157 Q1382R MRP2 is a mutation Fig. 4.

X

ABCC2 p.Gln1382Arg 17373578:157:0

status: NEW

Login to comment

101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined.

X

ABCC2 p.Gln1382Arg 18464048:101:1012

status: NEW

Login to comment

373 These include Arg768Trp and Gln1382Arg which have been recently characterized in vitro [275].

X

ABCC2 p.Gln1382Arg 14965249:373:28

status: NEW

Login to comment
376 Inhibitors of MRP2 have been described but few, if any, are known to be highly specific for this transporter alone. studies showed that the maturation and apical localization of the NBD1 MRP2-Arg768Trp mutant was deficient while substrate-induced ATP hydrolysis was impaired in the NBD2 MRP2-Gln1382Arg mutant.

X

ABCC2 p.Gln1382Arg 14965249:376:295

status: NEW

Login to comment

157 For example, homozygous DJS mutations Arg768Trp (C2302T) and Gln1382Arg (A4145G) are located in NBD1 and NBD2, respectively, and in vitro studies have shown that both mutations have substantial phenotypic consequences [40].

X

ABCC2 p.Gln1382Arg 16006996:157:61

status: NEW

Login to comment
158 Thus, the Arg768Trp mutation impairs maturation and sorting of MRP2 to the apical membrane, whereas the Gln1382Arg mutation decreases organic anion (LTC4) transport and substrate-induced ATP hydrolysis [45].

X

ABCC2 p.Gln1382Arg 16006996:158:104

status: NEW

Login to comment

191 Q1382R MRP2, a mutation that is located between the Walker A and the signature C regions of the second ATP-binding site, results in a lack of ATP hydrolysis activity (36).

X

ABCC2 p.Gln1382Arg 16648557:191:0

status: NEW

Login to comment

116 Of all the blocks, block 1 (rs1885301-rs2804402) in the promoter region and Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 33 rs3758395 chr10:101602004 c.3741 + 154T > C Intron 26 0.190 34 rs17216177 chr10:101603522 c.3742 - 34T > C Intron 26 0.000 35 rs3740066 chr10:101604207 c.3972C > T Exon 28 (Ile1324Ile) m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of irinotecan (ABCC2*2 containing C allele) [34] 0.327 36 rs72558202 chr10:101605538 c.4145A > G Exon 29 (Gln1382Arg) 0.000 37 rs3740065 chr10:101605693 c.4146 + 154A > G Intron 29 0.211 38 rs56296335 chr10:101610393 c.4348G > C Exon 31 (Ala1450Ser) k Activity, kexpression and impaired membrane localization [40] 0.000 39 rs3740063 chr10:101610723 c.4508 + 170T > C Intron 31 0.345 40 rs8187710 chr10:101611294 c.4544G > A Exon 32 (Cys1515Tyr) m Expression [41] 0.017 452 Pharmacogenetics and Genomics 2012, Vol 22 No 6 block 2 (rs4919395-rs2756104-rs4148385-rs2180990- rs35191126) spanning introns 1 and 2, separated by a 1.5 kb region, were smaller spanning .5 and 6 kb regions, respectively.

X

ABCC2 p.Gln1382Arg 22565165:116:638

status: NEW

Login to comment

28 The study of allelic segregation in Letter to the Editor R100X R393W IVS6_IVS7del L441M IVS13 +2 T>A IVS15 +2 T>C G676R IVS18 +2 T>C R768W * 2748_2883del * R1066X * 3399_3400del L1173F 3615_3843del* Y1275X * R1310X Q1382R R1392_M1393del S325X W709R T1273A IVS8 +4 A>G 1256_1272delins CT 4292_4293delR1150H E1352Q * Exon 1 32 Fig. 1.

X

ABCC2 p.Gln1382Arg 21044052:28:217

status: NEW

Login to comment

87 Interestingly, two missense mutations, R768W and Q1382R, of the nucleotide-binding domains (NBDs) behaved differently.

X

ABCC2 p.Gln1382Arg 20082599:87:49

status: NEW

Login to comment
88 Pulse-chase analysis revealed that the precursor forms of the wild type and Q1382R ABCC2 fully matured, as they were resistant to endoglycosidase H (Endo H).

X

ABCC2 p.Gln1382Arg 20082599:88:76

status: NEW

Login to comment

139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ.

