ABCMdb

ABCB2 p.Ile379Val

None has been submitted yet.

Publications

PMID: 19188174 [PubMed] Einstein MH et al: "Genetic variants in TAP are associated with high-grade cervical neoplasia."

No. Sentence Comment

53 Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment
56 For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment
60 The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 AL multiplex PCR using primer sets previously reported (11). Login to comment
103 Oligonucleotide probe sequences (5¶-3¶) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment
117 For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment
131 Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment
132 Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment
46 Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment
49 For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment
96 Oligonucleotide probe sequences (5&#b6;-3&#b6;) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment
110 For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment
124 Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment
125 Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment
45 Genotyping of two single nucleotide polymorphisms (SNP) in the TAP1 gene (I333V and D637G) and 3 SNPs in the TAP2 gene (I379V, A665T, and Q687STOP) was done (see Table 1 for sequences). Login to comment
48 For the remaining four SNPs (I333V, I379V, A665T, and Q687STOP), a multiplex PCR was done followed by a microsphere-based oligonucleotide ligation assay (OLA). Login to comment
52 The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 AL multiplex PCR using primer sets previously reported (11). Login to comment
95 Oligonucleotide probe sequences (5&#b6;-3&#b6;) for TAP polymorphisms SNP Allele Allele Specific Probes* Reporter Probesc TAP1 I333V A tag65-TCACCATGGTCACCCTGA TCACCCTGCCTCTGCTTTT G tag1-CACCATGGTCACCCTGG TAP2 I379V G tag37-AACCGCCTTGTACCTGCTCG TAAGGAGGGTAAGATACCAGA A tag30-AACGCGCCTTGTACCTGCTCA TAP1 A655T G tag18-TTGCTCACAGGCTGCAGG CAGTTCAGCGCGCCCA A tag12-ATTGCTCACAGGCTGCAGA TAP2 Q687STOP T tag72-AGAAGCTTGCCCAGCTCT AGGAGGGACAGGACCTC C tag69-GAAGCTTGCCCAGCTCC *TAG-IT software (TM Biosciences) was used to determine the TAG assignments for the allele specific probes. Login to comment
108 For TAP2 gene alleles, a protective association with dysplasia was observed only for heterozygote and homozygote carriers of the variant TAP2 I379V (G) allele, albeit with borderline significance (Table 3A). Login to comment
122 Multivariable association between cervical dysplasia and TAP genotypes SNP Genotype CINI CINII CINIII Ptrend c OR* (95% CI) OR* (95% CI) OR* (95% CI) TAP1 I333V AA vs AG/GG 0.87 (0.4-1.8) 0.50 (0.2-1.3) 0.28 (0.1-0.8) 0.01 TAP1 D637G AA vs AG/GG 0.76 (0.4-1.4) 0.42 (0.2-1.0) 0.27 (0.1-0.7) 0.00 TAP2 I379V GG vs AG/AA 0.57 (0.3-1.1) 0.31 (0.1-0.8) 0.47 (0.2-1.2) 0.02 TAP2 A665T AA vs AG/GG 1.04 (0.6-1.9) 1.45 (0.7-3.1) 0.77 (0.3-1.8) 0.97 TAP2 Q687STOP TT vs TC/CC 0.76 (0.4-1.4) 1.06 (0.5-2.4) 0.70 (0.3-1.6) 0.62 B. Login to comment
123 Multivariable association between cervical dysplasia and TAP genotypes in women with high-risk HPV TAP1 I333V AA vs AG/GG 0.91 (0.3-2.4) 0.53 (0.2-1.7) 0.28 (0.1-1.0) 0.03 TAP1 D637G AA vs AG/GG 0.40 (0.2-1.0) 0.21 (0.1-0.6) 0.14 (0.0-0.4) 0.00 TAP2 I379V GG vs AG/AA 0.42 (0.2-1.1) 0.31 (0.1-1.0) 0.51 (0.2-1.7) 0.20 TAP2 A665T AA vs AG/GG 0.88 (0.4-2.2) 1.29 (0.5-3.6) 0.84 (0.3-2.5) 0.82 TAP2 Q687STOP TT vs TC/CC 0.77 (0.3-2.0) 1.25 (0.4-3.6) 0.98 (0.3-2.9) 0.58 *ORs and 95% CIs by polytomous logistic regression compared with women with no CIN, adjusted for number of Pap smears, age and race. Login to comment

PMID: 17192492 [PubMed] Qu HQ et al: "Genetic control of alternative splicing in the TAP2 gene: possible implication in the genetics of type 1 diabetes."

