ABCMdb

ABCB2 p.Ile379Val

Predicted by SNAP2:	A: N (53%), C: N (72%), D: D (80%), E: D (71%), F: N (97%), G: D (66%), H: D (59%), K: D (75%), L: N (93%), M: N (66%), N: D (66%), P: D (80%), Q: D (66%), R: D (71%), S: N (53%), T: D (53%), V: N (93%), W: D (75%), Y: N (78%),
Predicted by PROVEAN:	A: N, C: N, D: D, E: D, F: N, G: D, H: N, K: D, L: N, M: N, N: D, P: D, Q: D, R: D, S: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Genetic variants in TAP are associated with high-g... Clin Cancer Res. 2009 Feb 1;15(3):1019-23. Einstein MH, Leanza S, Chiu LG, Schlecht NF, Goldberg GL, Steinberg BM, Burk RD
Genetic variants in TAP are associated with high-grade cervical neoplasia.
Clin Cancer Res. 2009 Feb 1;15(3):1019-23., [PMID:19188174]

Abstract [show]
PURPOSE: The transporter associated with antigen processing (TAP) is essential in assembling MHC-I proteins. Human papillomavirus (HPV) evades immune recognition by decreasing class I MHC cell surface expression through down-regulation of TAP1 levels. Consistent with heterogeneity in MHC expression is the individual variability in clearing detectable HPV infections. Genetic polymorphisms in TAP genes may affect protein structure, function, and the ability to clear HPV infection. EXPERIMENTAL DESIGN: Case-control study of women with cervical intraepithelial neoplasia (CIN) II or III (n = 114) and women without high-grade CIN (n = 366). Five nonsynonymous single nucleotide polymorphisms (SNP) in TAP1 and TAP2 were genotyped using DNA collected in cervicovaginal lavage samples using microsphere array technology (Luminex xMAP). HPV typing was done using a PCR-based system with MY09/MY11 primers. TAP1 and TAP2 SNPs were validated by direct sequencing. RESULTS: Differences in allele distribution between women with high-grade cervical neoplasia and women without was seen for TAP1 I333V (P = 0.02) and TAP1 D637G (P = 0.01). The odds ratios (OR) for CIN III were significantly lower among carriers of the TAP1 I333V polymorphism (OR, 0.28; 95% confidence interval, 0.1-0.8), and TAP1 D637G polymorphism (OR, 0.27; 95% confidence interval, 0.1-0.7). These associations remained significant even after restricting the evaluation to women who were positive for high-risk HPV types. CONCLUSIONS: In addition to the down-regulation of MHC-1 by oncogenic HPV, HPV pathogenesis might be facilitated by polymorphisms in the TAP proteins. Identifying TAP polymorphisms may potentially be used to identify women less susceptible to progression to high-grade CIN and cervical cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment
56 For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment
60 The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 AL multiplex PCR using primer sets previously reported (11). Login to comment
103 Oligonucleotide probe sequences (5¶-3¶) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment
117 For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment
131 Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment
132 Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment
46 Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment
49 For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment
96 Oligonucleotide probe sequences (5&#b6;-3&#b6;) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment
110 For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment
124 Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment
125 Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment
45 Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment
48 For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment
52 The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 AL multiplex PCR using primer sets previously reported (11). Login to comment
95 Oligonucleotide probe sequences (5&#b6;-3&#b6;) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment
108 For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment
122 Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment
123 Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment

[hide] Genetic control of alternative splicing in the TAP... Diabetes. 2007 Jan;56(1):270-5. Qu HQ, Lu Y, Marchand L, Bacot F, Frechette R, Tessier MC, Montpetit A, Polychronakos C
Genetic control of alternative splicing in the TAP2 gene: possible implication in the genetics of type 1 diabetes.
Diabetes. 2007 Jan;56(1):270-5., [PMID:17192492]