X

ABCC2 p.Gln1382Arg 16847695:139:3564

status: NEW

Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ.

X

ABCC2 p.Gln1382Arg 16847695:140:3564

status: NEW

Login to comment

78 Mutations in the MRP2/ABCC2 Gene Associated with DJS Nucleotide Mutation Exon Predicted Effect Reference 298C→T 3 R100X 27 974C→G 8 S325X This article IVS8 + 4A→G Intron 8 Aberrant splicing 28 1177C→T 9 R393W 29 1256insCT/ delAAACAG TGAACCT- GATG 10 Frameshift 30 1271A→G 10 R412G 31 1815 + 2T→A 13 Skipped exon 32, 33 1967 + 2T→C 15 Skipped exon 34, 35 2026G→C 16 G676R 35 2125T→C 17 W709R 36 2302C→T 18 R768W 32, 37, 38 2439 + 2T→C 18 Skipped exon 32, 35, 37 3196C→T 23 R1066X 39, 40 3449G→A 25 R1150H 41 3517A→T 25 I1173F 41 3928C→T 28 R1310X 27, 33 4145A→G 29 Q1382R 37 4175delGGATGA 30 R1392 + M1393 deletion 40 4292delCA 30 Frameshift 30 DISCUSSION Identification of a Novel Nonsense Mutation of the MRP2/ABCC2 Gene Up to now, 18 mutations in the sequence of the MRP2/ABCC2 gene have been reported in DJS, including nonsense mutations, deletions, splicing junction mutations, and missense mutations (Table 1).

X

ABCC2 p.Gln1382Arg 16952291:78:660

status: NEW

X

ABCC2 p.Gln1382Arg 16952291:78:676

status: NEW

Login to comment

41 In Japan, the expected number of Table 1 Summary of mutations identified in Dubin-Johnson syndrome (DJS) Mutation Exon IVS Amino acid alteration Reference 298COT 3 R100X a,b 1815C 2TOA 13 Exon13 skip [38] 1967C 2TOC 15 Exon15 skip [62] 2026GOC 16 G676R [92] 2302COT 18 R768W [49,91]c 2439C 2TOC 18 Exon18 skip [38]a,c 3196COT 23 R1066X [47] 3449GOA 25 R1150H [52] 3517AOT 25 I1173F [52] 3928COT 28 R1310X [50] 4145AOG 29 Q1382R [38] 4175- 4180del 30 RM1392-1393del [48] a Adachi and Wada, unpublished data. b Houkibara and Wada, unpublished data.

X

ABCC2 p.Gln1382Arg 16377077:41:421

status: NEW

Login to comment
60 [42] 29 4145AOG Q1382R NBD2 DJS (ATP hydrilysis) Not reported 0.1?

X

ABCC2 p.Gln1382Arg 16377077:60:16

status: NEW

Login to comment
73 Another missense mutation Q1382R in NBD2 was found in one DJS patient with compound heterozygous mutations (Table 2) [38].

X

ABCC2 p.Gln1382Arg 16377077:73:26

status: NEW

Login to comment
74 The precursor form of the ABCC2 (Q1382R) was rapidly converted to the mature form, and sorted to the apical membrane of the LLC-PK1 cells as the wild type ABCC2.

X

ABCC2 p.Gln1382Arg 16377077:74:33

status: NEW

Login to comment
75 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of ABCC2.

X

ABCC2 p.Gln1382Arg 16377077:75:61

status: NEW

Login to comment
76 However, efflux of glutathione conjugate of mono- chlorobimane (GS-MCLB) and ATP-dependent LTC4 uptake into plasma membrane vesicles derived from HEK293 cells expressing ABCC2 (Q1382R) was markedly reduced compared to that from cells expressing wild type ABCC2.

X

ABCC2 p.Gln1382Arg 16377077:76:177

status: NEW

Login to comment
77 This indicated that ABCC2 (Q1382R), although localized on the apical membrane, was nonfunctional.

X

ABCC2 p.Gln1382Arg 16377077:77:27

status: NEW

Login to comment
80 Vanadate-induced nucleotide trapping in the wild type ABCC2 was stimulated by the transporter substrate estradiol-glucuronide (E217bG), but that in ABCC2 (Q1382R) was not.

