ABCMdb

ABCB3 p.Met285Cys

Predicted by SNAP2:	A: N (57%), C: N (72%), D: D (80%), E: D (80%), F: D (66%), G: D (63%), H: D (71%), I: N (57%), K: D (80%), L: N (61%), N: D (75%), P: D (80%), Q: D (71%), R: D (80%), S: D (63%), T: D (66%), V: N (53%), W: D (75%), Y: D (66%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Mechanism of substrate sensing and signal transmis... J Biol Chem. 2007 Feb 9;282(6):3871-80. Epub 2006 Dec 12. Herget M, Oancea G, Schrodt S, Karas M, Tampe R, Abele R
Mechanism of substrate sensing and signal transmission within an ABC transporter: use of a Trojan horse strategy.
J Biol Chem. 2007 Feb 9;282(6):3871-80. Epub 2006 Dec 12., [PMID:17164240]

Abstract [show]
By translocating proteasomal degradation products into the endoplasmic reticulum for loading of major histocompatibility complex I molecules, the ABC transporter TAP plays a focal role in the adaptive immunity against infected or malignantly transformed cells. A key question regarding the transport mechanism is how the quality of the incoming peptide is detected and how this information is transmitted to the ATPase domains. To identify residues involved in this process, we evolved a Trojan horse strategy in which a small artificial protease is inserted into antigenic epitopes. After binding, the TAP backbone in contact is cleaved, allowing the peptide sensor site to be mapped by mass spectrometry. Within this sensor site, we identified residues that are essential for tight coupling of peptide binding and transport. This sensor and transmission interface is restructured during the ATP hydrolysis cycle, emphasizing its important function in the cross-talk between the transmembrane and the nucleotide-binding domains. This allocrite sensor may be similarly positioned in other members of the ABC exporter family.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Expression of Human TAP Mutants-The single cysteine TAP1 mutants, Q277C, G282C, N283C, I284C, M285C, S286C, R287C, V288C, and R659C, were generated by ligase chain reaction with the following primers using cysteine-less human TAP1 with a C-terminal His10 tag as template (16): Q277C, CCGAATTCTTCCAGTGCAACCAGACCGC; G282C, GCA- GAACCAGACCTGCAACATCATGTCC; N283C, CAGAAC- CAGACCGGCTGCATCATGTCCAGAG; I284C, GACCGG- CAACTGCATGTCCAGAG; M285C, GACCGGCAACAT- CTGCTCCAGAGTCACCGAAG; S286C, GGCAACATCAT- GTGTAGAGTCACCGAAGA; R287C, GCAACATCATGTC- CTGCGTCACCGAAGATAC; V288C, CGGCAACATCAT- GTCCAGATGCACCGAAGATACG; and R659C, CAAGC- CTCTGCCTCAGTACG. Login to comment
40 Expression of Human TAP Mutants-The single cysteine TAP1 mutants, Q277C, G282C, N283C, I284C, M285C, S286C, R287C, V288C, and R659C, were generated by ligase chain reaction with the following primers using cysteine-less human TAP1 with a C-terminal His10 tag as template (16): Q277C, CCGAATTCTTCCAGTGCAACCAGACCGC; G282C, GCA- GAACCAGACCTGCAACATCATGTCC; N283C, CAGAAC- CAGACCGGCTGCATCATGTCCAGAG; I284C, GACCGG- CAACTGCATGTCCAGAG; M285C, GACCGGCAACAT- CTGCTCCAGAGTCACCGAAG; S286C, GGCAACATCAT- GTGTAGAGTCACCGAAGA; R287C, GCAACATCATGTC- CTGCGTCACCGAAGATAC; V288C, CGGCAACATCAT- GTCCAGATGCACCGAAGATACG; and R659C, CAAGC- CTCTGCCTCAGTACG. Login to comment