Abstract [show]
The transporter 2, ATP-binding cassette, subfamily B (TAP2) is involved in the transport of antigenic peptides to HLA molecules. Coding TAP2 polymorphisms shows a strong association with type 1 diabetes, but it is not clear whether this association may be entirely due to linkage disequilibrium with HLA DR and DQ. Functionally, rat Tap2 nonsynonymous single-nucleotide polymorphisms (nsSNPs) confer differential selectivity for antigenic peptides, but this was not shown to be the case for human TAP2 nsSNPs. In the human, differential peptide selectivity is rather conferred by two splicing isoforms with alternative carboxy terminals. Here, we tested the hypothesis that alleles at the coding SNPs favor different splicing isoforms, thus determining peptide selectivity indirectly. This may be the basis for independent contribution to the type 1 diabetes association. In RNA from heterozygous lymphoblastoid lines, we measured the relative abundance of each SNP haplotype in each isoform. In isoform NM_000544, the G (Ala) allele at 665 Thr>Ala (rs241447) is more than twice as abundant as A (Thr) (GA = 2.2 +/- 0.4, P = 1.5 x 10(-4)), while isoform NM_018833 is derived almost exclusively from chromosomes carrying A (AG = 18.1 +/- 5.6, P = 2.04 x 10(-7)). In 889 Canadian children with type 1 diabetes, differential transmission of parental TAP2 alleles persisted (P = 0.011) when analysis was confined to chromosomes carrying only DQ*02 alleles, which mark a conserved DR-DQ haplotype, thus eliminating most of the variation at DR-DQ. Thus, we present evidence of TAP2 association with type 1 diabetes that is independent of HLA DR-DQ and describe a plausible functional mechanism based on allele dependence of splicing into isoforms known to have differential peptide selectivities.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 TABLE 1 Transmission disequilibrium tests of the TAP2 SNPs SNP ID Position Minor allele (frequency) Hardy-Weinberg P Allele transmission counts (overtransmitted allele) ␹2 (P value) OR (95% CI)* rs2071552 (C/T) 5Ј UTR T (0.495) 0.395 431:279 (C) 32.5 (1.17 ϫ 10-8 ) 0.65 (0.56-0.75) rs1800454 (A/G) Exon 6 (I379V) A (0.100) 0.431 155:72 (G) 30.3 (3.61 ϫ 10-8 ) 0.47 (0.35-0.62) rs2228396 (A/G) Exon 10 (T565A) A (0.059) 1.000 61:46 (G) 2.1 (0.147) 0.75 (0.51-1.11) rs4148876 (C/T) Exon 12 (C651R) T (0.102) 1.000 163:79 (T) 29.2 (6.67 ϫ 10-8 ) 2.06 (1.58-2.70) rs241447 (A/G) Exon 12 (A665T) G (0.213) 0.190 332:143 (A) 75.2 (4.25 ϫ 10-18 ) 0.43 (0.35-0.52) rs241448 (C/T) Exon 12 (Q687Ter) C (0.215) 0.190 329:147 (T) 69.6 (7.31 ϫ 10-17 ) 0.45 (0.37-0.54) *Odds ratio of minor allele. Login to comment
84 TABLE 1 Transmission disequilibrium tests of the TAP2 SNPs SNP ID Position Minor allele (frequency) Hardy-Weinberg P Allele transmission counts (overtransmitted allele) ই2 (P value) OR (95% CI)* rs2071552 (C/T) 5b18; UTR T (0.495) 0.395 431:279 (C) 32.5 (1.17 afb; 10afa;8 ) 0.65 (0.56-0.75) rs1800454 (A/G) Exon 6 (I379V) A (0.100) 0.431 155:72 (G) 30.3 (3.61 afb; 10afa;8 ) 0.47 (0.35-0.62) rs2228396 (A/G) Exon 10 (T565A) A (0.059) 1.000 61:46 (G) 2.1 (0.147) 0.75 (0.51-1.11) rs4148876 (C/T) Exon 12 (C651R) T (0.102) 1.000 163:79 (T) 29.2 (6.67 afb; 10afa;8 ) 2.06 (1.58-2.70) rs241447 (A/G) Exon 12 (A665T) G (0.213) 0.190 332:143 (A) 75.2 (4.25 afb; 10afa;18 ) 0.43 (0.35-0.52) rs241448 (C/T) Exon 12 (Q687Ter) C (0.215) 0.190 329:147 (T) 69.6 (7.31 afb; 10afa;17 ) 0.45 (0.37-0.54) *Odds ratio of minor allele. Login to comment

[hide] Distribution of TAP gene polymorphisms and extende... Genes Immun. 2002 Apr;3(2):78-85. Balladares S, Alaez C, Pujol J, Duran C, Navarro JL, Gorodezky C
Distribution of TAP gene polymorphisms and extended MHC haplotypes in Mexican Mestizos and in Seri Indians from northwest Mexico.
Genes Immun. 2002 Apr;3(2):78-85., [PMID:11960305]