X

ABCC2 p.Gln1382Arg 16377077:80:155

status: NEW

Login to comment
83 These results suggest that 8-azido-[a-32 P]ATP is trapped together with vanadate after hydrolysis, and that the Q1382R mutation impaired substrate-induced ATP hydrolysis (Table 2).

X

ABCC2 p.Gln1382Arg 16377077:83:112

status: NEW

Login to comment
90 In our study, the lack of substrate-induced vanadate trapping in the ABCC2 (Q1382R) may suggest that Q1382 is directly involved in ATP hydrolysis [53].

X

ABCC2 p.Gln1382Arg 16377077:90:76

status: NEW

Login to comment

237 Q1382R MRP2 was mainly localized on the apical membrane of transfected LLC-PK1 cells as wild-type MRP2.

X

ABCC2 p.Gln1382Arg 16180115:237:0

status: NEW

Login to comment
238 However, efflux of glutathione monochlorobimane and ATP-dependent leukotriene C4 uptake into plasma membrane vesicles from cells expressing Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional (125).

X

ABCC2 p.Gln1382Arg 16180115:238:140

status: NEW

X

ABCC2 p.Gln1382Arg 16180115:238:195

status: NEW

Login to comment

63 4145AϾG 29 Q1382R Toh S et al, Am J Hum Genet 1999;64:739-746.

X

ABCC2 p.Gln1382Arg 16012956:63:17

status: NEW

Login to comment

43 With respect to the polymorphism )24C fi T, we also employed a restriction enzyme assay with BbsI; the results showed that his spouse and one daughter were heterozygous for this SNP, but other Table 1 Mutations of MRP2 in Dubin-Johnson syndrome (DJS) Nucleotide mutation Predicted effects References Splice site mutation 1815+2T fi A 1669del147 (exon13 skipping) Wada et al. 1998 1967+2T fi C 1901del67 (exon15 skipping) Kajihara et al. 1998 2439+2T fi C 2272del168 (exon18 skipping) Toh et al. 1999 Deletion mutation Del4170-5 Del R1392 , M1393 Tsujii et al. 1999 Missense mutation 2302C fi T R768 W Wada et al. 1998 3449G fi A R1150H Mor-Cohen et al. 2001 3517A fi T I1173F Mor-Cohen et al. 2001 4145A fi G Q1382R Toh et al. 1999 Nonesense mutation 3196C fi T R1066X Paulusma et al. 1997 3928C fi T R1310X Tate et al. 2002 family members did not possess it (Fig. 4).

X

ABCC2 p.Gln1382Arg 12884082:43:709

status: NEW

Login to comment
51 One of these mutations (R768 W) is located within the first Walker C motif, and the other (Q1382R) lies within the second ABC (Toh Table 2 Mutations of the MRP2 gene in DJS patients and family members (wild wild-type, nd not determined) a C child, S siblings Patients and family Bilirubin (mg/dl) Alteration in MRP2 gene Predicted effects membersa Total Conjugated 1 DJ1 2.7 1.8 2439+2T fi C/2439+2T fi C 2272del168/2272del168 DJ1/C1 0.6 0.2 2439+2T fi C/wild 2272del168/wild DJ1/C2 0.6 0.2 2439+2T fi C/wild 2272del168/wild 2 DJ2 3.0 2.4 1967+2T fi C/1967+2T fi C 1901del67/1901del67 DJ2/S1 0.4 0.1 1967+2T fi C/wild 1901del67/wild DJ2/S2 0.5 0.2 Wild/wild ) DJ2/C1 0.8 0.2 1967+2T fi C/wild 1901del67/wild 3 DJ3 3.4 2.8 1967+2T fi C/2026G fi C 1901del67/G676R DJ3/S1 0.8 0.3 Wild/wild ) DJ3/S2 0.9 0.3 Wild/wild ) DJ3/S3 0.9 0.3 Wild/wild ) DJ3/S4 0.9 0.3 1967+2T fi C/wild 1901del67/wild DJ3/S5 0.3 0.1 Wild/wild ) DJ3/S6 1.3 0.6 1967+2T fi C/wild 1901del67/wild DJ3/C1 nd nd 1967+2T fi C/wild 1901del67/wild DJ3/C2 0.7 0.3 1967+2T fi C/wild 1901del67/wild Fig. 2 Sequencing analysis of exon 16 in the MRP2 gene from DJ3 (arrow site of the heterozygous missense mutation 2026G fi C).

