ABCMdb

ABCG2 p.Gln126*

None has been submitted yet.

Publications

PMID: 16160819 [PubMed] Ishikawa T et al: "Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design."

No. Sentence Comment

105 The variant Q126stop (c.376C>T) was consistently observed in certain Japanese cohorts; however, it was absent in Caucasian and African American groups (Imai et al. 2002; Itoda et al. 2003; Kobayashi et al. 2005). Login to comment
118 For this purpose, we have created variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) by site-directed mutagenesis. Login to comment
132 No MTX-transport activity was observed in the Q126stop and E334stop variants, as well as in acquired mutation variants (R482G and R482T). Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."

No. Sentence Comment

213 Some of the above sequence variations showed an allele frequency of ~ 1% in distinct populations, Q126stop and F489L in the Japanese and N590Y in the Caucasian population [129-131,134,135], whereas most of the mutations were only detected in single individuals (e.g., I206L, F431L, S441N, D620N). Login to comment
238 The variant Q126stop (c.376C > T) was consistently observed in certain Japanese cohorts; however, it was absent in two different Caucasian and African-American groups [129,134,135]. Login to comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment
255 For this purpose, variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G and R482T) were created by site-directed mutagenesis (Figure 3). Login to comment
269 No MTX-transport activity was observed in the Q126stop and E334stop variants, as well as in acquired mutation variants (R482G and R482T). Login to comment

PMID: 16303243 [PubMed] Yanase K et al: "Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development."

No. Sentence Comment

64 C376T (Q126stop)-BCRP SNP Another of the BCRP gene SNPs, C376T, substitutes a stop codon for Gln-126 (Q126stop), and was found in 3/124 of our general Japanese samples as a heterozygosity [23]. Login to comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

PMID: 16399366 [PubMed] Ishikawa T et al: "High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics."

No. Sentence Comment

115 For this purpose, variant forms (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) have been created by site‐ directed mutagenesis with the QuikChange site‐directed mutagensis kit (Stratagene, La Jolla, CA). Login to comment
125 No MTX transport activity was observed in the variants Q126stop, E334stop, R482G, and R482T. Login to comment
233 Figure 13 shows the result of SNP array detection where nonsynonymous polymorphisms of ABCG2, that is, Q126stop and Q141K, were analyzed. Login to comment
249 Detection of nonsynonymous polymorphisms (Q126stop and Q141K) of ABCG2 with the SNP array. Login to comment

PMID: 16608919 [PubMed] Tamura A et al: "Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport."

No. Sentence Comment

2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
4 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Login to comment
6 Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria. Login to comment
36 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins, suggesting that those genetic polymorphisms in the ABCG2 gene may be related to the risk of certain diseases resulting from disruption of porphyrin homeostasis. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
148 For Q126stop and E334stop, however, that treatment created truncated proteins (Fig. 4A). Login to comment
164 It is important to note that the variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both hematoporphyrin and methotrexate. Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
215 We provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin (Fig. 5). Login to comment
219 The frequencies of the Q126stop, S441N, and F489L alleles are relatively low (less than 2%) compared with those of the V12M and Q141K alleles. Login to comment
220 The variant Q126stop was consistently observed in certain Japanese cohorts; however, it was absent in two different Caucasian and African-American groups (Imai et al., 2002; Itoda et al., 2003; Mizuarai et al., 2004; Kobayashi et al., 2005; for a recent review, see Ishikawa et al., 2005) for recent review. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
240 Therefore, at least, the validated alleles such as Q126stop, S441N, and F489L with a loss of porphyrin transport activity are at potential risk of diseases. Login to comment

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

917 0.005 Exon 4 c. 376 C>T Q126stop 0.01 Lack of function 0.00a 0.00b Exon 5 c. 421 C>A Q141K 0.35 Reduced activity (Mizuarai et al., 2004; Kobayashi et al., 2005; Sparreboom et al., 2005) 0.11a 0.02b IVS 5-16 A>G ? Login to comment

PMID: 16877258 [PubMed] Wakabayashi K et al: "Human ABC transporter ABCG2 in xenobiotic protection and redox biology."

No. Sentence Comment

176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment
177 The variants Q126stop, F208S, S248P, E334stop, and S441N were found to be defective in the transport of hematoporphyrin (Tamura et al., 2006) (Table 2). Login to comment

PMID: 17093005 [PubMed] Enokizono J et al: "Involvement of breast cancer resistance protein (BCRP/ABCG2) in the biliary excretion and intestinal efflux of troglitazone sulfate, the major metabolite of troglitazone with a cholestatic effect."

No. Sentence Comment

192 BCRP has some functional single nucleotide polymorphisms (SNP), such as C376T (Q126stop), C421A (Q141K), and G1322A (S441N). Login to comment

PMID: 17323126 [PubMed] Huang Y et al: "Pharmacogenetics/genomics of membrane transporters in cancer chemotherapy."