Abstract [show]
The study of the genetic structure is very useful for investigating the biological significance of polymorphism and may provide clues to understand population origins. We present TAP1/TAP2 gene analysis in the Seri indians from Sonora, and in Mestizos from the highlands of Mexico. Thirty-two Seri and 89 Mestizos were studied. TAP genes were typed using the ARMS-PCR technique. The most frequent alleles in Seri were: TAP1*0101/02, (68.8%); TAP1*02011/02012, (31.2%); TAP2*0201, (38.7%) and TAP2*0101, (29.0%). TAP1*0301, TAP1*0401, TAP2*0102 TAP2*0103 and TAP2H were absent in them. For Mestizos, the prevalent alleles were: TAP1*0101/02 (75.8%); TAP1*02011/12 (20.3%); TAP2*0101 (45.4%) and TAP2*0201 (29.3%). These results are similar to those found in Kaingang and Caucasians from Brazil, four Mediterranean, other Caucasians, two Oriental and one African group. In Seri, the extended prevalent haplotypes are typically Amerindian, such as TAP1*0101/2-TAP2*0201-QBP3.21-DQB1*0302-QAP*3.1-DQA1*03011-DRB1*0407-B*3501-A*020 1 (HF = 16.6%). Thirty-two extended haplotypes were found in Seri, although TAP contributed scarcely to diversity. Mestizos show Amerindian and Caucasian combinations. No difference was detected in the distribution of amino acids in the individual variable sites, between both groups. These findings are the basis for further anthropological studies and to explore the contribution of TAP genes to disease expression in Mexicans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 For TAP2, three dimorphic sites have been described: ILE379VAL, ALA565THR and ALA665THR; the different combinations result in eight distinct alleles, described in Table 1.3,4 Four of them have not been Correspondence: Dr C Gorodezky, Head of The Department of Immunogenetics, InDRE, SSA, Carpio 470-1st floor. Login to comment

[hide] HLA-DR, HLA-DQ, and TAP genes in familial Hodgkin ... Blood. 2002 Jan 15;99(2):690-3. Harty LC, Lin AY, Goldstein AM, Jaffe ES, Carrington M, Tucker MA, Modi WS
HLA-DR, HLA-DQ, and TAP genes in familial Hodgkin disease.
Blood. 2002 Jan 15;99(2):690-3., [PMID:11781255]