X

ABCC2 p.Gln1382Arg 12884082:51:91

status: NEW

Login to comment

1 We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS.

X

ABCC2 p.Gln1382Arg 12395335:1:68

status: NEW

Login to comment
2 Pulse chase analysis revealed that the precursor form of the wild-type and Q1382R MRP2 were converted to the mature form, which is resistant to endoglycosidase H (Endo H) in about 60 minutes.

X

ABCC2 p.Gln1382Arg 12395335:2:75

status: NEW

Login to comment
5 Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form.

X

ABCC2 p.Gln1382Arg 12395335:5:27

status: NEW

Login to comment
6 However, efflux of glutathione monochlorobimane (GS-MCLB) and ATP-dependent leukotriene C4 (LTC4) uptake into plasma membrane vesicles from cells expressing the Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional.

X

ABCC2 p.Gln1382Arg 12395335:6:161

status: NEW

X

ABCC2 p.Gln1382Arg 12395335:6:216

status: NEW

Login to comment
7 Vanadate-induced nucleotide trapping with 8-azido-[␣-32P]ATP in the wild-type MRP2 was stimulated by estradiol glucuronide (E217betaG) in a concentration-dependent manner but that in the Q1382R MRP2 was not.

X

ABCC2 p.Gln1382Arg 12395335:7:194

status: NEW

Login to comment
8 In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis.

X

ABCC2 p.Gln1382Arg 12395335:8:92

status: NEW

Login to comment
28 The mutants R768W, Q1382R, and K677R were generated from pBS-MRP2.20 To generate these mutant MRPs, site-directed mutagenesis was carried out using a PCR-based method.21 The following primers were used to generate specific mutations: for R768W, the 5Ј-oligonucleotides MRP2-2,302 (5Ј-CAGAAGCAGCGGAT- CAGC; corresponding to the native MRP2 sequence) and R768W-MRP2 (5Ј- CAGAAGCAGTGGAT- CAGCCTG); for Q1382R, the 5Ј-oligonucleotides MRP2-4,555 (5Ј-CATCCCCCAGGACCCCATC; corresponding to the native MRP2 sequence) and Q1382R- MRP2 (5Ј- CATCCCCCGGGACCCCATC); and, for K677R, the 5Ј-oligonucleotides MRP2-2,030 (5Ј- GGCTCTGGGAAATCCTCCTTG; corresponding to the native MRP2 sequence) and K677R-MRP2 (5Ј- GGCTCTGGGAGATCCTCCTTG).

X

ABCC2 p.Gln1382Arg 12395335:28:19

status: NEW

X

ABCC2 p.Gln1382Arg 12395335:28:417

status: NEW

X

ABCC2 p.Gln1382Arg 12395335:28:544

status: NEW

Login to comment
39 In brief, 20, 20, 200, and 200 ␮g total protein from LLC-PK1 cells expressing the wild-type, Q1382R, K677R, and R768W MRP2 were treated with 1,000 units of each enzyme for 1 hour at 37°C, respectively.

X

ABCC2 p.Gln1382Arg 12395335:39:100

status: NEW

Login to comment
56 Plasma membrane vesicles were prepared from HEK293 cells expressing the wild-type and Q1382R MRP2 according to the method of Cornwell et al.30 with some modifications as described previously.22 ATP-dependent uptake of [3H] LTC4 into the inside-out membrane vesicles was measured by a rapid filtration technique22,30 with some modifications.

X

ABCC2 p.Gln1382Arg 12395335:56:86

status: NEW

Login to comment
60 Vanadate trapping of 8-azido-ATP and subsequent photoaffinity labeling were performed as described previously.31 Membrane proteins (2 ␮g) from the stable transfectants of wild-type MRP2, Q1382R MRP2, and empty vector in HEK293 cells were suspended with the assay solution including 1 mmol/L vanadate and estradiol glucuronide (E217betaG) at each concentration.

X

ABCC2 p.Gln1382Arg 12395335:60:194

status: NEW

Login to comment
63 We recently identified a missense mutation 2,302 (C3T) R768W in NBD1 in 3 DJS families and another missense mutation 4,145 (A3G) Q1382R in NBD2 in one DJS family (Fig. 1).12,13 Paraffin-embedded liver sections from a patient with R768W mutation were examined for the presence of the MRP2 and P-glycoprotein using monoclonal antibodies.