No. Sentence Comment

83 TABLE 1 Transmission disequilibrium tests of the TAP2 SNPs SNP ID Position Minor allele (frequency) Hardy-Weinberg P Allele transmission counts (overtransmitted allele) ␹2 (P value) OR (95% CI)* rs2071552 (C/T) 5Ј UTR T (0.495) 0.395 431:279 (C) 32.5 (1.17 ϫ 10-8 ) 0.65 (0.56-0.75) rs1800454 (A/G) Exon 6 (I379V) A (0.100) 0.431 155:72 (G) 30.3 (3.61 ϫ 10-8 ) 0.47 (0.35-0.62) rs2228396 (A/G) Exon 10 (T565A) A (0.059) 1.000 61:46 (G) 2.1 (0.147) 0.75 (0.51-1.11) rs4148876 (C/T) Exon 12 (C651R) T (0.102) 1.000 163:79 (T) 29.2 (6.67 ϫ 10-8 ) 2.06 (1.58-2.70) rs241447 (A/G) Exon 12 (A665T) G (0.213) 0.190 332:143 (A) 75.2 (4.25 ϫ 10-18 ) 0.43 (0.35-0.52) rs241448 (C/T) Exon 12 (Q687Ter) C (0.215) 0.190 329:147 (T) 69.6 (7.31 ϫ 10-17 ) 0.45 (0.37-0.54) *Odds ratio of minor allele. Login to comment
84 TABLE 1 Transmission disequilibrium tests of the TAP2 SNPs SNP ID Position Minor allele (frequency) Hardy-Weinberg P Allele transmission counts (overtransmitted allele) ই2 (P value) OR (95% CI)* rs2071552 (C/T) 5b18; UTR T (0.495) 0.395 431:279 (C) 32.5 (1.17 afb; 10afa;8 ) 0.65 (0.56-0.75) rs1800454 (A/G) Exon 6 (I379V) A (0.100) 0.431 155:72 (G) 30.3 (3.61 afb; 10afa;8 ) 0.47 (0.35-0.62) rs2228396 (A/G) Exon 10 (T565A) A (0.059) 1.000 61:46 (G) 2.1 (0.147) 0.75 (0.51-1.11) rs4148876 (C/T) Exon 12 (C651R) T (0.102) 1.000 163:79 (T) 29.2 (6.67 afb; 10afa;8 ) 2.06 (1.58-2.70) rs241447 (A/G) Exon 12 (A665T) G (0.213) 0.190 332:143 (A) 75.2 (4.25 afb; 10afa;18 ) 0.43 (0.35-0.52) rs241448 (C/T) Exon 12 (Q687Ter) C (0.215) 0.190 329:147 (T) 69.6 (7.31 afb; 10afa;17 ) 0.45 (0.37-0.54) *Odds ratio of minor allele. Login to comment

PMID: 11960305 [PubMed] Balladares S et al: "Distribution of TAP gene polymorphisms and extended MHC haplotypes in Mexican Mestizos and in Seri Indians from northwest Mexico."

No. Sentence Comment

18 For TAP2, three dimorphic sites have been described: ILE379VAL, ALA565THR and ALA665THR; the different combinations result in eight distinct alleles, described in Table 1.3,4 Four of them have not been Correspondence: Dr C Gorodezky, Head of The Department of Immunogenetics, InDRE, SSA, Carpio 470-1st floor. Login to comment

PMID: 11781255 [PubMed] Harty LC et al: "HLA-DR, HLA-DQ, and TAP genes in familial Hodgkin disease."