No. Sentence Comment

124 Moreover, Letourneau et al. examined 10 non-synonymous ABCC1 SNPs to determine Table 2 Summary of genetic variants in ABC transporters ABCB1, ABCC1, ABCC2 and ABCG2 involved in cancer chemotherapy Variants (location, effect) Phenotype Drug Sample Reference ABCB1 +103T>C (5'flanking, non-coding) Increased transcription Doxorubicin vincristine osteosarcoma Stein et al., 1994 [19] +8T>C (5'flanking, non-coding) Unknown Leukemia Rund et al., 1999 [21] 1236C>T (exon12, synonymous) Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Higher exposure Irinotecan, SN-38 Cancer patients Mathijssen et al., 2003 [45] 2677G>T/A (exon21, A893S/T) Lower expression placenta Tanabe et al., 2001 [42] Lower expression placenta Hitzl et al., 2004 [37] Higher expression AML blasts Illmer et al., 2002 [47] Allele specific expression Cell lines, lymphoma Mickley et al., 1998 [22] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Survival leukemia Illmer et al., 2002 [47] Survival leukemia van den Heuvel-Eibrink et al., 2001 [48] Worse survival AML blasts Kim et al., 2006 [10] Higher efficacy Paclitaxel Ovarian cancer Green et al., 2006 [50] 2995G>A (exon24, A999T) None Cell lines, lymphoma Mickley et al., 1998 [22] 3435C>T (exon26, synonymous) Lower expression Duodenal protein Hoffmeyer et al., 2000 [26] Lower expression placenta Hitzl et al., 2004 [37] Higher expression Intestine mRNA Nakamura et al., 2002 [32] Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Lower efflux Digoxin CD56+ NK cells Hitzl et al., 2001 [27] Higher plasma level Digoxin Healthy volunteers Hoffmeyer et al., 2000 [26] Higher AUC Cyclosporin transplant patients Bonhomme-Faivre et al., 2004 [36] Lower CNS relapse Cancer patients Stanulla et al., 2005 [46] Better survival leukemia Illmer et al., 2002 [47] Higher efficacy Breast cancer Kafka et al., 2003 [49] Higher activity, worse survival AML Kim et al., 2006 [10] Better survival Platinums Esophageal cancer Wu et al., 2006 [43] No difference Docetaxel patients Puisset et al., 2004 [41] No difference Irinotecan Cancer patients Mathijssen et al., 2004 [39] No difference Vincristine patients Plasschaert et al., 2004 [40] No difference colon Taniguchi et al., 2003 [24] ABCC1 -260G>C (5'flanking, non-coding) Higher activity Transfected cell line Wang et al., 2005 [62] Table 2 (Continued) Variants (location, effect) Phenotype Drug Sample Reference 128G>C (exon2, C43S) Reduced resistance Vincristine, arsenite Transfected cell line Leslie et al., 2003 [60] 1299G>T (exon10, R433S) Reduced transport of LTC4, increased resistance to doxorubicin Leukotriene C4, doxorubicin Transfected cell line Conrad et al., 2002 [59] 2012G>T (exon16, G671V) No change in activityLeukotriene C4 Transfected cell line Conrad et al., 2001 [58] Heart toxicity Doxorubicin nLon-Hodgkin lymphoma Wojnowski et al., 2005 [63] 2965G>A (exon22, A989T) Reduced transport Estradiol 17β-glucuronide Transfected cell line Letourneau et al., 2005 [61] ABCC2 1271A>G (exon10, R421G) Reduced drug elimination, increased nephrotoxicity Methotrexate One lymphoma patient Hulot et al., 2005 [79] 3972C>T (exon28, nonsynonymous) Reduced drug clearance Irinotecan Cancer patients Innocenti et al., 2004 [80] ABCG2 376C>T (exon4, Q126stop) Reduced transport Porphyrin Trensfected cell Tamura et al., 2006 [104] 421C>A (exon5, Q141K) Lower expression Transfected cell lines Imai et al., 2002 [94] Lower expression Transfected cell lines Kondo et al., 2004 [95] Lower expression Placenta Kobayashi et al., 2005 [98] Reduced ATPase activity Trensfected cell lines Mizuarai et al., 2004 [97] Higher plasma levels Diflomotecan patients Sparreboom et al., 2004 [100] Increased bioavailability Topotecan patients Sparreboom et al., 2005 [101] Increased bioavailability 9-Aminocamptothecin patients Zamboni et al., 2006 [81] Increased drug accumulation Imatinib Transfected cell lines Gardner et al., 2006 [96] Increased drug accumulation Topotecan Trensfected cell lines Imai et al., 2002 [94] No difference Imatinib patients Gardner et al., 2006 [96] No difference intestine Zamber et al., 2003 [99] No difference MTX Trensfected cell lines Kondo et al., 2004 [95] the effects on expression and function of this transporter in transfected HEK293T cells [61]. Login to comment
187 Another polymorphism, 376C>T, substitutes a stop codon for Gln (Q126stop) and causes the absence of active ABCG2 protein from the T allele [95, 99]. Login to comment
189 It was recently demonstrated that in vitro the Q126stop protein was defective in porphyrin transport [104]. Login to comment

PMID: 18154452 [PubMed] Sharom FJ et al: "ABC multidrug transporters: structure, function and role in chemoresistance."