X

ABCC2 p.Gln1382Arg 12395335:63:129

status: NEW

Login to comment
66 Location of the DJS-associated mutations, R768W and Q1382R, in a MRP2.

X

ABCC2 p.Gln1382Arg 12395335:66:52

status: NEW

Login to comment
77 We were unable to examine whether the Q1382R MRP2 was expressed in the canalicular membrane of hepatocytes because no bioptic sample was available.

X

ABCC2 p.Gln1382Arg 12395335:77:38

status: NEW

Login to comment
79 To investigate the effect of these DJS-associated mutations on the processing, localization, and function of MRP2, we introduced the 2 DJS-associated mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R into the MRP2 cDNA.

X

ABCC2 p.Gln1382Arg 12395335:79:195

status: NEW

Login to comment
81 LLC-PK1 and HEK293 cell lines that stably express the wild-type MRP2 or each mutant MRP2 (R768W, Q1382R, and K677R) were established.

X

ABCC2 p.Gln1382Arg 12395335:81:97

status: NEW

Login to comment
83 The antibody M2I-4 detected a 190 to 210 kd diffused band, probably mature and glycosylated protein (designated as M) of the wild-type and Q1382R MRP2 (Fig. 3A).

X

ABCC2 p.Gln1382Arg 12395335:83:139

status: NEW

Login to comment
84 The antibody M2III-6, raised against the C-terminal region, recognized the wild-type MRP2 efficiently but the Q1382R MRP2 only weakly (Fig. 3B).

X

ABCC2 p.Gln1382Arg 12395335:84:110

status: NEW

Login to comment
85 The Q1382R mutation changed the epitope to reduce the reactivity to the antibody, although it did not affect the maturation process.

X

ABCC2 p.Gln1382Arg 12395335:85:4

status: NEW

Login to comment
95 LLC-PK1 cells stably expressing the wild-type human MRP2 and the mutant MRP (Q1382R, R768W, or K677R) were solubilized and analyzed by Western blot analysis with monoclonal antibodies M2I-4 (A) and M2III-6 (B).

X

ABCC2 p.Gln1382Arg 12395335:95:77

status: NEW

Login to comment
98 The cell lysates from LLC-PK1 cells expressing the wild-type and Q1382R MRP2 (20 ␮g) or from cells expressing the R768W and K677R MRP2 (200 ␮g) were treated with Endo H or PNGaseF and analyzed by Western blot analysis with monoclonal antibodies M2I-4.

X

ABCC2 p.Gln1382Arg 12395335:98:65

status: NEW

Login to comment
100 wild-type and Q1382R MRP2 (band M) were resistant to Endo H, suggesting that they did not contain high mannose oligosaccharides but complex oligosaccharides and reached the trans-Golgi complex.

X

ABCC2 p.Gln1382Arg 12395335:100:14

status: NEW

Login to comment
104 The 175-kd form (band P) of the wild-type and Q1382R MRP2 were converted to the 190-kd form (band M) time dependently, and the conversion was almost completed in 60 minutes.

X

ABCC2 p.Gln1382Arg 12395335:104:46

status: NEW

Login to comment
115 On the other hand, the Q1382R MRP2 protein, which is modified with complex oligosaccharides, predominantly localized to the cell surface, especially to the apical membrane, with a distribution similar to that of the wild-type MRP2 (Fig. 6B).

X

ABCC2 p.Gln1382Arg 12395335:115:23

status: NEW

Login to comment
116 Q1382R Mutation Impairs Transport of GS-MCLB.

X

ABCC2 p.Gln1382Arg 12395335:116:0

status: NEW

Login to comment
117 Because Q1382R caused no apparent deficiency in the protein maturation process or apical sorting pro- Fig. 4.

X

ABCC2 p.Gln1382Arg 12395335:117:8

status: NEW

Login to comment
131 In stable HEK293 transfectants, as in stable LLC-PK1 transfectants (Fig. 3A), the Q1382R mutation did not affect the expression and maturation of MRP2, whereas the R768W and K677R MRP2 did not mature properly, and their expression levels were low (Fig. 7A).

X

ABCC2 p.Gln1382Arg 12395335:131:82

status: NEW

Login to comment
134 Interestingly, the GS-MCLB efflux from HEK293 cells expressing the Q1382R MRP2 was even lower than that from control cells, although the Q1382R MRP2 localized on the apical membrane as the wild-type MRP2 (Fig. 7B).