No. Sentence Comment

35 It was necessary to exclude one family from analysis for one locus (TAP2 Ile379Val) because one parent was unavailable, the other parent and the offspring were heterozygous, and the transmitted allele could not be determined. Login to comment
66 Transmission-disequilibrium test results for linkage between familial Hodgkin disease and noncandidate alleles at HLA class II and transporter associated with antigen processing loci, National Cancer Institute, Bethesda, MD, 1978-1993 All familial HD (n ϭ 28) Familial NSHD only (n ϭ 23) Unaffected siblings (n ϭ 40)¶ T NT ␹2 P† T NT ␹2 P† T NT ␹2 P† DRB1 *0301 1 6 3.57 .24 - - - - 7 9 0.25 - *0401 5 4 0.11 - 3 4 0.14 Ͼ .99 11 5 2.25 .53 *1300 3 6 1.00 - 3 4 0.14 Ͼ .99 5 3 0.50 - All others‡ 36 29 - - 32 30 - - 13 14 - - Total 45 45 4.07 .25 38 38 0.23 .97 64 64 2.27 .52 DQA1 *0101 5 7 0.33 - 1 7 4.50 - 7 8 0.07 - *0102 19 9 3.57 .29 19 5 8.17 .02 18 20 0.11 - *0301 5 5 0.00 - 3 5 0.50 - 8 6 0.29 Ͼ .99 *0501 11 12 0.04 - 10 9 0.05 - 14 13 0.04 - All others‡ 3 10 - - 3 10 - - 9 9 - - Total 43 43 6.17 .19 36 36 13.59 .01 56 56 0.41 .98 DQB1 *201 3 11 4.57 .13 3 8 2.27 .53 9 13 0.73 - *0301 10 6 1.00 - 7 6 0.08 - 11 6 1.47 .90 *0302 2 5 1.29 - 2 5 1.29 - 7 4 0.82 - All others‡ 25 18 - - 21 14 - - 26 30 - - Total 40 40 6.00 .11 33 33 3.78 .29 53 53 2.48 .48 DRB1-DQA1-DQB1 *0301-*0501-*0201 1 6 3.57 .18 - - - - 7 9 0.25 - *0701-*0201-*0201 2 5 1.29 - 2 5 1.29 .77 4 6 0.40 Ͼ .99 All others‡ 42 34 - - 36 33 - - 46 42 - - Total 45 45 3.80 .15 38 38 0.71 .70 57 57 0.55 .76 DRB3-5 DRB3*0101 2 6 2.00 - - - - - 4 10 2.57 .54 DRB3*0202 7 5 0.33 - 5 5 0.00 - 8 5 0.69 - DRB4*0101 7 13 1.80 - 5 13 3.56 - 16 13 0.31 - DRB5*0101 16 6 4.55 .16 16 5 5.76 .08 12 15 0.33 - All others‡ 5 7 - - 5 8 - - 11 8 - - Total 37 37 7.20 .13 31 31 7.51 .11 51 51 3.50 .48 TAP1 Ile333Val Ile 14 6 3.20 .07 12 3 5.40 .02 15 13 0.14 .71 TAP1 Asp637Gly Asp 7 6 0.08 .78 5 4 0.11 .74 14 7 2.33 .13 TAP2 Ile379Val Ile 5 5 0.00 Ͼ .99 3 5 0.50 .48 9 3 3.00 .08 TAP2 Ala665Thr Ala 5 4 0.11 .74 3 4 0.14 .71 5 7 0.33 .57 Noncandidate alleles either were not significantly associated with sporadic Hodgkin disease or were not evaluated in the study by Klitz et al.16 TAP indicates transporter associated with antigen processing. Login to comment
33 It was necessary to exclude one family from analysis for one locus (TAP2 Ile379Val) because one parent was unavailable, the other parent and the offspring were heterozygous, and the transmitted allele could not be determined. Login to comment
64 Transmission-disequilibrium test results for linkage between familial Hodgkin disease and noncandidate alleles at HLA class II and transporter associated with antigen processing loci, National Cancer Institute, Bethesda, MD, 1978-1993 All familial HD (n afd; 28) Familial NSHD only (n afd; 23) Unaffected siblings (n afd; 40)&#b6; T NT ই2 Pߤ T NT ই2 Pߤ T NT ই2 Pߤ DRB1 *0301 1 6 3.57 .24 - - - - 7 9 0.25 - *0401 5 4 0.11 - 3 4 0.14 b0e; .99 11 5 2.25 .53 *1300 3 6 1.00 - 3 4 0.14 b0e; .99 5 3 0.50 - All othersߥ 36 29 - - 32 30 - - 13 14 - - Total 45 45 4.07 .25 38 38 0.23 .97 64 64 2.27 .52 DQA1 *0101 5 7 0.33 - 1 7 4.50 - 7 8 0.07 - *0102 19 9 3.57 .29 19 5 8.17 .02 18 20 0.11 - *0301 5 5 0.00 - 3 5 0.50 - 8 6 0.29 b0e; .99 *0501 11 12 0.04 - 10 9 0.05 - 14 13 0.04 - All othersߥ 3 10 - - 3 10 - - 9 9 - - Total 43 43 6.17 .19 36 36 13.59 .01 56 56 0.41 .98 DQB1 *201 3 11 4.57 .13 3 8 2.27 .53 9 13 0.73 - *0301 10 6 1.00 - 7 6 0.08 - 11 6 1.47 .90 *0302 2 5 1.29 - 2 5 1.29 - 7 4 0.82 - All othersߥ 25 18 - - 21 14 - - 26 30 - - Total 40 40 6.00 .11 33 33 3.78 .29 53 53 2.48 .48 DRB1-DQA1-DQB1 *0301-*0501-*0201 1 6 3.57 .18 - - - - 7 9 0.25 - *0701-*0201-*0201 2 5 1.29 - 2 5 1.29 .77 4 6 0.40 b0e; .99 All othersߥ 42 34 - - 36 33 - - 46 42 - - Total 45 45 3.80 .15 38 38 0.71 .70 57 57 0.55 .76 DRB3-5 DRB3*0101 2 6 2.00 - - - - - 4 10 2.57 .54 DRB3*0202 7 5 0.33 - 5 5 0.00 - 8 5 0.69 - DRB4*0101 7 13 1.80 - 5 13 3.56 - 16 13 0.31 - DRB5*0101 16 6 4.55 .16 16 5 5.76 .08 12 15 0.33 - All othersߥ 5 7 - - 5 8 - - 11 8 - - Total 37 37 7.20 .13 31 31 7.51 .11 51 51 3.50 .48 TAP1 Ile333Val Ile 14 6 3.20 .07 12 3 5.40 .02 15 13 0.14 .71 TAP1 Asp637Gly Asp 7 6 0.08 .78 5 4 0.11 .74 14 7 2.33 .13 TAP2 Ile379Val Ile 5 5 0.00 b0e; .99 3 5 0.50 .48 9 3 3.00 .08 TAP2 Ala665Thr Ala 5 4 0.11 .74 3 4 0.14 .71 5 7 0.33 .57 Noncandidate alleles either were not significantly associated with sporadic Hodgkin disease or were not evaluated in the study by Klitz et al.16 TAP indicates transporter associated with antigen processing. Login to comment