Abstract [show]
The HLA region has long been implicated in sporadic and familial Hodgkin disease (HD), with recent case-control studies suggesting that HLA class II loci predispose to sporadic nodular sclerosis HD (NSHD). To determine whether this predisposition extends to familial HD, HLA class II loci (DRB1, DQA1, DQB1, DRB3, DRB4, and DRB5) and transporter associated with antigen processing (TAP) loci (TAP1, TAP2) were investigated in 100 members of 16 families with at least 2 confirmed cases of HD. With the use of the transmission disequilibrium test, evidence for linkage disequilibrium with familial HD and, in particular, familial NSHD was obtained for the DRB1*1501-DQA1*0102-DQB1*0602 haplotype, the TAP1 allele encoding Ile at residue 333, and the DRB5-0101 allele. These 3 markers were in linkage disequilibrium and may not represent independent susceptibility regions. Use of a family-based approach excludes population stratification as an explanation for these findings.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 It was necessary to exclude one family from analysis for one locus (TAP2 Ile379Val) because one parent was unavailable, the other parent and the offspring were heterozygous, and the transmitted allele could not be determined. Login to comment
66 Transmission-disequilibrium test results for linkage between familial Hodgkin disease and noncandidate alleles at HLA class II and transporter associated with antigen processing loci, National Cancer Institute, Bethesda, MD, 1978-1993 All familial HD (n ϭ 28) Familial NSHD only (n ϭ 23) Unaffected siblings (n ϭ 40)¶ T NT ␹2 P† T NT ␹2 P† T NT ␹2 P† DRB1 *0301 1 6 3.57 .24 - - - - 7 9 0.25 - *0401 5 4 0.11 - 3 4 0.14 Ͼ .99 11 5 2.25 .53 *1300 3 6 1.00 - 3 4 0.14 Ͼ .99 5 3 0.50 - All others‡ 36 29 - - 32 30 - - 13 14 - - Total 45 45 4.07 .25 38 38 0.23 .97 64 64 2.27 .52 DQA1 *0101 5 7 0.33 - 1 7 4.50 - 7 8 0.07 - *0102 19 9 3.57 .29 19 5 8.17 .02 18 20 0.11 - *0301 5 5 0.00 - 3 5 0.50 - 8 6 0.29 Ͼ .99 *0501 11 12 0.04 - 10 9 0.05 - 14 13 0.04 - All others‡ 3 10 - - 3 10 - - 9 9 - - Total 43 43 6.17 .19 36 36 13.59 .01 56 56 0.41 .98 DQB1 *201 3 11 4.57 .13 3 8 2.27 .53 9 13 0.73 - *0301 10 6 1.00 - 7 6 0.08 - 11 6 1.47 .90 *0302 2 5 1.29 - 2 5 1.29 - 7 4 0.82 - All others‡ 25 18 - - 21 14 - - 26 30 - - Total 40 40 6.00 .11 33 33 3.78 .29 53 53 2.48 .48 DRB1-DQA1-DQB1 *0301-*0501-*0201 1 6 3.57 .18 - - - - 7 9 0.25 - *0701-*0201-*0201 2 5 1.29 - 2 5 1.29 .77 4 6 0.40 Ͼ .99 All others‡ 42 34 - - 36 33 - - 46 42 - - Total 45 45 3.80 .15 38 38 0.71 .70 57 57 0.55 .76 DRB3-5 DRB3*0101 2 6 2.00 - - - - - 4 10 2.57 .54 DRB3*0202 7 5 0.33 - 5 5 0.00 - 8 5 0.69 - DRB4*0101 7 13 1.80 - 5 13 3.56 - 16 13 0.31 - DRB5*0101 16 6 4.55 .16 16 5 5.76 .08 12 15 0.33 - All others‡ 5 7 - - 5 8 - - 11 8 - - Total 37 37 7.20 .13 31 31 7.51 .11 51 51 3.50 .48 TAP1 Ile333Val Ile 14 6 3.20 .07 12 3 5.40 .02 15 13 0.14 .71 TAP1 Asp637Gly Asp 7 6 0.08 .78 5 4 0.11 .74 14 7 2.33 .13 TAP2 Ile379Val Ile 5 5 0.00 Ͼ .99 3 5 0.50 .48 9 3 3.00 .08 TAP2 Ala665Thr Ala 5 4 0.11 .74 3 4 0.14 .71 5 7 0.33 .57 Noncandidate alleles either were not significantly associated with sporadic Hodgkin disease or were not evaluated in the study by Klitz et al.16 TAP indicates transporter associated with antigen processing. Login to comment
33 It was necessary to exclude one family from analysis for one locus (TAP2 Ile379Val) because one parent was unavailable, the other parent and the offspring were heterozygous, and the transmitted allele could not be determined. Login to comment
64 Transmission-disequilibrium test results for linkage between familial Hodgkin disease and noncandidate alleles at HLA class II and transporter associated with antigen processing loci, National Cancer Institute, Bethesda, MD, 1978-1993 All familial HD (n afd; 28) Familial NSHD only (n afd; 23) Unaffected siblings (n afd; 40)&#b6; T NT ই2 Pߤ T NT ই2 Pߤ T NT ই2 Pߤ DRB1 *0301 1 6 3.57 .24 - - - - 7 9 0.25 - *0401 5 4 0.11 - 3 4 0.14 b0e; .99 11 5 2.25 .53 *1300 3 6 1.00 - 3 4 0.14 b0e; .99 5 3 0.50 - All othersߥ 36 29 - - 32 30 - - 13 14 - - Total 45 45 4.07 .25 38 38 0.23 .97 64 64 2.27 .52 DQA1 *0101 5 7 0.33 - 1 7 4.50 - 7 8 0.07 - *0102 19 9 3.57 .29 19 5 8.17 .02 18 20 0.11 - *0301 5 5 0.00 - 3 5 0.50 - 8 6 0.29 b0e; .99 *0501 11 12 0.04 - 10 9 0.05 - 14 13 0.04 - All othersߥ 3 10 - - 3 10 - - 9 9 - - Total 43 43 6.17 .19 36 36 13.59 .01 56 56 0.41 .98 DQB1 *201 3 11 4.57 .13 3 8 2.27 .53 9 13 0.73 - *0301 10 6 1.00 - 7 6 0.08 - 11 6 1.47 .90 *0302 2 5 1.29 - 2 5 1.29 - 7 4 0.82 - All othersߥ 25 18 - - 21 14 - - 26 30 - - Total 40 40 6.00 .11 33 33 3.78 .29 53 53 2.48 .48 DRB1-DQA1-DQB1 *0301-*0501-*0201 1 6 3.57 .18 - - - - 7 9 0.25 - *0701-*0201-*0201 2 5 1.29 - 2 5 1.29 .77 4 6 0.40 b0e; .99 All othersߥ 42 34 - - 36 33 - - 46 42 - - Total 45 45 3.80 .15 38 38 0.71 .70 57 57 0.55 .76 DRB3-5 DRB3*0101 2 6 2.00 - - - - - 4 10 2.57 .54 DRB3*0202 7 5 0.33 - 5 5 0.00 - 8 5 0.69 - DRB4*0101 7 13 1.80 - 5 13 3.56 - 16 13 0.31 - DRB5*0101 16 6 4.55 .16 16 5 5.76 .08 12 15 0.33 - All othersߥ 5 7 - - 5 8 - - 11 8 - - Total 37 37 7.20 .13 31 31 7.51 .11 51 51 3.50 .48 TAP1 Ile333Val Ile 14 6 3.20 .07 12 3 5.40 .02 15 13 0.14 .71 TAP1 Asp637Gly Asp 7 6 0.08 .78 5 4 0.11 .74 14 7 2.33 .13 TAP2 Ile379Val Ile 5 5 0.00 b0e; .99 3 5 0.50 .48 9 3 3.00 .08 TAP2 Ala665Thr Ala 5 4 0.11 .74 3 4 0.14 .71 5 7 0.33 .57 Noncandidate alleles either were not significantly associated with sporadic Hodgkin disease or were not evaluated in the study by Klitz et al.16 TAP indicates transporter associated with antigen processing. Login to comment