X

ABCC2 p.Gln1382Arg 12395335:134:67

status: NEW

X

ABCC2 p.Gln1382Arg 12395335:134:137

status: NEW

Login to comment
136 However, no decrease of fluorescence of intracellular GS-MCLB was observed in cells expressing the Q1382R MRP2 compared with the level in control cells (Fig. 7C).

X

ABCC2 p.Gln1382Arg 12395335:136:99

status: NEW

Login to comment
138 Taken together, these results suggest that Q1382R MRP2 localized on the apical membrane did not efflux GS-MCLB.

X

ABCC2 p.Gln1382Arg 12395335:138:43

status: NEW

Login to comment
139 Q1382R Mutation Impairs ATP-Dependent LTC4 Uptake Into Plasma Membrane Vesicles.

X

ABCC2 p.Gln1382Arg 12395335:139:0

status: NEW

Login to comment
140 Because GS-MCLB efflux could be affected by the velocity of conjugation in each transfectant, we also measured ATP-dependent LTC4 uptake into plasma membrane vesicles to examine transporter activity of the wild-type and Q1382R MRP2.

X

ABCC2 p.Gln1382Arg 12395335:140:220

status: NEW

Login to comment
141 Similar expression of MRP2 proteins was detected by Western blotting in plasma membrane vesicles from transfectants expressing wild-type and Q1382R MRP2 (Fig. 8A).

X

ABCC2 p.Gln1382Arg 12395335:141:141

status: NEW

Login to comment
144 Although the ATP-dependent uptake into membrane vesicles prepared from transfectants expressing the Q1382R MRP2 was also observed, it was as low as that into vesicles from the cells transfected by the empty vector, probably because of the activity of an endogenous ATP-dependent transport system.

X

ABCC2 p.Gln1382Arg 12395335:144:100

status: NEW

Login to comment
145 These results suggest that Q1382R MRP2 is deficient in ATP-dependent transport of LTC4.

X

ABCC2 p.Gln1382Arg 12395335:145:27

status: NEW

Login to comment
146 Q1382R Mutation Impairs Substrate Stimulation of Vanadate-Induced Nucleotide Trapping.

X

ABCC2 p.Gln1382Arg 12395335:146:0

status: NEW

Login to comment
147 It has been reported that MRP1 traps nucleotides and can be specifically photoaffinity labeled when crude membrane containing MRP1 is incubated with 8-azido-[␣-32P]ATP in the presence of excess vanadate.33,34 We examined whether human MRP2 also shows vanadate-induced nucleotide trapping (Fig. 9A) and, if so, whether the Q1382R mutation affects it (Fig. 9B).

X

ABCC2 p.Gln1382Arg 12395335:147:329

status: NEW

Login to comment
149 Crude membrane from HEK293 stable transfectants, which express similar levels of the wild-type and the Q1382R MRP2 (data not shown), was used for this experiment.

X

ABCC2 p.Gln1382Arg 12395335:149:103

status: NEW

Login to comment
153 (B) LLC-PK1 cells expressing the wild-type and Q1382R MRP2 were stained with the MRP2 antibody M2I-4.

X

ABCC2 p.Gln1382Arg 12395335:153:47

status: NEW

Login to comment
154 Vertical sections of LLC-PK1 cells expressing the wild-type and Q1382R MRP2 are shown in the lower panels.

X

ABCC2 p.Gln1382Arg 12395335:154:64

status: NEW

Login to comment
158 The Q1382R MRP2 was weakly photoaffinity labeled (Fig. 4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™ Fig. 7.

X

ABCC2 p.Gln1382Arg 12395335:158:4

status: NEW

Login to comment
163 The symbols shown are as follows: wild type (F), empty vector (Œ), R768W (ϫ), K677R (ϩ), Q1382R (I).

X

ABCC2 p.Gln1382Arg 12395335:163:107

status: NEW

Login to comment
166 LTC4 uptake into plasma membrane vesicles prepared from HEK293 cells expressing the wild-type and Q1382R MRP2.

X

ABCC2 p.Gln1382Arg 12395335:166:98

status: NEW

Login to comment
169 The symbols shown are as follows: wild type (F, E), empty vector (Œ, ‚), Q1382R (I, ᮀ), in the presence of ATP (F, Œ, I) and AMP (E, ‚, ᮀ).