No. Sentence Comment

355 Over 80 SNPs, missense, nonsense and frameshift mutations in the ABCG2 gene have been identified in different ethnic groups [23,170], including V12M (N-terminal cytosolic region), Q141K (NBD) and Q126stop (in which no active protein is produced). Login to comment
368 A recent study characterized the activity of 18 ABCG2 variants, and concluded that Q126stop, F208S, S248P, E334stop, S441N and F489L are defective in hematoporphyrin transport [170], which may increase the risk of disease in individuals carrying these polymorphisms. Login to comment

PMID: 18159130 [PubMed] Tamura A et al: "In vitro evaluation of photosensitivity risk related to genetic polymorphisms of human ABC transporter ABCG2 and inhibition by drugs."

No. Sentence Comment

22 By using plasma membrane vesicles and a high-speed screening system, we precisely evaluated functional changes associated with genetic polymorphisms in vitro.24) Since porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the transport of porphyrins with a total of 18 variant forms of human ABCG2 in the plasma membrane vesicle system.4) As a result, we found that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins. Login to comment
199 Indeed, we reported that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin.4) The F489L variant showed impaired transport activity. Login to comment

PMID: 18237272 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2."

No. Sentence Comment

26 The ABCG2 non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N and F489L were defective in the active transport of methotrexate and haematoporphyrin [18]. Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

PMID: 18363541 [PubMed] Tamura A et al: "Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems."

No. Sentence Comment

230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
246 The variants Q126stop, F208S, S248P, E334stop, and S441N were defective in the transport of hematoporphyrin (Figure 9). Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

PMID: 18668433 [PubMed] Koshiba S et al: "Human ABC transporters ABCG2 (BCRP) and ABCG4."

No. Sentence Comment

225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment
232 S. Koshiba et al. variants Q126stop, F208S, S248P, E334stop, and S441N substantially lack transport activity for both haematoporphyrin and methotrexate. Login to comment

PMID: 18958403 [PubMed] Furukawa T et al: "Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations."

No. Sentence Comment

129 Protein expression levels of the WT and the Q141K variant were determined by immunoblotting after PNGase F treatment in the same way as described above. Login to comment

PMID: 19111841 [PubMed] Noguchi K et al: "Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy."

No. Sentence Comment

228 C376T (Q126stop)-BCRP SNP . Login to comment
865 C376T (Q126stop)-BCRP SNP We have identified another SNP within the BCRP gene, C376T, which substitutes a stop codon for Gln-126 (Q126stop) and is present at a low frequency in samples from healthy Japanese individuals as a heterozygote (reported frequencies of 3/124 and 2/120 in two studies, respectively) [54,60]. Login to comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

PMID: 19111842 [PubMed] Wakabayashi-Nakao K et al: "Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation."

No. Sentence Comment

950 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin [54]. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

242 0.005 c. 376 C>T Q126stop 0.01 0.00a 0.00b Lack of function c. 421 C>A Q141K 0.35 0.11a 0.02b Reduced activity [120, 124, 137] IVS 5 -16 A>G ? Login to comment

PMID: 20812902 [PubMed] Ni Z et al: "Structure and function of the human breast cancer resistance protein (BCRP/ABCG2)."

No. Sentence Comment

249 A systematic study of 18 natural variants of BCRP expressed in insect cells showed that the variants Q126stop, F208S, S248P, E334stop, and S441N were defective in porphyrin transport, whereas F489L displayed approximately 10% of the transport activity of wild-type BCRP [120]. Login to comment

PMID: 21567408 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts."

No. Sentence Comment

118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected. Login to comment

PMID: 16648557 [PubMed] Mutoh K et al: "A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein."

No. Sentence Comment

216 In a separate previous study from our laboratory, we identified the C376T BCRP SNP that encodes a Q126stop truncated BCRP (34, 35). Login to comment

PMID: 20367109 [PubMed] Giraud C et al: "ABC transporters in human lymphocytes: expression, activity and role, modulating factors and consequences for antiretroviral therapies."

No. Sentence Comment

207 A nonsense mutation resulting in a premature stop codon has also been identified, the 376C > T mutation (Q126stop), which was associated with a lack of protein activity. Login to comment

PMID: 24287461 [PubMed] Ishikawa T et al: "Metabolic Interactions of Purine Derivatives with Human ABC Transporter ABCG2: Genetic Testing to Assess Gout Risk."

No. Sentence Comment

118 The variant Q126stop (376C>T) was consistently observed in certain Japanese cohorts; however, it was absent in Caucasian and African-American groups [39,41,44]. Login to comment
119 Matsuo et al. [4] reported that the genotype combinations of Q126stop and Q141K are clinically important biomarkers to predict the possible risk of gout in the Japanese population. Login to comment

PMID: 25236865 [PubMed] Mao Q et al: "Role of the breast cancer resistance protein (BCRP/ABCG2) in drug transport--an update."

No. Sentence Comment

216 Notably, two SNPs, 376C>T (Q126stop) and 1000G>T (E334stop) result in substitutions of a stop code in the ABCG2 gene. Login to comment