[hide] Alleles and haplotypes of the MHC-encoded ABC tran... Immunogenetics. 1993;37(5):373-80. Powis SH, Tonks S, Mockridge I, Kelly AP, Bodmer JG, Trowsdale J
Alleles and haplotypes of the MHC-encoded ABC transporters TAP1 and TAP2.
Immunogenetics. 1993;37(5):373-80., [PMID:8428770]

Abstract [show]
TAP1 and TAP2 are two major histocompatibility complex (MHC) genes, located between HLA-DP and -DQ, whose products form a transporter molecule involved in endogenous antigen processing. Polymorphic residues have been described in both genes and, in this study, we have identified another polymorphic site within the adenosine triphosphate (ATP)-binding domain of TAP2. We have used the amplification refractory mutation system (ARMS) polymerase chain reaction (PCR) to characterize TAP1 and TAP2 alleles and haplotypes in a reference panel of 115 homozygous typing cell lines. Of four possible TAP1 alleles, we observed three, and of eight possible TAP2 alleles, we observed five. Among 88 (homozygous typing cells) (HTCs) homozygous at HLA-DR, -DQ and -DP, 80 were also homozygous at TAP1 and TAP2. Of 27 HTCs homozygous at HLA-DR and -DQ, but heterozygous at -DP, 14 were homozygous at TAP1 or TAP2 and 13 heterozygous, consistent with recombination taking place either side of the TAP loci. Of the fifteen possible combinations of TAP1 and TAP2 alleles, we observed eleven, each at a frequency similar to that predicted by individual allele frequencies. In this ethnically heterogenous panel there is no indication that particular combinations of TAP1 and TAP2 have been maintained together.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 A third variable site within the protein sequence of TAP2 was inferred from the cDNA sequence published by Bahrain and co-workers (1991), which contained the substitution Ile for Val at position 379. Login to comment

[hide] Genotyping TAP2 variants in North American Caucasi... Genes Immun. 2001 Feb;2(1):32-40. Tang J, Freedman DO, Allen S, Karita E, Musonda R, Braga C, Jamieson BD, Louie L, Kaslow RA
Genotyping TAP2 variants in North American Caucasians, Brazilians, and Africans.
Genes Immun. 2001 Feb;2(1):32-40., [PMID:11294565]