X

ABCC2 p.Gln1382Arg 12395335:169:86

status: NEW

Login to comment
173 Discussion We previously reported 2 missense mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R, and 2 splice donor site mutations, 2,439 ϩ 2 (T3C) and 1,815 ϩ 2 (T3A), in the MRP2 gene in patients with DJS.12,13 In the present study, we examined the molecular consequences and biochemical basis for the defect caused by the missense mutations, R768W and Q1382R, in NBDs.

X

ABCC2 p.Gln1382Arg 12395335:173:90

status: NEW

X

ABCC2 p.Gln1382Arg 12395335:173:368

status: NEW

Login to comment
175 Interestingly, the other missense mutation Q1382R, located in NBD2, impaired substrate-induced ATP hydrolysis.

X

ABCC2 p.Gln1382Arg 12395335:175:43

status: NEW

Login to comment
176 We introduced 2 DJS-associated MRP2 mutations, R768W and Q1382R, and an artificial mutation, K677R, to the Walker A motif (Fig. 1).

X

ABCC2 p.Gln1382Arg 12395335:176:57

status: NEW

Login to comment
185 Vanadate-induced trapping of 8-azido-[␣-32P]ATP in the wild-type and Q1382R MRP2.

X

ABCC2 p.Gln1382Arg 12395335:185:76

status: NEW

Login to comment
186 Membrane proteins (2 ␮g) from HEK293 cells expressing the wild type (A), Q1382R MRP2 (B), and mock transfectant (C) were reacted with 10 ␮mol/L 8-azido-[␣-32P]ATP in the absence (lane 1) or presence of 1 mmol/L vanadate (lanes 2-5) and 10 ␮mol/L E217betaG (lane 3), 50 ␮mol/L E217betaG (lane 4), and 100 ␮mol/L E217betaG (lane 5) for 10 minutes at 37°C.

X

ABCC2 p.Gln1382Arg 12395335:186:80

status: NEW

Login to comment
190 The symbols shown are as follows: wild type (F), empty vector (Œ), and Q1382R (I).

X

ABCC2 p.Gln1382Arg 12395335:190:77

status: NEW

Login to comment
193 Another missense mutation, 4,145 (A3G) Q1382R, in NBD2 was found in one DJS patient with compound heterozygous mutants.13 The precursor form of the Q1382R MRP2 was rapidly converted to the mature form (Fig. 4), which was resistant to Endo H (Fig. 3C), and sorted to the apical membrane of the LLC-PK1 cells as the wild-type MRP2 (Fig. 6B).

X

ABCC2 p.Gln1382Arg 12395335:193:39

status: NEW

X

ABCC2 p.Gln1382Arg 12395335:193:148

status: NEW

Login to comment
194 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of MRP2.

X

ABCC2 p.Gln1382Arg 12395335:194:61

status: NEW

Login to comment
195 However, efflux of GS-MCLB and ATP-dependent LTC4 uptake into plasma membrane vesicles from HEK293 cells expressing the Q1382R MRP2 were markedly reduced compared with that from cells expressing the wild-type MRP2 (Figs.

X

ABCC2 p.Gln1382Arg 12395335:195:120

status: NEW

Login to comment
197 This indicated that the Q1382R MRP2 localized on the apical membrane was nonfunctional.

X

ABCC2 p.Gln1382Arg 12395335:197:24

status: NEW

Login to comment
198 To assess the functional integrity of the Q1382R MRP2, we examined vanadate-induced nucleotide trapping by using 8-azido-[␣-32P]ATP.

X

ABCC2 p.Gln1382Arg 12395335:198:42

status: NEW

Login to comment
200 Vanadate-induced nucleotide trapping in the wild-type MRP2 was stimulated by E217betaG in a concentration-dependent manner but that in Q1382R MRP2 was not (Fig. 9).

X

ABCC2 p.Gln1382Arg 12395335:200:135

status: NEW

Login to comment
203 These results suggest that 8-azido-[␣-32P]ATP is trapped with vanadate after hydrolysis and that the Q1382R mutation impaired substrate-induced ATP hydrolysis.

X

ABCC2 p.Gln1382Arg 12395335:203:108

status: NEW

Login to comment
207 However, the role of the glutamine in the Q-loop has been controversial because the correspondent glutamine residue in the malK molecule was suggested to be placed too far away from the nucleotide to coordinate Mg2ϩ and the water molecule that attacks the ␥-phosphate bond.40 In the present study, the lack of substrate-induced vanadate trapping in the Q1382R MRP2 may suggest that Q1382 is directly involved in ATP hydrolysis.