PMID: 8428770 [PubMed] Powis SH et al: "Alleles and haplotypes of the MHC-encoded ABC transporters TAP1 and TAP2."

No. Sentence Comment

52 A third variable site within the protein sequence of TAP2 was inferred from the cDNA sequence published by Bahrain and co-workers (1991), which contained the substitution Ile for Val at position 379. Login to comment

PMID: 11294565 [PubMed] Tang J et al: "Genotyping TAP2 variants in North American Caucasians, Brazilians, and Africans."

No. Sentence Comment

38 In particular, complete equilibrium between GGT386GGG, I379V, A665T, and Q687Stop further separated a number of protein-coding alleles into pairs of nucleotide sequences. Login to comment
79 The complexity of TAP2 polymorphisms, as implied in our identification Table 2 Frequency and heterozygosity of TAP2 single nucleotide polymorphisms (SNPs) observed in four ethnic groups SNP sequencesa T374A I379V I467V T565A C651R A665T Q687Stop GGT386GGG AAT436AAC Caucasians (n = 76) SNP frequencies: 1.000 0.816 1.000 0.993 0.947 0.849 0.849 0.814 0.908 0.000 0.184 0.000 0.007 0.053 0.151 0.151 0.184 0.092 Heterozygosity: Observed 0 31.6% 0 1.3% 10.5% 25.0% 25.0% 28.9% 18.4% Expected 0 30.0% 0 1.4% 10.0% 25.7% 25.7% 30.0% 16.7% Brazilians (n = 148) SNP frequencies: 0.980 0.868 0.983 0.899 0.960 0.676 0.676 nd nd 0.020 0.132 0.017 0.101 0.040 0.324 0.324 nd nd Heterozygosity: Observed 4.0% 25.0% 3.4% 20.3% 8.1% 54.7%b 54.7%b nd nd Expected 3.9% 22.9% 3.3% 18.2% 7.7% 43.8% 43.8% nd nd Rwandans (n = 285) SNP frequencies: 0.933 0.882 0.947 1.000 0.900 0.698 0.694 0.806 0.993 0.067 0.118 0.053 0.000 0.100 0.302 0.306 0.194 0.007 Heterozygosity: Observed 13.0% 22.5% 10.2% 0 18.6% 43.1% 45.3% 33.3% 1.4% Expected 12.5% 20.8% 10.0% 0 18.0% 42.2% 42.4% 31.3% 11.4% Zambians (n = 117) SNP frequencies: 0.932 0.898 0.949 0.817 1.000 0.765 0.752 0.778 0 0.068 0.102 0.051 0.183 0 0.235 0.248 0.222 0 Heterozygosity: Observed 13.7% 18.8% 10.3% 35.0% 0 40.2% 42.7% 33.3% 0 Expected 12.7% 18.3% 9.7% 29.9% 0 36.0% 37.3% 34.5% 0 Average 9.4% 23.5% 7.3% 11.5% 11.7% 43.1% 44.6% 32.6% 5.1% heterozygosity a At each codon position the less common amino acid or nucleotide sequence is listed first and/or underlined as defined in Figure 1. b P = 0.185 compared with the expected frequency. Login to comment
98 In addition, when cDNA served as the templates, PCR with combinations of the SNP-specific primers was able to link T374A, I379V with I467V, as well as T565A, C651R with A665T. Login to comment