exposure. As a result, BCRP has now been recognized by the FDA to be one of the key drug transporters involved in clinically relevant drug disposition. We published a highly-accessed review article on BCRP in 2005, and much progress has been made since then. In this review, we provide an update of current knowledge on basic biochemistry and pharmacological functions of BCRP as well as its relevance to drug resistance and drug disposition.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
216 Notably, two SNPs, 376C>T (Q126stop) and 1000G>T (E334stop) result in substitutions of a stop code in the ABCG2 gene. Login to comment