X

ABCC2 p.Gln1382Arg 12395335:207:366

status: NEW

Login to comment
208 In conclusion, introduction of a DJS mutation R768W as well as the Walker A lysine mutation K677R resulted in abortive maturation and sorting of MRP2, whereas another DJS mutation, Q1382R, did not affect maturation or sorting but impaired the substrate-induced ATP hydrolysis.

X

ABCC2 p.Gln1382Arg 12395335:208:181

status: NEW

Login to comment

223 These mutations include two missense mutations (R768Y, Q1382R), a nonsense mutation (R1066stop), three splice site mutations (1815ϩ2, T3A; 1967ϩ2, T3C; 2439ϩ2, T3C) and a deletion mutation (4175del6).

X

ABCC2 p.Gln1382Arg 11477083:223:55

status: NEW

Login to comment

25 We previously had isolated the human MRP2/cMOAT gene as the candidate transporter for the glucuronide- Table 1 Mutations in MRP2/cMOAT and Serum Total- and Direct-Bilirubin and Urinary Coproporphyrine Isomer I Fractions, in Patients with DJS and in Their Families PEDIGREE AND PATIENT/ FAMILY MEMBER ALTERATION IN cMAOT EXON PUTATIVE CONSEQUENCE CONCENTRATION [NORMAL RANGE]a T-bilirubin [.3-1.0] (mg/dl) D-bilirubin [.1-.6] (mg/dl) Urinary Coproporphyrin I Fraction [!27]b (%) 1: DJ1 2302(CrT)/2302(CrT) 18 R768W/R768W 5.0 3.8 NT 2: DJ2 2302(CrT)/wild type 18 R768W/wild type NT NT 42.1 DJ3 2439ϩ2(TrC)/wild type 18 Splice donor/wild type NT NT 43.5 DJ4 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 94.5 DJ5 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 93.6 DJ6 Wild type/wild type ) Wild type/wild type NT NT NT 3: DJ7 1815ϩ2(TrA)/1815ϩ2(TrA) 13 Splice donor/splice donor 5.2 3.8 NT 4: DJ8 2302(CrT)/2302(CrT) 18 R768W/R768W 4.8 3.2 NT 5: DJ9 2439ϩ2(TrC)/4145(ArG) 18/29 Splice donor/Q1382R 2.5 1.6 80.0 6: DJ10 2439ϩ2(TrC)/2439ϩ2(TrC) 18 Splice donor/splice donor 2.1 1.6 85.7 DJ11 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .9 .4 48.0 DJ12 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .5 .2 36.9 a NT ϭ not tested.

X

ABCC2 p.Gln1382Arg 10053008:25:1036

status: NEW

Login to comment
84 The third alteration resulted in amino acid substitution Q1382R in the position at the ABC region.

X

ABCC2 p.Gln1382Arg 10053008:84:57

status: NEW

Login to comment
104 The third mutation is 4145(ArG), which predicts amino acid change Gln1382 rArg (Q1382R) within the ABC at the carboxyl-terminal end.

X

ABCC2 p.Gln1382Arg 10053008:104:80

status: NEW

Login to comment

30 Mutations in the ATP-binding site also disrupt function, such as G1302R in the Pseudoxanthoma elasticum- associated ABCC6 gene.15 Finally, mutations such as the Dubin-Johnson syndrome-associated Q1382R in ABCC2 are in a mobile region of the NBD (the ''Q-loop``) that is hypothesized to transmit a conformational change between the NBDs and TMDs of an ABC transporter.16 While it is preferable to experimentally characterize the effects of each of the thousands of reported variants in ABC transporters, this approach is not feasible given the large number of variants.

X

ABCC2 p.Gln1382Arg 20799350:30:195

status: NEW

Login to comment

331 The two missence mutations were C2302T transition in exon 18, resulting in amino acid replacement Arg768Trp in the active transport family signature motif; and A4145G transition in exon 29, resulting in amino acid substitution Gln1382Arg in the position within the ABC signature motif at the C-terminal end.

X

ABCC2 p.Gln1382Arg 16815813:331:227

status: NEW

Login to comment