Abstract [show]
The protein forms of transporter associated with antigen processing, subunit 2 (TAP2), differ either by amino acid substitutions (Thr374Ala, Ile379Val, Ile467Val, Thr565Ala, Val577Met, Cys651Arg, and Ala665Thr) or by a truncation (Gln687Stop) of 17 amino acid residues at the C-terminus. Nonsynonymous single nucleotide polymorphisms (N-SNPs) causing these amino acid variations except 577Val were detected in genomic DNA samples from North American Caucasians (n = 76), Brazilians (n = 148), Rwandans (n = 285), and Zambians (n = 117). Exclusive (100%) and nearly exclusive (>95%) linkage disequilibrium was seen with a number of N-SNPs. The average heterozygosity at any given dimorphic site ranged from 7.3% to 44.6%, and at least four N-SNPs showed clear population specificity. N-SNP combinations alone led to the identification of 16 relatively common alleles, which appeared to form at least three lineages. Further analyses of 101 cDNA samples from Brazilians detected nine expressed TAP2 alleles, four of which matched the official assignments. Genetic complexity at the TAP2 locus was further enhanced by two out of five synonymous SNPs (S-SNPs), especially the GGT386GGG (Gly) that had similar heterozygosity rates in Caucasians (28.9%), Rwandans (33.3%), and Zambians (33.3%). Overall, distribution of both synonymous and nonsynonymous SNPs in the various ethnic groups examined here conformed well to the Hardy-Weinberg equilibrium, and between 57.9% and 77.0% of subjects in each ethnic group were heterozygous with two TAP2 alleles predicted to differ by at least one amino acid residue. Such complexity of TAP2 polymorphisms, in the form of SNPs as well as alleles, is likely to complicate the analyses of disease associations and haplotype structures in the HLA class II region.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 In particular, complete equilibrium between GGT386GGG, I379V, A665T, and Q687Stop further separated a number of protein-coding alleles into pairs of nucleotide sequences. Login to comment
79 The complexity of TAP2 polymorphisms, as implied in our identification Table 2 Frequency and heterozygosity of TAP2 single nucleotide polymorphisms (SNPs) observed in four ethnic groups SNP sequencesa T374A I379V I467V T565A C651R A665T Q687Stop GGT386GGG AAT436AAC Caucasians (n = 76) SNP frequencies: 1.000 0.816 1.000 0.993 0.947 0.849 0.849 0.814 0.908 0.000 0.184 0.000 0.007 0.053 0.151 0.151 0.184 0.092 Heterozygosity: Observed 0 31.6% 0 1.3% 10.5% 25.0% 25.0% 28.9% 18.4% Expected 0 30.0% 0 1.4% 10.0% 25.7% 25.7% 30.0% 16.7% Brazilians (n = 148) SNP frequencies: 0.980 0.868 0.983 0.899 0.960 0.676 0.676 nd nd 0.020 0.132 0.017 0.101 0.040 0.324 0.324 nd nd Heterozygosity: Observed 4.0% 25.0% 3.4% 20.3% 8.1% 54.7%b 54.7%b nd nd Expected 3.9% 22.9% 3.3% 18.2% 7.7% 43.8% 43.8% nd nd Rwandans (n = 285) SNP frequencies: 0.933 0.882 0.947 1.000 0.900 0.698 0.694 0.806 0.993 0.067 0.118 0.053 0.000 0.100 0.302 0.306 0.194 0.007 Heterozygosity: Observed 13.0% 22.5% 10.2% 0 18.6% 43.1% 45.3% 33.3% 1.4% Expected 12.5% 20.8% 10.0% 0 18.0% 42.2% 42.4% 31.3% 11.4% Zambians (n = 117) SNP frequencies: 0.932 0.898 0.949 0.817 1.000 0.765 0.752 0.778 0 0.068 0.102 0.051 0.183 0 0.235 0.248 0.222 0 Heterozygosity: Observed 13.7% 18.8% 10.3% 35.0% 0 40.2% 42.7% 33.3% 0 Expected 12.7% 18.3% 9.7% 29.9% 0 36.0% 37.3% 34.5% 0 Average 9.4% 23.5% 7.3% 11.5% 11.7% 43.1% 44.6% 32.6% 5.1% heterozygosity a At each codon position the less common amino acid or nucleotide sequence is listed first and/or underlined as defined in Figure 1. b P = 0.185 compared with the expected frequency. Login to comment
98 In addition, when cDNA served as the templates, PCR with combinations of the SNP-specific primers was able to link T374A, I379V with I467V, as well as T565A, C651R with A665T. Login to comment